ID: 1083953155

View in Genome Browser
Species Human (GRCh38)
Location 11:65967744-65967766
Sequence CTGCAGAAGCAGCTGGAGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 558}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083953148_1083953155 14 Left 1083953148 11:65967707-65967729 CCCGCAGGTGCTGGAGGAGGACG 0: 1
1: 0
2: 1
3: 48
4: 440
Right 1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG 0: 1
1: 0
2: 5
3: 72
4: 558
1083953142_1083953155 25 Left 1083953142 11:65967696-65967718 CCGCCGGGGTCCCCGCAGGTGCT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG 0: 1
1: 0
2: 5
3: 72
4: 558
1083953144_1083953155 22 Left 1083953144 11:65967699-65967721 CCGGGGTCCCCGCAGGTGCTGGA 0: 1
1: 0
2: 3
3: 29
4: 312
Right 1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG 0: 1
1: 0
2: 5
3: 72
4: 558
1083953149_1083953155 13 Left 1083953149 11:65967708-65967730 CCGCAGGTGCTGGAGGAGGACGA 0: 1
1: 0
2: 1
3: 32
4: 217
Right 1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG 0: 1
1: 0
2: 5
3: 72
4: 558
1083953147_1083953155 15 Left 1083953147 11:65967706-65967728 CCCCGCAGGTGCTGGAGGAGGAC 0: 1
1: 0
2: 3
3: 39
4: 277
Right 1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG 0: 1
1: 0
2: 5
3: 72
4: 558
1083953141_1083953155 28 Left 1083953141 11:65967693-65967715 CCACCGCCGGGGTCCCCGCAGGT 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG 0: 1
1: 0
2: 5
3: 72
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083953155 Original CRISPR CTGCAGAAGCAGCTGGAGAA GGG Exonic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900951470 1:5860383-5860405 CTGCGGAAGCAGCAGGCTAACGG + Intergenic
901080400 1:6580655-6580677 CTCAACAAGCAGCGGGAGAAGGG + Exonic
901124300 1:6918233-6918255 CTCCAGAAGCAGCTGGTTTAGGG - Intronic
901228073 1:7625921-7625943 CTCCAGGAGCCACTGGAGAAAGG + Intronic
901550074 1:9989488-9989510 GTGGAGAAGCAGCTGGATATTGG + Intergenic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
902538413 1:17135283-17135305 CAGCACAAGGTGCTGGAGAAAGG - Intergenic
902690077 1:18105660-18105682 CAGCAGAAGGAGCTAGAGAATGG - Intergenic
903218288 1:21855010-21855032 CCCCAGAGGCAGCTGGACAACGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
903796275 1:25931179-25931201 CTTTATAAGCAGCTTGAGAATGG + Intergenic
904379556 1:30101750-30101772 CTGTAGAAGAGGCTGGGGAAGGG - Intergenic
904529670 1:31160128-31160150 CTGCAGAGGCAAATGGAGAGAGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904774641 1:32899277-32899299 CATCAGAAGCAGCTAAAGAAGGG - Intronic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
904877516 1:33667907-33667929 CTCCAGAAGCTCCCGGAGAATGG - Intronic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
905780046 1:40700906-40700928 GTGGAGAATAAGCTGGAGAAGGG - Intronic
905889445 1:41510428-41510450 ATGCTGAAGCAGTTGGAGAGAGG + Exonic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906701094 1:47858822-47858844 CTGCAGATGCCTCTAGAGAAAGG + Intronic
906707303 1:47904095-47904117 CTGCAGAAGGAGCTGTAACAGGG + Intronic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908389943 1:63675267-63675289 CTGCTGAAGGAGCTGGGGGAGGG + Intergenic
909465027 1:75963951-75963973 CTGCAGAAGCAGCCAGATGAAGG + Intergenic
909539269 1:76772474-76772496 ATAGAGAAGTAGCTGGAGAAGGG - Intergenic
910166169 1:84329573-84329595 ATGGAGAAGCAGCTGGATTAAGG + Intronic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
911499741 1:98670418-98670440 CTGGAAATGCAGCTGCAGAAAGG + Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913129573 1:115827638-115827660 CAGCAGCAACAGCTGGATAATGG + Intergenic
