ID: 1083946443

View in Genome Browser
Species Human (GRCh38)
Location 11:65925725-65925747
Sequence AGAGAGATGTGTCCTAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083946439_1083946443 5 Left 1083946439 11:65925697-65925719 CCACTCCTGGGTTAAACCTCTCA No data
Right 1083946443 11:65925725-65925747 AGAGAGATGTGTCCTAGGCATGG No data
1083946437_1083946443 16 Left 1083946437 11:65925686-65925708 CCCTGGCAGGTCCACTCCTGGGT No data
Right 1083946443 11:65925725-65925747 AGAGAGATGTGTCCTAGGCATGG No data
1083946438_1083946443 15 Left 1083946438 11:65925687-65925709 CCTGGCAGGTCCACTCCTGGGTT No data
Right 1083946443 11:65925725-65925747 AGAGAGATGTGTCCTAGGCATGG No data
1083946435_1083946443 17 Left 1083946435 11:65925685-65925707 CCCCTGGCAGGTCCACTCCTGGG No data
Right 1083946443 11:65925725-65925747 AGAGAGATGTGTCCTAGGCATGG No data
1083946440_1083946443 0 Left 1083946440 11:65925702-65925724 CCTGGGTTAAACCTCTCACAAGC No data
Right 1083946443 11:65925725-65925747 AGAGAGATGTGTCCTAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083946443 Original CRISPR AGAGAGATGTGTCCTAGGCA TGG Intergenic
No off target data available for this crispr