ID: 1083950560

View in Genome Browser
Species Human (GRCh38)
Location 11:65953427-65953449
Sequence AAACCCTACTCCCAGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083950554_1083950560 24 Left 1083950554 11:65953380-65953402 CCGAGGGCTGAGCCTCCAGGGCA 0: 1
1: 1
2: 2
3: 49
4: 386
Right 1083950560 11:65953427-65953449 AAACCCTACTCCCAGGACACTGG 0: 1
1: 0
2: 2
3: 11
4: 156
1083950557_1083950560 9 Left 1083950557 11:65953395-65953417 CCAGGGCAGTCTCTGTCATGGAC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1083950560 11:65953427-65953449 AAACCCTACTCCCAGGACACTGG 0: 1
1: 0
2: 2
3: 11
4: 156
1083950555_1083950560 12 Left 1083950555 11:65953392-65953414 CCTCCAGGGCAGTCTCTGTCATG 0: 1
1: 0
2: 1
3: 21
4: 223
Right 1083950560 11:65953427-65953449 AAACCCTACTCCCAGGACACTGG 0: 1
1: 0
2: 2
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083950560 Original CRISPR AAACCCTACTCCCAGGACAC TGG Intronic
901347144 1:8555173-8555195 AAACTCTTCTCTCAGGCCACAGG - Intronic
901749632 1:11397788-11397810 GATCCACACTCCCAGGACACTGG - Intergenic
902043810 1:13511061-13511083 AAACCCTGTTCCCAGGGCTCTGG + Intronic
902918433 1:19652506-19652528 AAGCCCCACTCCCAGCCCACTGG - Intronic
907700388 1:56780902-56780924 AAACTCTACAGGCAGGACACAGG + Intronic
908568362 1:65382373-65382395 AAAGCCTTCTCCCAGGAGAAAGG - Intronic
910094011 1:83499315-83499337 AAACCCTGCCCCAAGGACAGAGG + Intergenic
910975416 1:92901326-92901348 AAACCCTGCACCTAGGACCCTGG - Intronic
914629793 1:149497924-149497946 TAATCCTACTCTCATGACACTGG + Intergenic
914630327 1:149502685-149502707 TAATCCTACTCTCATGACACTGG + Intergenic
914630861 1:149507446-149507468 TAATCCTACTCTCATGACACTGG + Intergenic
914632461 1:149521718-149521740 TAATCCTACTCTCATGACACTGG + Intergenic
914633531 1:149531198-149531220 TAATCCTACTCTCATGACACTGG + Intergenic
914634067 1:149535953-149535975 TAATCCTACTCTCATGACACTGG + Intergenic
914634600 1:149540700-149540722 TAATCCTACTCTCATGACACTGG + Intergenic
914635135 1:149545437-149545459 TAATCCTACTCTCATGACACTGG + Intergenic
914635670 1:149550174-149550196 TAATCCTACTCTCATGACACTGG + Intergenic
914876884 1:151518826-151518848 AACCCCTACTCTCAGGTCAAGGG + Exonic
922578137 1:226677037-226677059 AAACCCTCCTCCCAGAGCCCAGG + Intronic
1064456538 10:15492402-15492424 CCACCCCACTCCCAGGACCCTGG - Intergenic
1065959719 10:30724800-30724822 ACACGGTACTCCCAGCACACTGG + Intergenic
1067037346 10:42930426-42930448 CAACTCTACTCCCAGGATATGGG - Intergenic
1067433614 10:46262511-46262533 ACACCCTACCCCCAGCACCCAGG + Intergenic
1067450268 10:46377769-46377791 AAACCCATCTCCCAGGCCTCTGG + Intronic
1067586977 10:47481994-47482016 AAACCCATCTCCCAGGCCTCTGG - Intronic
1067634034 10:47989761-47989783 AAACCCATCTCCCAGGCCTCTGG - Intergenic
1067689731 10:48494049-48494071 AAACCCACCTCCCAGGACTGTGG + Intronic
1069577069 10:69538325-69538347 GACCCCTCCTCCCAGGACCCTGG + Intergenic
1069590813 10:69640796-69640818 AAACCCTGCTCCCCGGGGACAGG - Intergenic
1076157586 10:128215642-128215664 ACACCCAACCCCCAGGACGCTGG - Intergenic
1076664282 10:132077227-132077249 AAACCCTCTCCCCAGGTCACCGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1078853125 11:15181997-15182019 AAACCCAACTCCCCACACACTGG - Intronic
