ID: 1083949793

View in Genome Browser
Species Human (GRCh38)
Location 11:65947608-65947630
Sequence CAGGACTCCCTGCAGAAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083949789_1083949793 5 Left 1083949789 11:65947580-65947602 CCACAGAGGAGGCTGAGGAGGGA 0: 1
1: 2
2: 58
3: 654
4: 3578
Right 1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083949793 Original CRISPR CAGGACTCCCTGCAGAAGGA GGG Exonic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
901787563 1:11634846-11634868 TAGGTCTCCCTCCAGGAGGAGGG + Intergenic
902032418 1:13432648-13432670 CAGATCTCCCTTCTGAAGGAAGG - Intergenic
902242821 1:15100178-15100200 CAGGAGTGCCTGGAGAAAGAGGG + Intronic
902571552 1:17350295-17350317 CAGCACTTCCTGCAGATAGAAGG + Intronic
903157758 1:21459840-21459862 CTGGACTCACTGCTGCAGGATGG - Intronic
903393551 1:22982139-22982161 GAGGAGACACTGCAGAAGGAGGG + Intergenic
903579934 1:24363173-24363195 AAGGACAGCCTGCAGAAGGCTGG + Intronic
904484728 1:30817165-30817187 CAGGACTCCTGGCAGAGGGGAGG - Intergenic
904732689 1:32606831-32606853 CAGGACTACCAGCTGCAGGAAGG - Intronic
907020221 1:51059749-51059771 CAGGACTACCAGCTGCAGGAAGG + Intergenic
907496139 1:54846031-54846053 CAGCAATCCCTGGAGAAGGAGGG + Intergenic
907562545 1:55403897-55403919 CAGGACTCCATGCTGGAAGATGG - Intergenic
907985358 1:59524591-59524613 CAGGACTACCAGCTGCAGGAAGG + Intronic
910096992 1:83534445-83534467 CAAGACTGGCTCCAGAAGGATGG - Intergenic
910900403 1:92114652-92114674 CCAGACCCCCTGAAGAAGGAGGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
912471179 1:109908047-109908069 CAGCACTCCTTGCCGATGGATGG + Intergenic
913544460 1:119853543-119853565 CCGGACTCACTGCTGCAGGATGG + Intergenic
913602338 1:120433830-120433852 CTGGACTCACTGCTGCAGGATGG - Intergenic
913991839 1:143620320-143620342 CCGGACTCACTGCTGCAGGATGG + Intergenic
914084710 1:144442807-144442829 CTGGACTCACTGCTGCAGGATGG + Exonic
914190720 1:145407973-145407995 CTGGACTCACTGCTGCAGGATGG + Intergenic
914333907 1:146698028-146698050 AAGGCTTCCCTGCAGAAGGATGG - Intergenic
914363511 1:146957436-146957458 CTGGACTCACTGCTGCAGGATGG - Intronic
914488165 1:148129698-148129720 CTGGACTCACTGCTGCAGGATGG + Intronic
914588529 1:149084818-149084840 CTGGACTCACTGCTGCAGGATGG + Intronic
915169583 1:153968507-153968529 CACGCCTTCCTGCAGAAGCATGG + Exonic
916553343 1:165871240-165871262 CAGGATACCCTGCACAAGGTGGG + Intronic
917124094 1:171670695-171670717 CGGGACTCACTGCTGCAGGATGG - Intergenic
917478554 1:175389831-175389853 TAGGAATCCCTCCAGAAGGCCGG - Intronic
917869899 1:179232048-179232070 CACCACTCTCTCCAGAAGGAAGG + Intergenic
918823215 1:189286261-189286283 CAGGACTCCTTGGAGAGCGATGG - Intergenic
919264033 1:195237993-195238015 CAGGACTACCAGCTGCAGGAAGG + Intergenic
919991783 1:202712276-202712298 CAGGACTCCAGCCAGAAAGAGGG + Intergenic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
920970803 1:210742331-210742353 CAGGACTTCCAGCTGAATGAAGG - Intronic
921161408 1:212474820-212474842 CAGGACTCCAAGCAGAAAGGGGG + Intergenic
921674662 1:217964872-217964894 CAGGACTACCAGCTGCAGGAAGG - Intergenic
921839040 1:219808953-219808975 TAGGTCTCCCTGCAGACTGATGG + Intronic
922559856 1:226561420-226561442 CAGGGCTGCATGCAGAATGAGGG + Intronic
922724004 1:227914260-227914282 TAGGACTTGCTGCAGAAGGCAGG + Intergenic