913156070 1:116099687-116099709 CTCCTGATGCAGCAGGAGAAGGG + Intergenic
913475057 1:119229315-119229337 CTTCAGAAGAAGCTGAGGAATGG - Intergenic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
915789912 1:158657471-158657493 ATGAAGAAGCAGCTGGGGTAAGG - Exonic
915853423 1:159352865-159352887 CTTCAGAAGCAGATGCAGATGGG + Intergenic
917476939 1:175377018-175377040 TAGCAGAAGCAGCTGTGGAAGGG + Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917535371 1:175870737-175870759 GTCCAGATGCAGCTGGAGCAAGG + Intergenic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921540517 1:216408847-216408869 ATGGAGAAGCTGCTGGACAAAGG + Intronic
922911777 1:229224543-229224565 CTGCAACAGCAGCCGGGGAAAGG + Intergenic
923776806 1:236986158-236986180 CTGAAGAAGCCAGTGGAGAAGGG - Intergenic
924032029 1:239895329-239895351 CTGCAGAGGCAGCTGGAAGGAGG - Intronic
924426635 1:243957010-243957032 CTGAAGTAGCAGCTGGATCATGG + Intergenic
924738352 1:246779578-246779600 CTGAAGAATCAGCTCAAGAAGGG - Intergenic
924809754 1:247390445-247390467 CTGCAGCAGCAGCTGGAGTCGGG + Intergenic
1062860428 10:805700-805722 CTGCAGAAGCAGCCGGGGACAGG + Intergenic
1063322262 10:5061270-5061292 CTGAAGAAGGAGCTGGTGACAGG + Intronic
1064016142 10:11773801-11773823 CTCCAGAGGCGCCTGGAGAAGGG + Intergenic
1064420776 10:15188951-15188973 CAGGAGGAGGAGCTGGAGAATGG - Intergenic
1066004569 10:31134383-31134405 CTGAAGAGGCAGCTGGAGCGCGG - Intergenic
1066640566 10:37550846-37550868 CTGCAGAAGGAGCTTGGTAAAGG - Intergenic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067394993 10:45906990-45907012 CTACAGAAGTAGCTGGAGGCTGG - Intergenic
1067523661 10:47026112-47026134 CTGCAGAACCATGTGGAGATGGG - Intergenic
1067863313 10:49876121-49876143 CTACAGAAGTAGCTGGAGGCTGG - Intronic
1069411103 10:68154336-68154358 CTGCTGAAGCAGCTGGGGCCAGG - Intronic
1070341920 10:75505746-75505768 CTAAAGGAGCAGCTGGAGTAGGG - Intronic
1070692845 10:78540507-78540529 CAGCAGAAGCAGCTGCACAGGGG + Intergenic
1070837024 10:79454482-79454504 CTGCTGAAGCAACTGAAGGAGGG - Intergenic
1070853160 10:79584163-79584185 CAGCAGGAGAAGCAGGAGAAGGG + Intergenic
1070853785 10:79589085-79589107 CTGAAGAACCAGCTGCTGAAAGG - Intergenic
1071876744 10:89850959-89850981 CCACAGAAGCAGGTGGAGCAGGG + Intergenic
1072538506 10:96381050-96381072 CTGCAGAAGGACTTGGAGGAAGG - Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1072806268 10:98425641-98425663 CTGGAGAAGAAGCTGAAGGAAGG - Exonic
1074273543 10:111979031-111979053 CTGGAGGAGGAGCGGGAGAAAGG + Intergenic
1075331943 10:121580373-121580395 AAGCAGCAGCAGCTGGAGACTGG + Intronic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075442933 10:122493956-122493978 CTGCATGAGGAGCTGGAGAGGGG - Intronic
1075653695 10:124147269-124147291 CTGCAAAAGCAGGTAGAGAGAGG - Intergenic
1076482818 10:130796045-130796067 CAGCAGAGGCCGCTGGAGGAGGG + Intergenic
1076740241 10:132479282-132479304 CTGGAGCAGGAGCTGGACAAGGG + Intergenic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1077160727 11:1111664-1111686 CTGCGGACCCAGCTGGACAAGGG + Intergenic
1077186315 11:1236902-1236924 CTGCAGAGGCAGCGAGAGAGTGG - Intronic
1077214122 11:1388296-1388318 CAGCAGCAGCAGCGGGGGAAAGG + Intergenic
1077919300 11:6631053-6631075 CTGCACCAGCAGCTGGAGGCTGG + Exonic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1077992247 11:7422426-7422448 CTTGAGAAGGAGCTGGAGACTGG + Intronic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078342161 11:10505420-10505442 CTGCAGCAGCTGCTGGGGATGGG - Intronic