1083485551 11:62981188-62981210 AAACCCCAAACCCAGGACCCAGG - Intronic
1083663982 11:64265016-64265038 AAACCCCACCCCCAGCCCACTGG + Exonic
1083950560 11:65953427-65953449 AAACCCTACTCCCAGGACACTGG + Intronic
1084336300 11:68459993-68460015 AAGTCCTTCTCCCAGGACAAGGG + Intergenic
1084830149 11:71762596-71762618 AAGCCTTAATCCCAGGACTCTGG + Intergenic
1086447931 11:86887691-86887713 CACCCCTACTCCCAGTACACCGG - Intronic
1086493534 11:87379375-87379397 AACCCCACCTTCCAGGACACTGG + Intergenic
1091058223 11:132438691-132438713 ACACCCTACACCCTGCACACTGG - Intronic
1092141645 12:6187991-6188013 AAACCCTTCCCACAGGCCACAGG + Intergenic
1096562218 12:52444377-52444399 CAACCCTATTCACAGGAGACTGG + Intergenic
1096951230 12:55475251-55475273 AAACCCTAGTTCCTGGACTCAGG + Intergenic
1100007443 12:89911233-89911255 AAGCCCTACTACCAGCACACTGG + Intergenic
1100452703 12:94722716-94722738 AAGCCCGAGTCCCAGGACTCTGG - Intergenic
1103038896 12:117678597-117678619 AAACCAAGCTCCCATGACACAGG + Intronic
1103716756 12:122949612-122949634 CAAGCCAGCTCCCAGGACACAGG + Intronic
1103907833 12:124336311-124336333 CATCCCTGCTCCCTGGACACAGG + Intronic
1104232644 12:126900115-126900137 AGACCCTCCTCACAGGAGACCGG - Intergenic
1108280346 13:48854987-48855009 AGGACCTACTCCCAGGCCACTGG + Intergenic
1110270094 13:73579831-73579853 CCACCCTACTCCAAGGACAGAGG - Intergenic
1111902789 13:94220207-94220229 AACCCCTCTTCCCTGGACACAGG + Intronic
1113327097 13:109293051-109293073 ATACCCTAAGCCAAGGACACAGG + Intergenic
1118767772 14:68921702-68921724 ATACCCTCCTCCCAGGGCAAAGG - Intronic
1120153583 14:81065224-81065246 ACACACTTCTCCCAGGGCACAGG + Intronic
1121488949 14:94344071-94344093 AAACCCTTCCCCCATGTCACAGG + Intergenic
1122163700 14:99805078-99805100 GAACCCTGCTCCCATGCCACGGG + Intronic
1124260229 15:28183062-28183084 ATACCCTCTGCCCAGGACACCGG + Intronic
1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG + Intronic
1127187596 15:56495276-56495298 ACACCCTACACTCAGCACACAGG + Intergenic
1128270260 15:66303227-66303249 CAACACTACTCACAGTACACAGG - Intronic
1129221851 15:74135816-74135838 AATCCCTACTCCCAGAAGCCGGG + Exonic
1129392527 15:75227685-75227707 AAAGCCAGCTCCCAGCACACAGG - Intergenic
1129471865 15:75760499-75760521 AAAGCCAGCTCCCAGCACACAGG + Intergenic
1130037721 15:80376907-80376929 AAATCTTACTCCCAGAGCACAGG - Exonic
1130512431 15:84600837-84600859 AAACCCTACTCCGGGGACCGCGG + Intergenic
1132826934 16:1909830-1909852 CCCTCCTACTCCCAGGACACAGG + Intergenic
1133833243 16:9343313-9343335 AAACTCTACACCCAGGATAAGGG + Intergenic
1135992688 16:27227524-27227546 CGACCCTACTGCCAGGTCACAGG + Intronic
1136033074 16:27517487-27517509 AACCCCTGGTCCCTGGACACAGG + Intronic
1136707442 16:32201636-32201658 CACCCCCACTCCCAGGTCACTGG - Intergenic
1136760469 16:32727781-32727803 CACCCCCACTCCCAGGTCACTGG + Intergenic
1136807634 16:33142605-33142627 CACCCCCACTCCCAGGTCACTGG - Intergenic
1139347124 16:66311060-66311082 AAACCAAACACCCAGGGCACAGG - Intergenic
1140150830 16:72363275-72363297 AAACCCAATTCCCAGCATACTGG + Intergenic
1203062622 16_KI270728v1_random:988096-988118 CACCCCCACTCCCAGGTCACTGG + Intergenic
1142672732 17:1494713-1494735 AACCCTCAGTCCCAGGACACAGG + Exonic