922781874 1:228259295-228259317 CAGGGCACCCTGCAGAATGGTGG - Intronic
923215325 1:231843530-231843552 CTGGCCTCCCTGCAGGGGGATGG - Intronic
923430953 1:233919849-233919871 CACTGCTCCCTGGAGAAGGATGG + Intronic
923654227 1:235901463-235901485 CTTGACTCCCAGGAGAAGGAGGG - Intergenic
924176835 1:241400088-241400110 CAGAGCTCCCTTCACAAGGAGGG - Intergenic
1062893419 10:1084116-1084138 AAGGTCTCACTGCAGAAGGGTGG - Intronic
1062909761 10:1205081-1205103 CAGGAGTCTCTGCAGAATGGCGG - Intronic
1063464548 10:6234271-6234293 CAGGGCTCACAGCAGAAGGCAGG - Exonic
1065434386 10:25692273-25692295 CAGGACTCCATGTGGCAGGAGGG - Intergenic
1066455413 10:35567905-35567927 CAGGAAGTCCTGCAGAGGGAGGG - Intronic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1068225541 10:54103001-54103023 GAGGCCTCCTTGGAGAAGGATGG + Intronic
1068983322 10:63084177-63084199 CAGGACACCCTGTGGGAGGAGGG + Intergenic
1070409420 10:76125719-76125741 CAGGACTGCATGCAGCTGGAGGG + Intronic
1070838670 10:79468229-79468251 CTGCACACCCTGGAGAAGGAAGG + Intergenic
1070973014 10:80582801-80582823 CAGGACTGCCTGCAGCAAGCAGG - Intronic
1071722847 10:88164738-88164760 CAGTACTCCCAGCACAAAGAGGG - Intergenic
1071954560 10:90743671-90743693 CAGGAGGGCCTGCACAAGGAGGG - Exonic
1072046928 10:91666633-91666655 CAGACCTCCCTGAAGAAGGAGGG - Intergenic
1072085574 10:92076258-92076280 CTGGGCTCCCATCAGAAGGAAGG + Intronic
1073435986 10:103516377-103516399 CAGGACCCCAAGCAGAAGGCGGG + Intronic
1073845101 10:107545294-107545316 TAGGACTACCAGCAGAGGGAGGG + Intergenic
1074106013 10:110390179-110390201 CAGGTCCCCCAGCAGCAGGAGGG - Intergenic
1074412395 10:113239682-113239704 CAGGACTCCCTGTCTCAGGATGG - Intergenic
1074919208 10:117990169-117990191 CAAGTCTCCCTGCAGAGGGATGG - Intergenic
1076076246 10:127535971-127535993 CAGGAATCCCTCCACCAGGACGG - Intergenic
1076334878 10:129699758-129699780 GAGGTCTTCCTGGAGAAGGACGG - Intronic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1076924347 10:133474881-133474903 CAACCCTCCCTGCAGGAGGATGG - Intergenic
1077148648 11:1057856-1057878 CAGGACTTCATGCTGAATGAAGG - Intergenic
1079089225 11:17469101-17469123 CAAGACTCCATCTAGAAGGAAGG - Intronic
1079408921 11:20168320-20168342 CAGGTCTCTCTGCCCAAGGATGG - Intergenic
1080380868 11:31771186-31771208 CACCACTCCCCACAGAAGGAGGG + Intronic
1081072597 11:38629701-38629723 GAGGTCTCCCTGGAGAAGGTTGG - Intergenic
1083637617 11:64128994-64129016 CAGGACTTCCTGGGGAAGGGTGG - Intronic
1083679407 11:64344297-64344319 CAGGAGTCCCCGGAGAAGGCTGG + Exonic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1083954896 11:65977813-65977835 CAGGACTTCAAGGAGAAGGACGG + Exonic
1084568450 11:69944746-69944768 CAGGACTCCCTGGAGCAAAATGG + Intergenic
1085542600 11:77286471-77286493 GAGGTTTCCCTGCAGTAGGAAGG - Intronic
1087158172 11:94924312-94924334 CAGCACTCGCTGCAGGAGGGTGG + Intergenic
1088194832 11:107262788-107262810 CAGGACTTCATGCAGAAGTAGGG + Intergenic
1088250398 11:107857094-107857116 AAGGTCACCCAGCAGAAGGAAGG + Intronic
1089076705 11:115744356-115744378 TAGGACTCCCTTTAGAAGAAAGG + Intergenic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1090630680 11:128644483-128644505 CAGCAGTCCATGCAGAAGGGAGG + Intergenic
1090976141 11:131682433-131682455 CAGGACTCCCTGCAGCCGATGGG - Intronic
1091037829 11:132249380-132249402 AAGAACTCCCTGGAGAAGGCAGG + Intronic
