ID: 1083950639

View in Genome Browser
Species Human (GRCh38)
Location 11:65953713-65953735
Sequence CAGCTCCTCCAGCTTGCGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 284}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083950639_1083950647 0 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950647 11:65953736-65953758 AGGTAGGGAGCCTGGGCTTCGGG 0: 1
1: 0
2: 4
3: 27
4: 321
1083950639_1083950658 27 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950658 11:65953763-65953785 CTGGTTGGGAGAGGGCAGGGAGG 0: 1
1: 0
2: 12
3: 122
4: 1056
1083950639_1083950651 12 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950651 11:65953748-65953770 TGGGCTTCGGGAGGCCTGGTTGG 0: 1
1: 0
2: 2
3: 28
4: 276
1083950639_1083950652 13 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950652 11:65953749-65953771 GGGCTTCGGGAGGCCTGGTTGGG 0: 1
1: 0
2: 2
3: 38
4: 609
1083950639_1083950644 -8 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950644 11:65953728-65953750 AGGAGCTGAGGTAGGGAGCCTGG 0: 1
1: 0
2: 9
3: 74
4: 579
1083950639_1083950656 24 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950656 11:65953760-65953782 GGCCTGGTTGGGAGAGGGCAGGG 0: 1
1: 1
2: 15
3: 88
4: 694
1083950639_1083950648 3 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950648 11:65953739-65953761 TAGGGAGCCTGGGCTTCGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 234
1083950639_1083950654 19 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950654 11:65953755-65953777 CGGGAGGCCTGGTTGGGAGAGGG 0: 1
1: 0
2: 3
3: 35
4: 372
1083950639_1083950646 -1 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950646 11:65953735-65953757 GAGGTAGGGAGCCTGGGCTTCGG 0: 1
1: 0
2: 2
3: 45
4: 515
1083950639_1083950649 8 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950649 11:65953744-65953766 AGCCTGGGCTTCGGGAGGCCTGG 0: 1
1: 0
2: 5
3: 56
4: 472
1083950639_1083950655 23 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950655 11:65953759-65953781 AGGCCTGGTTGGGAGAGGGCAGG 0: 1
1: 1
2: 7
3: 68
4: 581
1083950639_1083950653 18 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950653 11:65953754-65953776 TCGGGAGGCCTGGTTGGGAGAGG 0: 1
1: 0
2: 1
3: 22
4: 318
1083950639_1083950645 -7 Left 1083950639 11:65953713-65953735 CCCAGCGCAAGCTGGAGGAGCTG 0: 1
1: 1
2: 2
3: 27
4: 284
Right 1083950645 11:65953729-65953751 GGAGCTGAGGTAGGGAGCCTGGG 0: 1
1: 0
2: 7
3: 42
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083950639 Original CRISPR CAGCTCCTCCAGCTTGCGCT GGG (reversed) Exonic
900096762 1:942955-942977 CGGCCCCTCCAGCTGGAGCTTGG - Exonic
900114426 1:1022424-1022446 CACCTCCTCCAGGTTCCGCAGGG - Exonic
900195630 1:1374309-1374331 CATCTCCTCCAGCTCCAGCTGGG + Exonic
901196652 1:7443995-7444017 AAACTCCTCCAGCTTCCTCTGGG - Intronic
902950962 1:19882572-19882594 CCGCTCGTCCCGCTTGCGCTCGG - Exonic
903528042 1:24007929-24007951 CAGCTCCTCCCGCTTCCTCTTGG + Intergenic
904312997 1:29641478-29641500 CAGCTACTCCACCCTGCCCTTGG - Intergenic
