ID: 1083946446

View in Genome Browser
Species Human (GRCh38)
Location 11:65925737-65925759
Sequence TGCCACCTCAAACCATGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083946446_1083946450 13 Left 1083946446 11:65925737-65925759 CCTAGGCATGGTTTGAGGTGGCA No data
Right 1083946450 11:65925773-65925795 CCATCAATGGAGAACTGCCTGGG No data
1083946446_1083946453 28 Left 1083946446 11:65925737-65925759 CCTAGGCATGGTTTGAGGTGGCA No data
Right 1083946453 11:65925788-65925810 TGCCTGGGCAGAAGGCAACAGGG No data
1083946446_1083946452 27 Left 1083946446 11:65925737-65925759 CCTAGGCATGGTTTGAGGTGGCA No data
Right 1083946452 11:65925787-65925809 CTGCCTGGGCAGAAGGCAACAGG No data
1083946446_1083946448 12 Left 1083946446 11:65925737-65925759 CCTAGGCATGGTTTGAGGTGGCA No data
Right 1083946448 11:65925772-65925794 TCCATCAATGGAGAACTGCCTGG No data
1083946446_1083946451 20 Left 1083946446 11:65925737-65925759 CCTAGGCATGGTTTGAGGTGGCA No data
Right 1083946451 11:65925780-65925802 TGGAGAACTGCCTGGGCAGAAGG No data
1083946446_1083946447 0 Left 1083946446 11:65925737-65925759 CCTAGGCATGGTTTGAGGTGGCA No data
Right 1083946447 11:65925760-65925782 GAAAAATCAGTGTCCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083946446 Original CRISPR TGCCACCTCAAACCATGCCT AGG (reversed) Intergenic
No off target data available for this crispr