ID: 1083946979

View in Genome Browser
Species Human (GRCh38)
Location 11:65929151-65929173
Sequence GACACAGACGTGAATCCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083946979_1083946981 -5 Left 1083946979 11:65929151-65929173 CCTGTCGGATTCACGTCTGTGTC No data
Right 1083946981 11:65929169-65929191 GTGTCTCCAGGATGTCTCACAGG No data
1083946979_1083946988 19 Left 1083946979 11:65929151-65929173 CCTGTCGGATTCACGTCTGTGTC No data
Right 1083946988 11:65929193-65929215 CCTGGCACGTGGTAGGTACGTGG No data
1083946979_1083946982 -4 Left 1083946979 11:65929151-65929173 CCTGTCGGATTCACGTCTGTGTC No data
Right 1083946982 11:65929170-65929192 TGTCTCCAGGATGTCTCACAGGG No data
1083946979_1083946985 8 Left 1083946979 11:65929151-65929173 CCTGTCGGATTCACGTCTGTGTC No data
Right 1083946985 11:65929182-65929204 GTCTCACAGGGCCTGGCACGTGG No data
1083946979_1083946986 12 Left 1083946979 11:65929151-65929173 CCTGTCGGATTCACGTCTGTGTC No data
Right 1083946986 11:65929186-65929208 CACAGGGCCTGGCACGTGGTAGG No data
1083946979_1083946984 1 Left 1083946979 11:65929151-65929173 CCTGTCGGATTCACGTCTGTGTC No data
Right 1083946984 11:65929175-65929197 CCAGGATGTCTCACAGGGCCTGG No data
1083946979_1083946989 22 Left 1083946979 11:65929151-65929173 CCTGTCGGATTCACGTCTGTGTC No data
Right 1083946989 11:65929196-65929218 GGCACGTGGTAGGTACGTGGTGG No data
1083946979_1083946990 23 Left 1083946979 11:65929151-65929173 CCTGTCGGATTCACGTCTGTGTC No data
Right 1083946990 11:65929197-65929219 GCACGTGGTAGGTACGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083946979 Original CRISPR GACACAGACGTGAATCCGAC AGG (reversed) Intergenic
No off target data available for this crispr