905769244 1:40626652-40626674 CAGCTCGTCCAGCATGATCTGGG + Exonic
905894319 1:41535263-41535285 CAGCCCTTCCAGCCAGCGCTGGG + Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
912495769 1:110090156-110090178 CAGCACCTCCAGCTGCAGCTGGG - Intergenic
912659590 1:111515907-111515929 CAGTTCCTCCAGTCTGGGCTGGG - Intronic
913045294 1:115068947-115068969 CAGCTCCTCCTGGTGGGGCTTGG - Intronic
914879525 1:151536815-151536837 CTGCTCCTCCACCTCACGCTGGG - Exonic
915672148 1:157498805-157498827 CAGTTCCTCCAGCCTCTGCTTGG + Intergenic
917202639 1:172533355-172533377 CGGCTCCTCCATCTTGGCCTCGG + Exonic
917569732 1:176252469-176252491 CACATCCTCCATCTTGCCCTTGG - Intergenic
917845098 1:179014167-179014189 CTGCTCTTCCTGCTTGAGCTTGG - Intergenic
918334009 1:183489418-183489440 TAGGTCCTACAGCTTGGGCTGGG + Intronic
919650921 1:200148126-200148148 CACCTCCTCCAGCGTGGGCAAGG - Intronic
919745184 1:201004349-201004371 CGGCTCCTCCAGGATTCGCTGGG - Exonic
919921995 1:202171574-202171596 CAGCCCATCCAGCTGCCGCTTGG - Intergenic
921969466 1:221131578-221131600 CAGCTACTCCAGCTTTCTTTTGG + Intergenic
922209645 1:223477728-223477750 CACATCCTCCAGCCTGCTCTTGG - Intergenic
923084798 1:230695076-230695098 CAACTCCTCCAGCTCCTGCTGGG - Intergenic
923495104 1:234517764-234517786 CAGCTCCACCGGCATGGGCTAGG - Intergenic
923563275 1:235057959-235057981 CAACTCCGCCAGCTTTCTCTGGG + Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
924787428 1:247211039-247211061 CAGGGCTTCCTGCTTGCGCTGGG + Intergenic
1063592578 10:7408242-7408264 TGGCTCCTCCAGCCTGCGTTTGG - Intronic
1066209651 10:33224263-33224285 CAGTGCCCCCAGCTTGCCCTGGG - Intronic
1069600995 10:69708042-69708064 CAGCTCCTCCAACTTGCAGGTGG + Intergenic
1070825540 10:79388375-79388397 CAGCTCCTCCATCTGGGGCTTGG + Intronic
1073290392 10:102410540-102410562 CCCCTCCTCCAGTGTGCGCTGGG - Intronic
1073454708 10:103629546-103629568 CACCTCCTCCAGCCTGACCTTGG - Intronic
1074590888 10:114811932-114811954 CAGCTGTTCCATCTTTCGCTGGG - Intergenic
1074843107 10:117374799-117374821 CAGCCCCTCCAGCAGGCGCCCGG + Exonic
1076775388 10:132693516-132693538 TAGCTCCTCCAGCTTTCTTTTGG - Intronic
1076869451 10:133186202-133186224 CAGCTCCCCGAGGGTGCGCTCGG - Exonic
1076885100 10:133258572-133258594 CAGGTCCTGCAGCTGGGGCTGGG - Intergenic
1077194224 11:1271197-1271219 CAGCCCCTCCTGCCTGCACTGGG + Intergenic
1077411790 11:2407090-2407112 CAGGTGCTCCCGCTTGTGCTCGG + Intronic
1077556356 11:3227928-3227950 CTGGTCCTCCAGCGAGCGCTGGG - Exonic
1078272223 11:9806641-9806663 CAGCTCCTCCAGTTACTGCTTGG + Intronic
1078723872 11:13910105-13910127 TAGCTCCTCCAGATTCTGCTGGG - Intergenic
1079064443 11:17276985-17277007 CAGCGCCTCCGGCTCGCGCTGGG - Intronic
1080270186 11:30442898-30442920 CAGCTACTCCTGCTTGGGCCAGG + Intronic
1081675701 11:44967821-44967843 CAGCTCCTGCAGCTTGCCAGAGG + Intergenic
1081811691 11:45917800-45917822 CAGCTTCTCCATCCTGCCCTCGG + Exonic
1082783272 11:57302765-57302787 CATCTCCTCCAGCAGGCCCTGGG + Exonic
1083764691 11:64836219-64836241 CAGCTCCTCCTGCTGCCCCTGGG + Exonic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084860213 11:72013276-72013298 CAGCTCCCCAAGCTCCCGCTGGG + Exonic