1091309329 11:134561396-134561418 CAAGACTCCCTCCAGAAAGGAGG - Intergenic
1094224758 12:28032593-28032615 CAGGACACCCTGGAGAGTGAAGG + Intergenic
1096243630 12:49972668-49972690 CAGGACCCCCTGAAGCAGGCCGG + Intronic
1096415219 12:51406880-51406902 CAGTTCTCCCTGCAGAAGCCGGG + Intronic
1096776970 12:53970195-53970217 CAGGACTCAAAGCAGATGGAGGG + Intergenic
1100510136 12:95262937-95262959 CAGGACTTCCTGTTGCAGGATGG - Exonic
1100950812 12:99847469-99847491 CAGGACTCCTTCTAGAATGAGGG - Intronic
1102717926 12:114990230-114990252 AAGGTCTCCCTGCAGGAGCAGGG + Intergenic
1103397527 12:120619427-120619449 AAAGAATCCCTGCAGAAAGAAGG - Intergenic
1104110394 12:125699033-125699055 TAGGAGACCCAGCAGAAGGAAGG + Intergenic
1105502961 13:20988626-20988648 CGGGACTCCCTGCAGAAGCCGGG - Exonic
1107662342 13:42651541-42651563 CAAATCTACCTGCAGAAGGAGGG - Intergenic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1112097208 13:96147410-96147432 CAGGACCTGCTGCAGAATGATGG - Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1112778036 13:102866618-102866640 CAGGAGTTCCTGCAGAGTGAGGG - Exonic
1114567185 14:23641357-23641379 CTGGAGTCGCTGGAGAAGGATGG - Intronic
1114679296 14:24471254-24471276 CAGGACTCACTGTAAAAGTATGG - Intergenic
1115662708 14:35512728-35512750 CAGGAGCACCTGCAGAAGAAGGG - Intergenic
1118764433 14:68900403-68900425 CTGGACTCCCTGGAGAAGGCAGG + Intronic
1119188344 14:72660960-72660982 CAGGAGTCCCTGCCGCATGACGG + Intronic
1119318070 14:73712593-73712615 CAGGCCTAACTGCAGAAGGGTGG + Exonic
1119661319 14:76454062-76454084 CAAGAGTCCCTGCAGAGAGAAGG + Intronic
1121270899 14:92637546-92637568 CAGGACCCTCTGGAGAAGGGAGG + Intronic
1121583260 14:95046161-95046183 GAGGACTCCAGGCAGAAAGAAGG - Intergenic
1122274682 14:100585486-100585508 CAGGAGTGCCTGCAGGAGTAGGG + Intronic
1122546335 14:102524701-102524723 CAGGAGTCCCTGCAGGAGTTGGG + Intergenic
1123020160 14:105394280-105394302 CAGGGCTGCCTGCAGGTGGAAGG - Intronic
1123625375 15:22223472-22223494 CAGGAGGCCGAGCAGAAGGAGGG - Intergenic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1127289160 15:57554833-57554855 TAGGACTCCCTGCAGAGCGAGGG + Intergenic
1130066284 15:80607706-80607728 CTGGACTTTCTGCAGAAGCACGG + Intergenic
1130396987 15:83511275-83511297 CAGGACTACAGGCAGAAGTAGGG + Intronic
1130857939 15:87857842-87857864 AAGGACTTCCTGAAGAAAGATGG + Intergenic
1130932401 15:88438930-88438952 CAGGGCTCCCAGCAGCTGGAAGG - Intergenic
1132119258 15:99162621-99162643 TAGGACTCCCTGCAAAAAGCTGG + Intronic
1132207141 15:99993927-99993949 CAGGATTCCCAGCAGCAAGAAGG + Intronic
1132305003 15:100804743-100804765 CAGAAACCCATGCAGAAGGAGGG + Intergenic
1132465775 16:76904-76926 CAGGACTTCCTGGGGAGGGAGGG - Intergenic
1132890304 16:2200447-2200469 GAGGACTCCATGCATAAGGCAGG + Intergenic
1133572520 16:7055516-7055538 CAGCACTCTCATCAGAAGGAAGG + Intronic
1133749171 16:8711583-8711605 CAGGACACCCTGCTGAACCAGGG + Intronic
1139999711 16:71013221-71013243 AAGGCTTCCCTGCAGAAGGATGG + Intronic
1140035333 16:71367459-71367481 AAGGGCTTCCTGCAGATGGATGG + Intronic
1140479390 16:75254217-75254239 CAGCCCACCCTGCAGCAGGAAGG + Intronic
1140663843 16:77211815-77211837 CAGGTATCGGTGCAGAAGGAAGG + Intronic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1142674295 17:1504085-1504107 CAGAACTCCGTGCAGAAGGTTGG - Intronic
