ID: 1083952658

View in Genome Browser
Species Human (GRCh38)
Location 11:65965492-65965514
Sequence GGCCTGACGGCACTGAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083952650_1083952658 14 Left 1083952650 11:65965455-65965477 CCTGGGCAGCATGGGGTGGTCGC 0: 1
1: 0
2: 1
3: 17
4: 243
Right 1083952658 11:65965492-65965514 GGCCTGACGGCACTGAGGCGGGG 0: 1
1: 0
2: 1
3: 20
4: 141
1083952653_1083952658 -8 Left 1083952653 11:65965477-65965499 CCTAGTGCTTCTGGTGGCCTGAC 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1083952658 11:65965492-65965514 GGCCTGACGGCACTGAGGCGGGG 0: 1
1: 0
2: 1
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083952658 Original CRISPR GGCCTGACGGCACTGAGGCG GGG Intronic