1085047631 11:73362747-73362769 CATCTCCTCCAACTTGGCCTTGG + Intronic
1085123153 11:73980313-73980335 CAGCTCACCCAGCTTCCTCTTGG + Intronic
1085159369 11:74326670-74326692 CAGCTCCTACATTTTGCACTTGG - Intergenic
1085998093 11:81946921-81946943 CAGCAACTCCAGCTTGAGATGGG - Intergenic
1086590387 11:88508751-88508773 CAGCTCCTCCAGGTCTGGCTTGG + Exonic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1088800280 11:113299306-113299328 TAGCTACTCCTGCTTGCGTTTGG - Intergenic
1089292016 11:117443246-117443268 CGGCTGCTACAGCTTGCCCTTGG + Intronic
1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG + Exonic
1091106169 11:132921596-132921618 TAGCTCCTCCAGCTAGAGCCTGG + Intronic
1091722558 12:2823984-2824006 CAGCTCCTGCAGCATGCTGTGGG - Intronic
1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG + Intronic
1094039673 12:26109779-26109801 CACCACCTCCAGCCTTCGCTTGG - Intergenic
1096497365 12:52046148-52046170 CTGCCCCTCCACCTTGGGCTGGG - Intronic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096554706 12:52396146-52396168 CAGCCCTGCCAGCTTGCACTTGG + Exonic
1096566767 12:52488462-52488484 CAGCCCTTCCAGCTTGTTCTTGG + Exonic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096581389 12:52587765-52587787 CAGCTCATCCAGCTTGGCCCGGG + Exonic
1096584440 12:52610749-52610771 CAGCTCATCCAGCTTGGCCCTGG + Exonic
1097782415 12:63723502-63723524 CAGCCCCTTAAGCTTACGCTGGG + Intergenic
1100918739 12:99457605-99457627 CAGCTACTCCTGCTTGCTTTTGG - Intronic
1103282668 12:119772824-119772846 CAGCTTCTCCAGCTCCCTCTCGG + Exonic
1104137596 12:125955203-125955225 CAGCTCCTTCTGATTGGGCTTGG - Intergenic
1107359113 13:39600963-39600985 CAGATCCTCCATTCTGCGCTGGG + Exonic
1109319199 13:60789183-60789205 AACCTCCTCCAGTTTGCTCTTGG + Intergenic
1110810766 13:79808554-79808576 CAGCTTCCCCAGCTGGCACTGGG - Intergenic
1112873947 13:104012129-104012151 CAGCTCCTCCACCCTCCACTGGG + Intergenic
1113008079 13:105730362-105730384 AAGCTCCACCATCTTGAGCTTGG - Intergenic
1113895480 13:113761382-113761404 CAGCTCCTCCAGCTAAGGCTGGG + Intronic
1114490092 14:23095101-23095123 CAGCTCCGCCATCTTGCGTGAGG + Exonic
1117334906 14:54748902-54748924 CTGCGCCTCCAGCTGGCACTCGG - Exonic
1118374356 14:65163719-65163741 CAGCTCCTACAGCTTGTGAGAGG + Intergenic
1118878989 14:69810304-69810326 CAGCTCCTCCTGCTGTCCCTGGG + Intergenic
1118946922 14:70397589-70397611 CAGCTTCTACAGCTGGCACTGGG + Intronic
1119223931 14:72929660-72929682 CAGCTCCTCCCGCTTCCTCTTGG + Intronic
1120356647 14:83442738-83442760 CAGCTCCTCCTGTTAGAGCTGGG - Intergenic
1121089791 14:91173356-91173378 CAGCCCTTCCAGCTTGTCCTTGG - Exonic
1122198233 14:100105762-100105784 CAGCCCTTCCTGCTTGTGCTAGG - Intronic
1122491355 14:102117920-102117942 CAGCTTCCCCAGCTGGCACTGGG - Intronic
1124090927 15:26599293-26599315 CAGCTCCTCCAGCTTGAGCTGGG + Intronic
1124341900 15:28895162-28895184 CAGCTCCGCCAACTTACCCTCGG + Intronic
1124623834 15:31297024-31297046 TTGCTCCTCCAGCTTGAGCCTGG - Intergenic