1078696173 11:13634309-13634331 CTGCAGAATATGCCGGAGAAAGG - Intergenic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079190428 11:18272502-18272524 CTGTAGCAGTGGCTGGAGAAAGG + Intergenic
1079493717 11:21017207-21017229 CTGCAACAGCTTCTGGAGAATGG - Intronic
1080321529 11:31015436-31015458 TAACATAAGCAGCTGGAGAAAGG - Intronic
1080690221 11:34550002-34550024 CTGCAGGAGCAGCTGGGGATTGG + Intergenic
1081346927 11:41999365-41999387 CTGAAGAAGCAGCTTCAGTATGG + Intergenic
1081419504 11:42856927-42856949 ATACAGAAGAAGCTTGAGAAAGG + Intergenic
1082825173 11:57572270-57572292 CTGCACAAGCACCTGAGGAAAGG - Intergenic
1083117563 11:60477237-60477259 CTGCAGAAGCTGATGAAAAATGG + Intergenic
1083430447 11:62611478-62611500 CTGCAGCCGCAGCAGGCGAAGGG + Exonic
1083478782 11:62930316-62930338 TTGCAGCTGCAGCTGGAGAGAGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1084178702 11:67436228-67436250 CAGCAGCAGCAGCAGGACAACGG + Exonic
1084335954 11:68457971-68457993 CTCGAGAAGCAGGTGCAGAAGGG - Intergenic
1084789421 11:71463937-71463959 ATGCAGAGTCAGCTTGAGAATGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086351916 11:85950926-85950948 TTGCAAAATCAGCGGGAGAAAGG - Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087182602 11:95154646-95154668 CTGCAGGAGCATTTGGAGGAGGG - Intergenic
1088258791 11:107926017-107926039 GAGCAGAAGCCACTGGAGAAGGG + Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089485636 11:118843832-118843854 TTGTAGAAGAAGCTGGGGAAAGG - Intergenic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090875275 11:130783510-130783532 CAGCAGAGGCAGCTGGTGAGAGG + Intergenic
1091175717 11:133555721-133555743 CTGCAGAGGAGGCTGGAGAAAGG - Intergenic
1091894229 12:4088049-4088071 ATGCAGAAGCAACTGTAGGAAGG - Intergenic
1092106841 12:5927363-5927385 CTACAGAGGCAGATGAAGAAGGG + Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1093067692 12:14675664-14675686 GTGCCTCAGCAGCTGGAGAATGG + Intronic
1093213670 12:16337425-16337447 CTTCAGGAGCAGTTGGGGAAAGG - Intergenic
1094056286 12:26272661-26272683 CACCAGAAGCAGCAGGATAATGG - Intronic
1095641728 12:44493714-44493736 CTGCTGTAGGAGCCGGAGAAAGG + Intergenic
1096077093 12:48812716-48812738 CTGCAGAGCAAGATGGAGAAGGG + Intergenic
1096555477 12:52400990-52401012 CTGCCCGAGCAGCTGGAGATGGG - Intronic
1096841106 12:54379567-54379589 TTGCAGAGGAAGCTGGGGAAGGG - Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1097945171 12:65359669-65359691 TTGCAGAAGCAGCTGCCCAATGG + Intronic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098971712 12:76863973-76863995 CTGGAGAAGCTGCTGGGGAGAGG - Intronic
1099237169 12:80095538-80095560 ATGCAGAAGAAGCTGGAGAGAGG + Intergenic
1099576818 12:84392948-84392970 CTCCTATAGCAGCTGGAGAAAGG + Intergenic
1100620959 12:96272480-96272502 CTGGAGAAACGGCTGGAGAGTGG + Intergenic
1101041883 12:100763634-100763656 CTGCAGGAGCAGCTGGTGTCTGG + Intronic
1101475391 12:105041932-105041954 TTGGAGAAGTAGCTGGAGTAGGG - Intronic
1102107207 12:110335700-110335722 CTACAGAAGCAGCTCAAGAATGG + Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102656660 12:114487690-114487712 CTGAAGAAGAAGATGTAGAATGG + Intergenic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104710559 12:130982806-130982828 CTGAAGTGGAAGCTGGAGAAGGG + Intronic
1104775150 12:131386396-131386418 CTGCAGGAGGGTCTGGAGAAAGG - Intergenic
1104842974 12:131833473-131833495 CTGCGGAAGAGGCTGGAGCAAGG + Intronic
1105250791 13:18697479-18697501 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1105946829 13:25197522-25197544 CTACTGAAGCAGCTGGAACACGG - Intergenic