1143130808 17:4675839-4675861 CAGGATTTCCTGCACAGGGACGG + Exonic
1143145681 17:4773658-4773680 CAAGAATCCATGCAGGAGGAGGG - Intronic
1143174064 17:4946708-4946730 CGGGACTCACTGCTGCAGGATGG - Exonic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1144754664 17:17671810-17671832 CAGGACAACCTGAAGAAGGTGGG + Intergenic
1145722261 17:27083955-27083977 CAGCAGACCCTGCAGCAGGAAGG + Intergenic
1146400457 17:32496774-32496796 CTGGACTCCCTGCACAGGGAAGG - Intronic
1146478801 17:33185693-33185715 CAGTACTCCATGAAGAATGAAGG - Intronic
1147949542 17:44099332-44099354 CACCACTCCCAGGAGAAGGAAGG - Intronic
1148053662 17:44781138-44781160 CAGAACTCCCTGCCGAGTGAGGG - Exonic
1148111695 17:45148212-45148234 CACGACTCGCTGAGGAAGGACGG - Intergenic
1148131850 17:45266930-45266952 GAGGACCCCCACCAGAAGGAAGG + Intronic
1148606161 17:48930593-48930615 CAGGAACACCTGCTGAAGGAAGG - Exonic
1151598968 17:75094743-75094765 CGGGACTCCCTGCAGAGAGGAGG + Intronic
1151923605 17:77176415-77176437 CAGGACTCTCTCCAGATTGAAGG + Intronic
1152680428 17:81665168-81665190 CTGGACTCCCTACCGCAGGACGG - Exonic
1152951038 17:83231756-83231778 CAGGAATCCAGACAGAAGGAGGG + Intergenic
1153131476 18:1859140-1859162 GAGGTCTCCCTGGGGAAGGATGG + Intergenic
1153522759 18:5967810-5967832 CAGGACTCCCTGGGGCAGGAGGG + Intronic
1155252815 18:23967950-23967972 CAGGACTCCCTGGTGAAATAAGG - Intergenic
1155819208 18:30353119-30353141 CAGGACTACCAGCTGCAGGAAGG + Intergenic
1156338469 18:36189386-36189408 CAAGACTCCCAGCAGTGGGAGGG - Intronic
1157555598 18:48611018-48611040 CAGGGGTCCCTGGAGAAGGCAGG + Intronic
1157719868 18:49915458-49915480 GTGGATTCCCTTCAGAAGGAAGG + Intronic
1159027577 18:63200092-63200114 GAGGGCTTCCTGCAGAACGAAGG - Intronic
1160016107 18:75141853-75141875 CAGGAGAGCCTGCAGCAGGAAGG - Intergenic
1160787096 19:905723-905745 CAGGGCTGCCTGAAGCAGGAAGG + Intronic
1162141254 19:8586685-8586707 CAGGAGTCCCTGCTGCTGGAGGG - Exonic
1162609709 19:11739352-11739374 CAGGCCACCCTGCAGCAGGAGGG + Intergenic
1162680114 19:12334058-12334080 CAGGCCACACTGCAGCAGGAGGG + Intergenic
1162689185 19:12414504-12414526 CAGGCCACCCTGCAGCAGGAGGG + Intronic
1164576699 19:29409337-29409359 TCGGACTCCCTGCCGCAGGAGGG + Intergenic
1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG + Intronic
1165188239 19:34040151-34040173 AAGGCCTCCCTGCTGAAGGCCGG - Intergenic
1165828634 19:38719694-38719716 CAGGCCTCCATGGATAAGGACGG - Intronic
1166118997 19:40673741-40673763 CAGGACTCACTGGGCAAGGAAGG - Intronic
1167359589 19:49023177-49023199 CAGGACCCCCTGCAGCACGCGGG + Exonic
1167361540 19:49032908-49032930 CAGGACCCCCTGCAGCACGCGGG - Exonic
1167362112 19:49035877-49035899 CAGGACCCCCTGCAGCACGCGGG + Exonic
1167363973 19:49044981-49045003 CAGGACCCCCTGCAGCACGCGGG - Exonic
1167364527 19:49047946-49047968 CAGGACCCCCTGCAGCACGCGGG + Exonic
1167365813 19:49054582-49054604 CAGGACCCCCTGCAGCACGCGGG + Exonic
1167422593 19:49412987-49413009 CAGCGCACCCTGAAGAAGGAAGG + Exonic
1167776500 19:51561103-51561125 GAGGTCTCCCTGGAGGAGGAGGG + Intergenic
1168592302 19:57647398-57647420 CAAGACACACTGCTGAAGGATGG + Intergenic
925010951 2:485847-485869 CAGGTCTCGGGGCAGAAGGAGGG - Intergenic
925497162 2:4464825-4464847 CACGACGCCTTGCAGAGGGAGGG + Intergenic
927154071 2:20211848-20211870 CAGGGCTCCCCACAGAGGGAAGG - Intronic