1125729218 15:41883351-41883373 CAGCTCCTCCAGCTGGTGGGAGG + Exonic
1126040313 15:44584289-44584311 CAGCTCCTCCAGCTTATCCAAGG + Exonic
1127433413 15:58933710-58933732 CTGCTGCTGCAGGTTGCGCTAGG - Intronic
1128813355 15:70587557-70587579 CGGCTCCCTCAGCTTGCGCGAGG - Intergenic
1129884968 15:79031405-79031427 CAGCTCCTCCAGTTTGGACTTGG + Exonic
1129917006 15:79282947-79282969 CCGCTCCTCCAAGTTGCGGTGGG - Intergenic
1131058390 15:89389909-89389931 CTGGTCCTCCTGCCTGCGCTGGG - Intergenic
1131271221 15:90948730-90948752 CAGCTCCACCATCTTGGGGTCGG - Exonic
1132115248 15:99131242-99131264 CAGCTCCTCCCTCATGCGCTCGG - Exonic
1132365178 15:101251738-101251760 CGGCTCCTCCCGCTCGCGCGCGG + Exonic
1132505150 16:304322-304344 CCGCTCCTCCAGCTTCTCCTCGG + Exonic
1133802074 16:9092199-9092221 CAGCTTCTGCTGCTTGTGCTCGG - Exonic
1134059771 16:11192184-11192206 CAGCTCCTCCAGGGTGCTCCAGG - Intergenic
1135571274 16:23551240-23551262 CAGCTCCTCCAGTTCCCACTTGG + Intronic
1136613807 16:31383169-31383191 CAGCTCCACCAGCTTACCATCGG - Intergenic
1136848428 16:33594749-33594771 CAGCTTCTCCAGCATGAGGTGGG + Intergenic
1137760016 16:50933132-50933154 CAGCTTCTCCCGCATGCGCAAGG - Intergenic
1139243663 16:65419835-65419857 CAACTCATCCAGCTTGGGTTGGG + Intergenic
1141625611 16:85259570-85259592 CAGCTCCTCCCACTAGCCCTGGG - Intergenic
1142226412 16:88879865-88879887 CAGCTCCCCCGGCTCGCGTTAGG - Intronic
1203110135 16_KI270728v1_random:1443398-1443420 CAGCTTCTCCAGCATGAGGTGGG + Intergenic
1143123678 17:4626697-4626719 CTGCTCCTCGAGCTTCCTCTGGG + Intergenic
1143263865 17:5621125-5621147 CAGCTCCTCAGGCTTAAGCTGGG - Intergenic
1143711953 17:8741567-8741589 CACCATCTCCTGCTTGCGCTTGG + Exonic
1143730828 17:8881789-8881811 CAGCTCCTCCTGCTTCCGGCAGG + Exonic
1143815542 17:9509959-9509981 CAGCTACTCCTGCTTGCTTTTGG - Intronic
1144579130 17:16448049-16448071 CAGCTCCCCCAGGCTGAGCTGGG + Intronic
1145745970 17:27319932-27319954 ACGCTCATCCAGCTTGTGCTGGG + Intergenic
1146651056 17:34606683-34606705 CAGCTCCTCCAACTTGCCAGGGG - Intronic
1147660669 17:42115332-42115354 CAGTTCCTCCAGCCTGCTCTTGG + Intronic
1148114870 17:45169682-45169704 CAGCTCCTCCACCTGGCGGCAGG - Exonic
1148809869 17:50283602-50283624 GTGCTCCTCCAGCCTGCACTGGG + Intergenic
1149221597 17:54420510-54420532 CAGCTACTCCTGCTTGCTTTTGG - Intergenic
1149329958 17:55570430-55570452 CAGCTTCTCCAGCTGGCACCAGG - Intergenic
1151448234 17:74181272-74181294 CAGCTCCTCCAGCCTGAGAAAGG + Intergenic
1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1152186204 17:78857703-78857725 CAGCTCCTCCACCCGGCGCAGGG + Intronic
1154328481 18:13409678-13409700 CTTCTCCTCCAGCTTGCGAATGG - Intronic
1155412016 18:25556919-25556941 CAGCTCTTCCAGCAAGCACTGGG - Intergenic
1157596388 18:48866551-48866573 CAGCTGCTCTGGCTGGCGCTTGG - Intergenic
1157781599 18:50444654-50444676 CAGCTGCTTCAGCTTTAGCTGGG - Intergenic
1159308125 18:66672339-66672361 CTGCTTCTCCAGCTTGCACATGG + Intergenic
1160428097 18:78792162-78792184 CAGCTCCTCCACCCTGCAGTTGG + Intergenic
1160579084 18:79873490-79873512 GAGCACATCCAGCCTGCGCTTGG + Intronic