1106029618 13:25988297-25988319 CTGCACAGGCAGATGGTGAAAGG + Intronic
1106285004 13:28310660-28310682 CTGCAGAGGGAATTGGAGAAGGG - Intronic
1106701878 13:32237866-32237888 CTGCAGCAGCTGCTGCTGAAAGG + Exonic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107294815 13:38897467-38897489 GTGGAGAAGCAGCTGGATATTGG + Intergenic
1107403785 13:40094395-40094417 TGGCAGAAGTAGCTGGAGAGAGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1110817377 13:79876914-79876936 CTCTAGAAGAAGCTAGAGAAGGG - Intergenic
1111728430 13:92041987-92042009 CTACAGAGGCACCTGGAGATGGG + Intronic
1111942339 13:94624015-94624037 CAGCATAAGCAGCTGGAGCCAGG + Intronic
1111976728 13:94974100-94974122 CTACAGATGCAGCTGGATACAGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112629526 13:101145726-101145748 CTGCAGAAGGTCCTGGAGAAGGG - Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114549878 14:23526554-23526576 CTGGAGATGGGGCTGGAGAAGGG + Exonic
1114588376 14:23835896-23835918 GTGAAGATTCAGCTGGAGAAAGG + Intergenic
1114618811 14:24082595-24082617 CTGCAGCAGCAGCTGGGGGCTGG - Exonic
1115733964 14:36303276-36303298 CTAAAGAAAGAGCTGGAGAAAGG + Intronic
1118166857 14:63345194-63345216 CTGCAGCAGCAACTGGAGCAAGG + Intergenic
1118186561 14:63543191-63543213 CTGCAGCGGCAGCAAGAGAAGGG + Exonic
1118737215 14:68710634-68710656 CTGGTGGAGCAGCTGGGGAAGGG - Intronic
1118740777 14:68737877-68737899 CTGCAGAAATAGCTAGAGATTGG - Intergenic
1119193860 14:72702627-72702649 CTGCAGAACCATCTGGGGGATGG + Intronic
1119444606 14:74652764-74652786 CTGGAGAGGGAGGTGGAGAATGG + Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119988335 14:79166040-79166062 CTGCAGAAGGAACTGTAGAAGGG - Intronic
1120228922 14:81821765-81821787 ATGGAGAAGCAGCTAGACAAAGG + Intergenic
1120441871 14:84551627-84551649 CTGCAGTACAAGCTGGAGATAGG - Intergenic
1120851996 14:89180030-89180052 GTGTAGAAGCAGCTGGCGGATGG + Intronic
1120906542 14:89625663-89625685 CCGCAGAGGCTGCTGGAGACCGG + Intergenic
1120979128 14:90275570-90275592 CTGGAGAAGCAGCTGGGGTGGGG - Exonic
1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123829968 15:24125348-24125370 CTGCAGAAGTAGATGCATAATGG - Intergenic
1123844878 15:24289289-24289311 CTGCAGAAGTAGATGCATAATGG - Intergenic
1123860029 15:24455968-24455990 CTGCAGAAGTAGATGCATAATGG - Intergenic
1124254112 15:28127229-28127251 CTGCAGACGCAGCTGGGCATAGG + Intronic
1126104233 15:45136814-45136836 CTACACCAGCAGCAGGAGAATGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126829561 15:52587067-52587089 CAGCAGCAGTAGCAGGAGAAAGG + Intronic
1126963596 15:54026565-54026587 CAGCAAAATCAGCTGGAGACTGG - Intronic
1127099077 15:55546113-55546135 CTGCAGAAGCATCTGCAGTATGG - Exonic
1127311868 15:57759535-57759557 ATGCAGCTGCAGGTGGAGAAGGG - Intronic
1127784447 15:62343372-62343394 CAGCAGAAGCAGCTGGCAGAAGG + Intergenic
1127877291 15:63122166-63122188 CTGGCGAAGCACCTGGAGCAGGG - Exonic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128374181 15:67064269-67064291 CTGCAGCAGCAGCTGCGGATTGG + Intronic
1129667820 15:77589224-77589246 CTGCAGAGGCAGCAGGGGAGAGG + Intergenic
1129673125 15:77617946-77617968 CTGCAGAAGAGCCTGGAGAGAGG - Intronic
1129708509 15:77808236-77808258 CTGCAGATGAGGCTGGAGAGGGG - Intronic
1129821425 15:78604629-78604651 ATGCAGACCCAGCTGGAGACTGG + Intronic
1130394297 15:83488715-83488737 CTGCAGAGGCAGCTGGGCAGGGG - Intronic
1130899493 15:88196423-88196445 CTGCAGAAGAATGTGGAGCAGGG + Intronic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1131667351 15:94584797-94584819 TTGCTGAAATAGCTGGAGAATGG - Intergenic