927204529 2:20598912-20598934 CAGTACTCCCTGGAGAAGAAAGG - Intronic
927491073 2:23521280-23521302 CAGCTCTGCCTGCAGGAGGAAGG + Intronic
927495019 2:23546304-23546326 CAGGGGACCCTGCAGAATGAGGG + Intronic
927587524 2:24320872-24320894 CAGGACTCCAAGCAGCAGGTTGG - Intronic
927757047 2:25717229-25717251 CAGGACTGTCTAGAGAAGGAAGG - Intergenic
927896892 2:26788536-26788558 CAAGACCCCATGTAGAAGGAAGG - Intronic
928359520 2:30651750-30651772 CAGGCCTCGCTCCAGAACGATGG + Intergenic
928646250 2:33355804-33355826 TAGGCCTCACTGCAGAGGGATGG - Intronic
931232582 2:60387230-60387252 CAGGAATCCCAGCAGAATCAGGG + Intergenic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
932322990 2:70835492-70835514 AAGGACGGCCTGCAGCAGGACGG + Exonic
932408183 2:71528210-71528232 CAGGACTGCCTGGAGACAGATGG + Intronic
932491906 2:72127847-72127869 CACGACTCCCTGCGGAAGCTGGG + Intergenic
932714405 2:74090843-74090865 CAGGAGCCCAGGCAGAAGGAAGG - Intronic
933239415 2:79903333-79903355 CAGGACTGCAAGCAGAAGGCAGG - Intronic
933762403 2:85681426-85681448 CAGGAATCCCAGAAGACGGAGGG + Intergenic
934936643 2:98470436-98470458 CATGCCTCCCTGCGGAGGGAAGG - Intronic
936967977 2:118146057-118146079 AAGGGCTCCCTGCACAAGCACGG - Intergenic
939672460 2:145029958-145029980 TAGCACTTCCTGCAGAAAGAAGG - Intergenic
941145254 2:161835945-161835967 CAGGACTCAAAGCAGAAGGATGG - Intronic
943564605 2:189503074-189503096 CAGGTCTCCCTGAAGGAAGAGGG - Intergenic
943928472 2:193819486-193819508 CAGGACTACCAGTAGCAGGATGG - Intergenic
944347233 2:198684216-198684238 CAGGCTGCCCTGCTGAAGGAAGG - Intergenic
947668516 2:231922457-231922479 CAGGCCTTCCTGCAGAGGGGAGG + Intronic
948316813 2:237033680-237033702 CGAGACTCCTTGAAGAAGGATGG - Intergenic
948434558 2:237944271-237944293 CAGGACTACCAGCTGCAGGAAGG + Intergenic
948593180 2:239064030-239064052 CAGGAGTCACTGCAGAGAGACGG + Intronic
1170327880 20:15176499-15176521 CAGGACTACCAGCTGCAGGAAGG + Intronic
1170495662 20:16922264-16922286 CAGAACTCTCTGCAAAAGAAAGG + Intergenic
1170764079 20:19275293-19275315 CAGCATTCCCTGCAAGAGGATGG + Intronic
1170804467 20:19617616-19617638 CAAGACTGCCTGCAGGAGGGCGG + Intronic
1171216821 20:23358228-23358250 CAGGGCTCCTTGGAGACGGAGGG - Intergenic
1173201757 20:40959949-40959971 TATGCCTCCCTGCAGGAGGAGGG + Intergenic
1173598935 20:44279211-44279233 AAGGACGCCCCGAAGAAGGATGG - Exonic
1174478728 20:50815864-50815886 CACGCCTCCCTGGAGCAGGACGG + Intronic
1175133452 20:56806436-56806458 CAGGCCTCTCTGAGGAAGGAGGG - Intergenic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1178856849 21:36257456-36257478 CAGGACCCTCTCCAGAATGAGGG + Intronic
1179397696 21:41056527-41056549 CAGTATTCCCTGCATAAGGCTGG + Intergenic
1180836101 22:18930305-18930327 CAGGAATCCCTGCAAAAGAGAGG - Intronic
1181030599 22:20147418-20147440 CTGGACCCCCTGCAGCAGGTGGG - Exonic
1181316535 22:21974317-21974339 CAGAACTCCCTTCAGTAGGATGG + Intronic
1181512711 22:23395963-23395985 CTGGACCCCCTGCAGCAGGTGGG + Intergenic
1182021241 22:27083397-27083419 CAGAATCCCCTGCAGAAGGGAGG - Intergenic
1182331591 22:29554963-29554985 CAGGTGGCCCTGCAGAATGAGGG + Exonic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1183737907 22:39654003-39654025 CAGGCCTCCCTGGAGAAGCCTGG - Intronic
1185210530 22:49568351-49568373 CAGCACTCCCTGCAGCAGTGGGG + Intronic
1185393186 22:50573519-50573541 CAGCCCTCACTGCAGGAGGAAGG - Exonic