1160597048 18:79982921-79982943 CAGCTCCTCCTCCAAGCGCTTGG - Intronic
1161290796 19:3492455-3492477 CAGCCACTCCAGCCTGCGCACGG + Exonic
1161341849 19:3747349-3747371 CAGCTCCTCCAGGCTGGGCGCGG - Intronic
1161683378 19:5691551-5691573 CAGCTCCTCCCGCTTCCTCTTGG - Exonic
1161766595 19:6211977-6211999 CAGCCCCTCGAGCGTGGGCTCGG - Intergenic
1162100240 19:8334753-8334775 CAGCAGCTCTAGCTCGCGCTCGG + Exonic
1162432332 19:10636522-10636544 CAGGTCGTCCGGCTTGCGCAGGG - Exonic
1163420573 19:17211730-17211752 CCGCTCCTCCAGCAGGCTCTCGG - Exonic
1164725734 19:30464585-30464607 CAGCTCCGCCAGCTTCTGCTTGG + Intronic
1166189990 19:41170096-41170118 CAGCTCCTTCCGCTTCCTCTTGG - Intergenic
1166210758 19:41305337-41305359 CAACTCCTTTAGCTTGCCCTGGG - Intronic
1166745698 19:45140904-45140926 CAGCTCCTACAGGGTGGGCTTGG + Intronic
1167171649 19:47836282-47836304 CAGCTCCTCCAGTTGGCTCCGGG - Exonic
927147286 2:20174545-20174567 CAGTGCCTCCAGCTTGCACAGGG + Intergenic
930574108 2:53125409-53125431 TAGCTACTCCAGCTTGCTTTTGG + Intergenic
932842696 2:75098665-75098687 CACCACATCCAGCTTGCTCTAGG + Intronic
933313186 2:80685939-80685961 CAGCTTCTTCAGCTTCCGGTTGG - Intergenic
934973583 2:98784382-98784404 CAGCTACTCCAGCTTTCTTTTGG - Intergenic
935321760 2:101896228-101896250 CAGTCCCTCCAGCTGGAGCTTGG + Intergenic
939508332 2:143075984-143076006 CAGCTGCTCCAGCTGTGGCTGGG + Intergenic
942877848 2:180823886-180823908 CAGCTGCTCCATCTTCCCCTAGG + Intergenic
945480457 2:210339040-210339062 CAGCTACTCCTGCTTGCTTTTGG + Intergenic
945991820 2:216402446-216402468 CACCCCCTCCAGCTTGCTATAGG - Intergenic
946635103 2:221716343-221716365 AAGCTCCTCCAGCTTGAGAAGGG - Intergenic
947012677 2:225582937-225582959 CAGCTCCTCCAGCGGGCTCGTGG - Exonic
948663081 2:239518659-239518681 CAGCTCCTCCAGGTGGGGCCTGG + Intergenic
948994982 2:241573455-241573477 CAGCTCTTCCAGCTTCAGCCAGG - Exonic
1172446974 20:34998344-34998366 CAGCTCCTCCACCTTGATCTTGG - Exonic
1173737966 20:45375104-45375126 CAGATCCTCCACCCTGCGTTGGG - Exonic
1174186243 20:48708302-48708324 CAGCTTCTCCATCTGCCGCTTGG + Exonic
1174451102 20:50621006-50621028 CGGCTCCTCCTGCTTCCTCTTGG - Intronic
1175147359 20:56907058-56907080 CAGCTCTTCCAACCTGGGCTGGG + Intergenic
1175244425 20:57573065-57573087 GAGCTCTTCCAGCTTCCACTGGG - Intergenic
1175261936 20:57680176-57680198 CAGCCACTCCAGCTTTAGCTGGG + Intronic
1175748726 20:61480269-61480291 CAGCTGCCCCGGCTTCCGCTTGG - Intronic
1176013987 20:62919050-62919072 AAGCTCCACCAGCTTGCGGCAGG + Intronic
1176144732 20:63560488-63560510 CACCTCCTCCAGGTTGGCCTTGG + Exonic
1176177552 20:63735825-63735847 GAGCTGCCCCAGCTGGCGCTGGG - Exonic
1176301814 21:5102209-5102231 CAGCCCCTCCCGCTTGCCCAGGG + Intergenic
1178971028 21:37177030-37177052 CAGCTGGTCCTGCTTGGGCTCGG + Intronic
1179855217 21:44159691-44159713 CAGCCCCTCCCGCTTGCCCAGGG - Intergenic
1182403659 22:30105139-30105161 CAGCTCCTCCTACTTCCTCTTGG + Intronic
1183186284 22:36293350-36293372 CTGCTTCTCCAGGTTGTGCTTGG + Exonic
1183921888 22:41176419-41176441 CAGCTCCACCAGCATGCACATGG - Exonic
