ID: 1083948188

View in Genome Browser
Species Human (GRCh38)
Location 11:65937842-65937864
Sequence CAGATTCTTGCCTGTTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083948186_1083948188 0 Left 1083948186 11:65937819-65937841 CCAATTATAGGCTATAACGTATG No data
Right 1083948188 11:65937842-65937864 CAGATTCTTGCCTGTTCTGGAGG No data
1083948183_1083948188 19 Left 1083948183 11:65937800-65937822 CCACCTTGATGTTATCACACCAA No data
Right 1083948188 11:65937842-65937864 CAGATTCTTGCCTGTTCTGGAGG No data
1083948184_1083948188 16 Left 1083948184 11:65937803-65937825 CCTTGATGTTATCACACCAATTA No data
Right 1083948188 11:65937842-65937864 CAGATTCTTGCCTGTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083948188 Original CRISPR CAGATTCTTGCCTGTTCTGG AGG Intergenic
No off target data available for this crispr