1203286193 22_KI270734v1_random:155604-155626 CAGGAATCCCTGCAAAAGAGAGG - Intergenic
950860557 3:16144358-16144380 CAAGAGACCCTGCAGAAAGAAGG + Intergenic
954235809 3:49256400-49256422 CAGGATTCCATGCAGCAGGGAGG - Exonic
956605659 3:71070670-71070692 CCAGACTCCCAGCTGAAGGAGGG + Intronic
957974627 3:87427415-87427437 CAGGACTCACTACATCAGGATGG + Intergenic
960408073 3:117286156-117286178 CAGGACACCCTGAAGAACAAGGG - Intergenic
960738892 3:120811083-120811105 TAAGACTCCCTGGAGAAGGAAGG + Intergenic
960974446 3:123161146-123161168 CAGGACTCCTTGGAGACTGATGG - Intronic
961722794 3:128907536-128907558 CAGGACTCCCTACAGGAAAAGGG - Intronic
963080907 3:141393015-141393037 CAGGAATTGCTGCAGAAGCAAGG - Intronic
964292068 3:155192609-155192631 CAGGATTCCCAGAAGAGGGAAGG - Intergenic
965993119 3:174845191-174845213 CAGGACTCTCTTCAGCAAGATGG + Intronic
966152166 3:176877106-176877128 CAGGGCTCCCCCCAGAGGGAGGG + Intergenic
966462127 3:180188334-180188356 TAGGAATCCCAGCAGAAAGAAGG + Intergenic
967154722 3:186681896-186681918 CTGGAGTCCCTGGAGAAGAAGGG - Intergenic
968054518 3:195681338-195681360 CAGCCCACCCTGCAGAAGGCAGG - Intergenic
968101373 3:195967820-195967842 CAGCCCACCCTGCAGAAGGCAGG + Intergenic
968512171 4:1000598-1000620 GTGGACCCCCTGCAGAAGGACGG - Exonic
968521788 4:1037516-1037538 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968521808 4:1037596-1037618 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968800823 4:2742374-2742396 CAGAACCCCCTGCAGAGGGCGGG - Exonic
969464915 4:7350604-7350626 CAGGACTCCCGGCAGGCGGCAGG + Intronic
969652788 4:8477796-8477818 GAGCTCTCCCTGCAGCAGGAAGG + Intronic
971253674 4:24994418-24994440 CCGGACTCCCTCCACAGGGAAGG - Intergenic
971640082 4:29119932-29119954 CAGTACTCAAAGCAGAAGGAGGG + Intergenic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
975733895 4:77363457-77363479 GAGGTCTCCTTGGAGAAGGACGG + Intronic
976563664 4:86529740-86529762 CAGAAAGCCCTGCAGAAGGATGG + Intronic
977560440 4:98527749-98527771 CAGGGCTCCCTGGAAAAGCATGG + Intronic
977775348 4:100913132-100913154 AAGGAGTCCCTGCAGCAGAAGGG - Intergenic
977895526 4:102360730-102360752 CAGGACTGCTTGAAGACGGATGG - Intronic
979576083 4:122293874-122293896 CCGGACTCCCTGGAGCAGGCAGG - Intronic
980640460 4:135570711-135570733 GAAGACTCTCTGAAGAAGGACGG + Intergenic
982203258 4:152978058-152978080 CAGGCTTCCCTGCAGATGGGTGG + Exonic
982264308 4:153524281-153524303 TAGGTCTCTCAGCAGAAGGAGGG + Intronic
982802578 4:159722925-159722947 CAGGACTACCAGCTGCAGGAAGG - Intergenic
985501579 5:251140-251162 CAGCCCACCCTGCAGAAGGAAGG - Intronic
985723460 5:1502627-1502649 CAGGACTCCGTGTAGAGGGGCGG + Intronic
985735300 5:1576485-1576507 CAGCCCACCCTGCAGAAGGCAGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988107567 5:26771101-26771123 GAGGTCTCCTTGCGGAAGGATGG - Intergenic
988480569 5:31627022-31627044 AAGGAGTACCTGCAGAGGGAGGG + Intergenic
989817781 5:45757189-45757211 CAGGAATCACAGCAGAAGGCTGG - Intergenic
991488890 5:67164888-67164910 CAGGGCTCCTGGCAGTAGGATGG - Exonic
992130964 5:73692690-73692712 CGGCCCTCCCTGCAGAAGGCTGG - Intronic
995755849 5:115503168-115503190 CAGAAGTGCCTGCAGAAGGTAGG + Intergenic
996153989 5:120075631-120075653 CAGGCCTCTATTCAGAAGGATGG + Intergenic
996810049 5:127506674-127506696 CAGGACTCCATTCAGCAAGAGGG + Intergenic