1185389124 22:50549353-50549375 CAGGGCCACCAGCTTGAGCTGGG - Exonic
954479993 3:50790117-50790139 TAGCTCCTCCTGCTTGCTTTGGG + Intronic
954642090 3:52106788-52106810 CAGGTCCTCCATCTTGCCATGGG - Intronic
961006598 3:123409836-123409858 CAGCTCATCCAACTGGGGCTTGG - Intronic
961673274 3:128549769-128549791 CAGCACCTACAGCCTGTGCTTGG + Intergenic
961989795 3:131176230-131176252 CAGCTTCTCCATCTTGGGCTGGG - Intronic
963326300 3:143866925-143866947 CTGCTCCACCAGCTTCTGCTGGG - Intergenic
963923593 3:150928690-150928712 CAGCTCCTTCAGCTTTCACTTGG + Intronic
964282236 3:155079698-155079720 CGGCTGCTCCAGCCTGCTCTCGG - Exonic
964653476 3:159039750-159039772 CAGCTCCTTCATCTTGCCATGGG + Intronic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
965731006 3:171772658-171772680 CAGCTCATCCAGCTTTCGCTTGG - Intronic
965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG + Intronic
966775741 3:183541330-183541352 GAGCTCCTCCAGCTGGGGATGGG + Intronic
967208482 3:187145555-187145577 CAGCTGCTCCAGCTCCAGCTGGG - Intronic
967808585 3:193736437-193736459 CTGCTTCTCCAGCTTCCTCTTGG - Intergenic
968927653 4:3558323-3558345 CAGGCCCTCCAGCTGGCCCTCGG - Intergenic
975594540 4:76036798-76036820 CAGCTCCTCCTGCCTTCTCTTGG + Intronic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
978229801 4:106385183-106385205 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
980410236 4:132408102-132408124 CAGCTCTTCCAGCTTCCTTTGGG + Intergenic
984102029 4:175498790-175498812 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
985493457 5:192173-192195 CACCACCTCCAGCTTGCGCAGGG - Exonic
985688204 5:1293362-1293384 CAGCTCCTGCAGCGAGAGCTTGG + Exonic
987709608 5:21491423-21491445 CAGCACCTTCAGCTGGCCCTGGG - Intergenic
988090210 5:26529619-26529641 CAGCTGCTGCAGCTTGCTATGGG + Intergenic
988181255 5:27796991-27797013 CAGCTCCTCCAGCTGCAGTTGGG + Intergenic
988750005 5:34182743-34182765 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
990503611 5:56422931-56422953 CAACACTTCCAGCTTGCCCTGGG - Intergenic
991738265 5:69645945-69645967 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
991759928 5:69910477-69910499 CAGCACCTTCAGCTGGCCCTGGG - Intergenic
991787403 5:70207621-70207643 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
991789841 5:70225671-70225693 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
991814589 5:70500779-70500801 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
991817725 5:70522064-70522086 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
991839158 5:70785540-70785562 CAGCACCTTCAGCTGGCCCTGGG - Intergenic
991879849 5:71208006-71208028 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
991882289 5:71226030-71226052 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994421732 5:99532731-99532753 CAGCACCTTCAGCTGGCCCTGGG - Intergenic
994461111 5:100067830-100067852 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
994485260 5:100381274-100381296 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