1143003933 17:3814572-3814594 AACCCCTGCCCCGAGGACACAGG + Intronic
1143334912 17:6165027-6165049 AGATCCTACACCCAGGACACTGG - Intergenic
1143370033 17:6433878-6433900 AAAGACTAGTCCCAGGAGACAGG + Intronic
1145761061 17:27425707-27425729 AAACCCAACTCCCAGCCCATGGG - Intergenic
1146161110 17:30559865-30559887 AAACCCAACTCCCAGCCCATGGG - Intronic
1146902300 17:36596683-36596705 AAACCCAACTTTCAGGACATGGG + Intronic
1148902677 17:50890289-50890311 AAAGCCAGCTCCCAGGACAGGGG - Intergenic
1156384660 18:36594240-36594262 AACCCCTACTCCCTGGATCCAGG - Intronic
1156468454 18:37362555-37362577 GCACCCTTCTGCCAGGACACAGG + Intronic
1157185815 18:45539361-45539383 AAACCCACCTGCCAGGACAGAGG + Intronic
1161922408 19:7276401-7276423 CACCCATACTCCCAGCACACTGG - Intronic
1162742918 19:12783381-12783403 AACCCCTCCTCCCAGCCCACAGG + Intronic
1162747360 19:12806270-12806292 TCACCCCACTCCCAGGACACGGG - Intronic
1162784895 19:13028544-13028566 AAACTCCACTCCCAGAATACTGG + Intronic
1163143607 19:15366200-15366222 ATACCCTTCTCCCAGTACTCTGG + Intronic
1167531615 19:50021266-50021288 AACCCCTCCTCCCAGGAGTCAGG + Intronic
1168288033 19:55344046-55344068 AAACCCTTTCCCCAGGCCACAGG - Intronic
927452785 2:23223246-23223268 TGACCCTCCTCCCAAGACACAGG + Intergenic
927477623 2:23425985-23426007 ACACCCTTGTCCCAGAACACTGG - Intronic
927751607 2:25674512-25674534 AAACCATACTCCCAGCATGCAGG - Intergenic
927867564 2:26600657-26600679 ACACCCTTCTCCCAGGACATGGG - Intronic
928499574 2:31876175-31876197 ACACCATACTCCCACAACACAGG + Intronic
930480385 2:51941743-51941765 AAACCCTGTTCTCAGGACAAAGG - Intergenic
934941854 2:98508487-98508509 AAGCCCAACTCACAGGTCACGGG + Intronic
935728092 2:106041308-106041330 AACCCCTAGTCCCAGTACACTGG - Intergenic
937925106 2:127162171-127162193 AAACCCTACCTCCAGAGCACAGG + Intergenic
938738549 2:134208953-134208975 AAACCCTGCTCCCAGAACACTGG - Intronic
939150088 2:138462384-138462406 AAACCATAATCCCAGGACTTTGG - Intergenic
941846767 2:170141567-170141589 AAATCCTGCTCCCAGGAAAAAGG - Intergenic
943482326 2:188435611-188435633 ATACCCTACGCCAAGGACACAGG - Intronic
945049758 2:205812209-205812231 AAATCCTATTCCCAGGAGGCAGG + Intergenic
946309316 2:218873958-218873980 AAGCCCAACTCCCAGGGCTCTGG + Exonic
947931373 2:233967982-233968004 AAATCTTACTACCAGGCCACAGG + Intronic
1169154858 20:3321101-3321123 AAACCATGCCCCCAGCACACAGG + Intronic
1170455380 20:16528068-16528090 AGTCCCTACTACGAGGACACAGG + Intronic
1172421074 20:34818384-34818406 AAACCCTACCCAAAGAACACTGG + Intronic
1177872381 21:26589436-26589458 ATATCATACTCCCAGGACAAGGG - Intergenic
1182086833 22:27566774-27566796 CAACCCATCACCCAGGACACAGG + Intergenic
1183288845 22:36985339-36985361 TAAGCCTACTCTCAGGACAAGGG - Intergenic
1184704774 22:46203328-46203350 AAACTTTACACCCAGGAGACCGG + Intronic
1184882425 22:47317478-47317500 ACACCTTAATCCCAGCACACTGG - Intergenic
953335210 3:42088744-42088766 AGACTGTACTTCCAGGACACAGG - Intronic
953905686 3:46867303-46867325 AAACCCCAGACCCAGGACCCAGG + Intronic
957767793 3:84648490-84648512 AAACCATACTGCCAGGACACAGG + Intergenic
966486771 3:180479762-180479784 AAACCCTACTCCTAGGCAGCAGG + Intergenic
967174637 3:186852213-186852235 AAACCATATTACCAGGGCACTGG + Intronic