997582273 5:135025415-135025437 CAGGACACCCTGCAGAGGTGGGG + Intergenic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
999685968 5:154103495-154103517 CAAGACGCACAGCAGAAGGAAGG - Intronic
999717883 5:154376522-154376544 GATGGCTCCCTGCAGCAGGAGGG - Intronic
1000230456 5:159310781-159310803 CAGCGCTTCCCGCAGAAGGAGGG + Intergenic
1002313753 5:178330170-178330192 CTGCCCTCCCTGCAGAAGAAGGG + Intronic
1002871097 6:1167835-1167857 CACCAAGCCCTGCAGAAGGAGGG + Intergenic
1003426873 6:6003543-6003565 CAGGACTCCCTGCAGAGAGCAGG + Intronic
1003443063 6:6161157-6161179 CGGGCCTCCCTGCATGAGGAAGG + Intronic
1004253639 6:14043203-14043225 CAGGAGTCCCTGCATGAGGATGG + Intergenic
1006025316 6:31143115-31143137 CAGGCCACCTTGCAGCAGGAAGG - Exonic
1006657673 6:35610082-35610104 CAGGCCTTTCTGCAAAAGGATGG + Intronic
1007092457 6:39192703-39192725 GAAGGCTCCCTGCAGCAGGAGGG - Intronic
1007318422 6:41008661-41008683 CACTTCTCCCTGCAGAAGGGAGG - Intergenic
1008231620 6:48990311-48990333 CAGGACTACCAGCAGTTGGAAGG + Intergenic
1010927939 6:81766186-81766208 CAGGACTCCAGGAAGAAGAAAGG - Intergenic
1011509847 6:88088383-88088405 CAGGAGAACCTGCAGAAGGGAGG + Intergenic
1011896420 6:92232285-92232307 CTGGATTCACTGCACAAGGAGGG + Intergenic
1012433112 6:99186808-99186830 CAAGAGTCCCTGAAGAGGGATGG - Intergenic
1013466982 6:110426494-110426516 CTGGCCTCCCTCCAGGAGGAGGG - Intronic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1014829347 6:126083278-126083300 CAGTACTCCAGGCAGAAAGAAGG - Intergenic
1015370053 6:132440305-132440327 CAAGACACCCTCCAGAGGGATGG + Intergenic
1018762722 6:166905557-166905579 CAGGTCTCCCTGAAGAGGGATGG + Intronic
1018911055 6:168101162-168101184 CAGGGCTCCTTCCAGAAGGCAGG + Intergenic
1019475658 7:1242882-1242904 CAGGCGTTCCTGCAGTAGGAGGG + Intergenic
1020659588 7:10966299-10966321 CAGGACTACCTGCCTGAGGATGG - Intergenic
1020979251 7:15047022-15047044 TGGCACTCCCTGGAGAAGGAGGG + Intergenic
1021889298 7:25171963-25171985 CAGGAATCCTTTCAGTAGGAAGG + Intronic
1023758838 7:43444946-43444968 AAGGACTCCTCGGAGAAGGATGG + Exonic
1023760690 7:43462656-43462678 GAGGGCGCCCTGCAGTAGGATGG - Intronic
1024430812 7:49285897-49285919 CAGGACTTACTGAGGAAGGAGGG + Intergenic
1024960722 7:54971830-54971852 CAGCTGTCCCTGCAGAAAGATGG - Intergenic
1025156079 7:56606695-56606717 GAGGTCTCCTTGGAGAAGGATGG + Intergenic
1026370149 7:69691070-69691092 CAGGACTACCAGCTGCAGGAAGG - Intronic
1026575935 7:71571560-71571582 CAGGTTTCCCTACATAAGGAGGG - Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027233153 7:76283323-76283345 CAGGAGGCCACGCAGAAGGAAGG + Intronic
1027903403 7:84148365-84148387 CAGAGCTCCGTGCGGAAGGATGG + Intronic
1028979121 7:96947320-96947342 CAGGGCTCCTTGCAGAAGCTTGG + Intergenic
1030018184 7:105245276-105245298 CAGGACCCTCTGCAGTGGGATGG + Intronic
1030461734 7:109845631-109845653 GTGGACTCACTACAGAAGGAAGG - Intergenic
1030566505 7:111164268-111164290 CAGCACTCCCTGCAATAGGTTGG - Intronic
1032008407 7:128323583-128323605 CACGAATCACTGCAGAAAGAGGG + Exonic
1032189570 7:129756413-129756435 CAGGAGTCCCTTCTGAAGCAGGG - Exonic
1032512722 7:132484741-132484763 CAGAAAGCCCTGCAGATGGATGG - Intronic
1034256023 7:149725040-149725062 CAGGAATCACTGCAAAACGAAGG - Intronic
1034543948 7:151777461-151777483 CAGGACTCACTGCCGCAGGGAGG - Intronic