998258519 5:140609333-140609355 CAGCTCCTCCTGCTTCCTGTTGG - Intergenic
998308492 5:141102556-141102578 CAGCACCACCAGCCTGTGCTTGG - Exonic
998311556 5:141137338-141137360 CAGCACCACCAGCCTGTGCTTGG - Exonic
998313532 5:141157907-141157929 CAGCACCACCAGCCTGTGCTTGG - Intergenic
998318006 5:141201681-141201703 CAGCACCACCAGCCTGTGCTTGG - Exonic
998318965 5:141210814-141210836 CAGCACCACCAGCCTGTGCTTGG - Exonic
998319530 5:141216030-141216052 CAGCACCACCAGCCTGTGCTTGG - Exonic
998320507 5:141225412-141225434 CAGCACCACCAGCCTGTGCTTGG - Exonic
998321520 5:141236461-141236483 CAGCACCACCAGCCTGTGCTTGG - Intergenic
1000266370 5:159641715-159641737 CAGCTCCCACAGCTGGCACTGGG - Intergenic
1001449644 5:171814728-171814750 CAGCTCCTCCTGGGTGAGCTGGG - Intergenic
1002790775 6:435930-435952 CGGCTCCCTCAGCTTGCGCGGGG - Intergenic
1002896207 6:1381992-1382014 CAGTTCCTCCGGCTTCCGCGGGG - Intergenic
1005548069 6:26889073-26889095 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
1006502744 6:34468704-34468726 AAGCTTCCCCAGCTTGGGCTGGG + Intronic
1006614969 6:35319959-35319981 CACCTCCTCCAGCTGCTGCTGGG - Exonic
1006657446 6:35607867-35607889 CAGCTCCTCCTGCTTCCTCTTGG - Intronic
1006906647 6:37537517-37537539 CAGCTCCTCCAGCTCCTGATGGG - Intergenic
1006932156 6:37695054-37695076 CAGCTTCTCCAGCCTTCTCTAGG - Intronic
1009018829 6:57930167-57930189 CAGCACCTTCAGCTGGCCCTGGG + Intergenic
1010916720 6:81628177-81628199 CACCACCTCCACCTTGCACTAGG + Intronic
1011156446 6:84338956-84338978 CAGCTACTCCTGCTTGTGTTTGG + Intergenic
1011527113 6:88276932-88276954 CAACTGCTCCAGCATGCGCAAGG - Intergenic
1012231079 6:96762070-96762092 CAGCTTCCCCAGCTGGCACTGGG + Intergenic
1013111800 6:107070285-107070307 CAGCGACTCCAGCTTGCGCTTGG + Exonic
1013194516 6:107833430-107833452 CAGCTCCTCCAGCTACCCCATGG - Intergenic
1015178601 6:130338137-130338159 CAGCTGCTCCAGCTCCAGCTGGG + Intronic
1016495769 6:144660052-144660074 CAGCAGCGGCAGCTTGCGCTGGG - Intronic
1016994473 6:149951842-149951864 CAGCTCCTCCTGCTTTCTGTGGG - Intergenic
1017382713 6:153848709-153848731 CAGCTCCTCCTGCTTGCAGGGGG - Intergenic
1017566847 6:155696109-155696131 GAGCTCCTCCATCTTGTGCTGGG + Intergenic
1018353072 6:162983117-162983139 TAGCTCCTCCTGCTTGCTTTTGG + Intronic
1019634500 7:2068301-2068323 CAGCTTCTCCAGCTCGCTCTGGG - Intronic
1019921290 7:4164775-4164797 CAGCTCCTCCAGGTGGCACTAGG - Intronic
1020037674 7:4974476-4974498 CCGCTCCTCCAGGCCGCGCTCGG - Intergenic
1020162144 7:5781148-5781170 CCGCTCCTCCAGGCCGCGCTCGG + Intronic
1020608767 7:10369080-10369102 CAGCTACTCCTGCTTGCTTTTGG - Intergenic
1022354593 7:29600892-29600914 CAGCTGCTCCAGCTTCCAGTTGG - Intergenic
1022482630 7:30753836-30753858 CAGCTCCTCCCGGTTGCGGTCGG - Exonic
1022941014 7:35239602-35239624 CAGCCCCTTAAGCTTACGCTGGG + Intronic
1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1026035172 7:66825315-66825337 CAGCTCCACCTGCTTCCGCAGGG + Intergenic
1026773913 7:73219417-73219439 CAGCCCCTCCAGCTAGTGCCTGG - Intergenic
1026984366 7:74545768-74545790 CAGCTCCACCTGCTTCCGCAGGG - Exonic