967213421 3:187189391-187189413 CAACCCTAATCCCAGATCACTGG + Intergenic
969476430 4:7424914-7424936 GCACTCTGCTCCCAGGACACTGG + Intronic
970361997 4:15319141-15319163 AAACACTTCCCCCAGGCCACTGG - Intergenic
975985259 4:80196826-80196848 ACCTCCTAGTCCCAGGACACGGG - Intronic
981511342 4:145561958-145561980 AAATCCTAGGCCCAGGACACTGG - Intergenic
983261310 4:165459985-165460007 AAGCACTACCCTCAGGACACTGG - Intronic
983441978 4:167798075-167798097 AGACCCTAATTCCAGGACGCTGG - Intergenic
986778102 5:11038143-11038165 ACACCATCCTCCCAGGACACTGG + Intronic
995064220 5:107841941-107841963 AATCTCTACTCCCAGCTCACTGG - Intergenic
996540946 5:124629685-124629707 GCACCCTATCCCCAGGACACAGG + Intergenic
997191911 5:131945513-131945535 CCACCCTACCCCCAGGCCACGGG + Intronic
997384448 5:133461669-133461691 CAACCCTTCTCCAAGGTCACTGG - Intronic
997950539 5:138239336-138239358 AAAACCTTGTCCCAGGGCACAGG + Intergenic
999288253 5:150406993-150407015 ATACCCTCCTCCCTGGGCACCGG - Intronic
999719704 5:154390498-154390520 AAAGCCTCCTCCCAGGCTACAGG + Intronic
1005041248 6:21602341-21602363 AAACCCTAATCCCAGAGCAGTGG + Intergenic
1005969489 6:30749964-30749986 ATTCCCTACCCCCAGGACCCTGG - Intergenic
1007639623 6:43327565-43327587 CACCCCTACTCCCAAGCCACTGG - Intronic
1014824393 6:126032118-126032140 CATCCCTACTCCCAGGACCATGG + Intronic
1019267852 7:128814-128836 ACACCCTCCTCCGAGGCCACCGG - Intergenic
1020107898 7:5430665-5430687 AAAGGCCACTCCCATGACACAGG + Intergenic
1023534209 7:41191128-41191150 AAGCCCTAACCCCAGGACAATGG + Intergenic
1027891077 7:83976072-83976094 GAATCCTACTACCAGGAGACGGG - Intronic
1030085962 7:105815983-105816005 GAAACCTAATCCCAGTACACTGG + Intronic
1030281297 7:107778231-107778253 TAACCCGAGTCCCAGGACAATGG + Exonic
1033275877 7:139971339-139971361 CACACCAACTCCCAGGACACAGG + Intronic
1033516118 7:142108288-142108310 AAAGTCGACTCACAGGACACAGG - Intergenic
1035048886 7:155986983-155987005 AACCCTCACTCCCAGGACACGGG - Intergenic
1036835413 8:12060602-12060624 TGAGCCTACTCCCAGGACATGGG + Intergenic
1037703755 8:21297956-21297978 ACACCCGAATCCCAGGACCCGGG + Intergenic
1039454314 8:37697364-37697386 AAGCCCTACTCCAAGGGCTCCGG + Exonic
1048053042 8:130837326-130837348 AAACCCTTCTCCCAAGTCCCAGG + Intronic
1049465846 8:142750966-142750988 ACACTCTACTCCCAGGAGATAGG - Intronic
1049789459 8:144466172-144466194 AACCCCTACACCGCGGACACCGG - Exonic
1050097005 9:2077215-2077237 AAATCCTATTCACAGAACACTGG - Intronic
1055055028 9:72015508-72015530 AAACACTAAGGCCAGGACACTGG - Intergenic
1060981409 9:127794486-127794508 AAACCTTTCTCCCTGCACACTGG + Intergenic
1061954345 9:133953770-133953792 AAACCCAGCTCCCATGACCCCGG + Intronic
1188269738 X:28124023-28124045 AATCCCTAGTTCCTGGACACAGG - Intergenic
1189736885 X:44080554-44080576 AAATCCTACTCTCCGGACAGTGG - Intergenic
1194379188 X:93174368-93174390 AAACCATAATTCCAGGACCCTGG - Intergenic
1195654791 X:107324076-107324098 AGAGCCTCCTCCCAGGGCACAGG - Intergenic
1199448498 X:147954013-147954035 AAACCCTTCTACAAGGACGCAGG - Intergenic
1199815277 X:151391978-151392000 AAACCCAACTCCGAGGTCTCTGG + Intergenic
1199991084 X:152988130-152988152 ACTGCCTGCTCCCAGGACACAGG + Intergenic
1200083662 X:153592250-153592272 CAACCCTCCTCCCGGGACACCGG + Intronic