1034825225 7:154256320-154256342 CAGGGGCCCCTGCAGAAGGCAGG + Intronic
1035031830 7:155865859-155865881 CAGAACTGCCTCCAGAAGGAAGG + Intergenic
1035616797 8:1007953-1007975 CAGGACGCCCTCCATAAAGAAGG + Intergenic
1035993796 8:4522754-4522776 CAGGACTCCTTCATGAAGGATGG - Intronic
1036907655 8:12720546-12720568 CAGGACTACCAGCTGCAGGAAGG + Intergenic
1037305172 8:17497086-17497108 CCGGCCGCGCTGCAGAAGGAGGG - Intronic
1037920487 8:22802155-22802177 CAGAACCCGCTGCAGGAGGAGGG + Intronic
1039424596 8:37475713-37475735 CAGGACTGTGTGCAGGAGGATGG + Intergenic
1040866104 8:52050436-52050458 CAGGCCTCCCTGCAGGGGAAGGG + Intergenic
1042794402 8:72644943-72644965 CAGGAGTCTATGCTGAAGGATGG + Intronic
1044006261 8:86940510-86940532 CACAACTGCCTGAAGAAGGAGGG + Intronic
1045685567 8:104708097-104708119 CAGGTGTCCCTGGAGAAGTAGGG + Intronic
1047039602 8:120978311-120978333 AAGAACTACCTGCAGTAGGAAGG + Intergenic
1048339093 8:133525309-133525331 CAGGACTACCAGCTGCAGGAAGG - Intronic
1048444615 8:134484097-134484119 CAGGACACCCTCCTTAAGGAAGG + Intronic
1048736595 8:137508906-137508928 CTGAATTCCCTGCTGAAGGATGG - Intergenic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049296870 8:141845448-141845470 CAGGATTCTCTGTAGAGGGAGGG - Intergenic
1050682140 9:8124133-8124155 CAGCACTCCCAGAGGAAGGAGGG - Intergenic
1052227412 9:26106946-26106968 GAGGTCTCCTTGCAGAAGGATGG - Intronic
1052368447 9:27639408-27639430 GAGGTCTCCTTGGAGAAGGATGG - Intergenic
1057185540 9:93055633-93055655 GAGGGCTCCATGGAGAAGGAGGG + Intergenic
1057270452 9:93647378-93647400 CAGCTGTCCCTGCAGAAGCAGGG + Intronic
1057316730 9:93974004-93974026 GAGGTCTCCCTGGGGAAGGATGG - Intergenic
1058056437 9:100453785-100453807 CATGAGGCCATGCAGAAGGAAGG + Intronic
1059364485 9:113775353-113775375 AAGGCCTCTCTGCAGTAGGAGGG + Intergenic
1059953174 9:119489019-119489041 CAGGACTGTCTGCAGAAGGAAGG - Intergenic
1059959331 9:119550007-119550029 CAGGAATCCCCACAGAAGTATGG + Intergenic
1060340131 9:122767943-122767965 CAGAACTCCCTGGAGCAGGAAGG - Intergenic
1060759056 9:126233447-126233469 CCAGACTCCCTGAAGAAGGAGGG - Intergenic
1061017276 9:127989179-127989201 CTGGCCTCCCAGCTGAAGGAGGG - Intergenic
1061408954 9:130407987-130408009 CAGCACTACCTGCAGCTGGATGG + Intronic
1061712364 9:132497208-132497230 CTGGACTGCCAGCAGAGGGAAGG + Intronic
1062273453 9:135720121-135720143 CAGGAATGGGTGCAGAAGGAGGG + Intronic
1062380820 9:136285741-136285763 CAGGCCTCTCTGCTGGAGGAAGG + Intronic
1185458784 X:324101-324123 CAGGAGGCCGCGCAGAAGGAGGG + Intergenic
1189248486 X:39581552-39581574 CAGGGCTCCCTCCAGAATCAAGG + Intergenic
1189427844 X:40917647-40917669 AATGACACCCTGCAGAAGCAAGG + Intergenic
1189975403 X:46456821-46456843 CAGGACTTCCTGTTGCAGGATGG + Intronic
1190996944 X:55618898-55618920 GAGGTCTCCTTGCGGAAGGATGG + Intergenic
1194032187 X:88831281-88831303 GAGGTCTCCTTGCAGAAGGTTGG + Intergenic
1195626641 X:107010395-107010417 CTTGACTCACTGCAGAAGGCTGG - Intergenic
1198503797 X:137281028-137281050 CTGGATTCCCTGCATAGGGATGG + Intergenic
1198650625 X:138860232-138860254 CAGGGCTCCCTCAAGTAGGATGG + Intronic
1200133514 X:153863797-153863819 CAGGAGGCCTTGCAGAAGGGTGG + Intronic
1201762920 Y:17558513-17558535 CAGGGCTCCCACCAGAGGGAAGG + Intergenic
1201838632 Y:18347476-18347498 CAGGGCTCCCACCAGAGGGAAGG - Intergenic