1029381372 7:100217344-100217366 CAGCTCGTCCAGCCTGGCCTGGG - Intronic
1030836756 7:114297160-114297182 CAGCTCCTCCTGCTTCCTCTTGG + Intronic
1035166426 7:156993128-156993150 CAGCTGCTCCAGCTGCCCCTAGG - Intergenic
1035461414 7:159041377-159041399 CAGGTCCTCCAGGGTCCGCTGGG + Intronic
1039966629 8:42288752-42288774 CTGCTGCTCCAGCTTTCCCTTGG - Intronic
1040357927 8:46637802-46637824 CATCACCTCGAGCTTGGGCTAGG - Intergenic
1040388790 8:46932621-46932643 CAGCTCCTCCTGCCTGGGCTGGG + Intergenic
1040829223 8:51659353-51659375 CAGCTTCATCAGCTTGTGCTGGG - Intronic
1045437970 8:102183607-102183629 CAGCTTCTGCAGCTTCCCCTGGG + Intergenic
1047066806 8:121293047-121293069 CAGCTCTTCCCGCTTGTACTTGG - Intergenic
1048385296 8:133906864-133906886 CAACTCCTCCAGCTCATGCTTGG - Intergenic
1048881936 8:138878254-138878276 CACCTCCTCCAGCGTGGGCAAGG - Exonic
1049345926 8:142138635-142138657 CAACACCACCAGCTTGCTCTTGG + Intergenic
1049345931 8:142138671-142138693 CAACACCACCAGCTTGCCCTTGG + Intergenic
1050147587 9:2585529-2585551 CAGCTACTCCTGCTTGCTTTTGG - Intergenic
1052218516 9:25994523-25994545 CAGCTACTCCTGCTTGCTTTTGG - Intergenic
1052915893 9:33924144-33924166 CAGCTCCTGGAGTTCGCGCTAGG + Intronic
1053203763 9:36169792-36169814 CAGCTCCTCCACATTTTGCTCGG - Exonic
1053802512 9:41773402-41773424 CAGGCCCTCCAGCTGGCCCTCGG - Intergenic
1054142725 9:61541668-61541690 CAGGCCCTCCAGCTGGCCCTCGG + Intergenic
1054190820 9:61984748-61984770 CAGGCCCTCCAGCTGGCCCTCGG - Intergenic
1054462476 9:65472818-65472840 CAGGCCCTCCAGCTGGCCCTCGG + Intergenic
1054647553 9:67602969-67602991 CAGGCCCTCCAGCTGGCCCTCGG + Intergenic
1057490662 9:95517102-95517124 CGGCTTCTCCACCTTGTGCTCGG + Intergenic
1057592806 9:96388309-96388331 CTGCTCCTGCAGCCGGCGCTGGG + Exonic
1057792806 9:98135154-98135176 AAGCTCCTCCAGCCTGAGCAGGG + Intronic
1057812932 9:98271614-98271636 CAGCTCCTTGAGCTTGCCATTGG - Intergenic
1058809644 9:108627080-108627102 CAGCTCCTCCTGCTTCCTCTTGG - Intergenic
1062437881 9:136554689-136554711 CACCTCCTCCAGCTTCTGTTGGG - Intergenic
1203786282 EBV:129656-129678 CAGCTCCTCCATCTTGACCGTGG + Intergenic
1186213150 X:7271478-7271500 CAGCTCCTCCAGGTTCCTCAAGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189489344 X:41457544-41457566 CAGCTTCTTCACCTTGCCCTTGG + Intronic
1191039500 X:56064329-56064351 CAGCTACTCCTGCTTGCTTTTGG + Intergenic
1192298253 X:69872577-69872599 TAGCTACTCCAGCTTGCTTTTGG - Intronic
1196390170 X:115198679-115198701 CAGCTCCTCCCGCTTCCTCTTGG - Intronic
1197426594 X:126304906-126304928 CAGGTCTTCCAGCTTGTGATGGG - Intergenic
1197463608 X:126773519-126773541 TAGCTACTCCTGCTTGCTCTTGG - Intergenic
1200076556 X:153554175-153554197 GAGCACCTCGAGCTTGCCCTGGG + Intronic
1201586072 Y:15562738-15562760 CAGCTCCTCCAGGTTCCTCAAGG + Intergenic
1202274308 Y:23099773-23099795 CAGCCACTCCAGCTTCCTCTTGG - Intergenic
1202291718 Y:23320904-23320926 CAGCCACTCCAGCTTCCTCTTGG + Intergenic
1202427303 Y:24733518-24733540 CAGCCACTCCAGCTTCCTCTTGG - Intergenic
1202443488 Y:24936576-24936598 CAGCCACTCCAGCTTCCTCTTGG + Intergenic