ID: 1083946447

View in Genome Browser
Species Human (GRCh38)
Location 11:65925760-65925782
Sequence GAAAAATCAGTGTCCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083946441_1083946447 24 Left 1083946441 11:65925713-65925735 CCTCTCACAAGCAGAGAGATGTG No data
Right 1083946447 11:65925760-65925782 GAAAAATCAGTGTCCATCAATGG No data
1083946446_1083946447 0 Left 1083946446 11:65925737-65925759 CCTAGGCATGGTTTGAGGTGGCA No data
Right 1083946447 11:65925760-65925782 GAAAAATCAGTGTCCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083946447 Original CRISPR GAAAAATCAGTGTCCATCAA TGG Intergenic
No off target data available for this crispr