1132017497 15:98331746-98331768 CAGCAGAAGCTGCTGGAAATTGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1133077224 16:3289223-3289245 CTGGAGAAGCATCAGGATAAAGG - Intronic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1134759477 16:16701336-16701358 CTGCAGAAGGAGATGGAGTGAGG - Intergenic
1134986593 16:18657858-18657880 CTGCAGAAGGAGATGGAGTGAGG + Intergenic
1135953070 16:26933386-26933408 CTTCACTAGCAGATGGAGAACGG - Intergenic
1135994928 16:27240552-27240574 CAGCAGGAGCAGCTGAGGAAAGG + Intronic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136477807 16:30524416-30524438 GTGGAGAAGCCGCAGGAGAATGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136683338 16:31980485-31980507 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136783968 16:32924041-32924063 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136885814 16:33929765-33929787 CTGCAGCTGCTGCTGGAGAATGG - Intergenic
1136933378 16:34437401-34437423 CGGCAAAAGCAGCCGGAGCAGGG + Intergenic
1136971194 16:34974413-34974435 CGGCAAAAGCAGCCGGAGCAGGG - Intergenic
1137299739 16:47137344-47137366 ATGCAGAAGCTGCTGGAGCTGGG + Intronic
1137396793 16:48121824-48121846 TTCCAGATGCAGCTGCAGAAAGG - Exonic
1137440969 16:48498267-48498289 CAGCAGAACCAGCTCAAGAAAGG + Intergenic
1137714943 16:50592825-50592847 GTGCAGAAGCGGGTGGAGACAGG + Intronic
1137808164 16:51327132-51327154 CAGTAAAAGAAGCTGGAGAACGG - Intergenic
1138149961 16:54647717-54647739 CCCCAGAAAGAGCTGGAGAAGGG + Intergenic
1138175355 16:54893109-54893131 CTGCTGCTGCAGCTGGAGATGGG - Intergenic
1138309351 16:56009929-56009951 CTGAAGTTGGAGCTGGAGAAGGG + Intergenic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139530809 16:67541879-67541901 CGGCAGGAGGAGCTGGAGAATGG + Exonic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1141455093 16:84136060-84136082 CTGCAGGTGGAGCTGAAGAAGGG - Intronic
1141832725 16:86518687-86518709 CTGCAGAAGACGCCGGAAAAGGG - Intergenic
1142362023 16:89631876-89631898 GAGCAGAGGCAGCTGCAGAAAGG + Intronic
1203086624 16_KI270728v1_random:1188043-1188065 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1142879519 17:2873510-2873532 AAGCAGCAGCAGCTGCAGAAAGG + Intronic
1143898609 17:10156549-10156571 GTGCAGGAGCTGCAGGAGAAGGG - Intronic
1144073361 17:11694453-11694475 CTGGAGGAGCATCTGCAGAAAGG + Intronic
1144852696 17:18251991-18252013 CTGCAGCTGCAGCTGGTGAGTGG - Exonic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1145898318 17:28473774-28473796 GGGCAGAGGCAGCAGGAGAATGG - Exonic
1146568319 17:33932146-33932168 CTGCAGGAGCACCTGGTGAAGGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG + Intergenic
1147144250 17:38476196-38476218 CTGCAGCTGCTGCTGGAGAATGG + Intronic
1147447122 17:40481163-40481185 GTGCAGGAGAAGCTCGAGAAGGG - Intronic
1148151070 17:45396679-45396701 CTGCAGTCGCTGCGGGAGAAGGG - Exonic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148838060 17:50476826-50476848 CTGCTGAGGCAGCTGGGGGATGG + Intergenic
1148843576 17:50515149-50515171 GAGCTGAAGAAGCTGGAGAAAGG - Intronic
1149685727 17:58533501-58533523 CAGCAGGAGGTGCTGGAGAAAGG + Intronic
1150124116 17:62625844-62625866 CTACTCAAGCTGCTGGAGAAGGG + Intergenic
1150217053 17:63476847-63476869 CCGCAGAGGAAGCTGGAGAAAGG - Intergenic
1150265267 17:63828132-63828154 CTTCAGATGGAGCTGGAGGAGGG + Exonic
1150511592 17:65758148-65758170 TTGCAGAAGTAGCAGAAGAAAGG - Intronic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151692818 17:75697338-75697360 TTGCAGAAGCTGGTGGAGAGTGG - Intronic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1151815991 17:76471664-76471686 TCGCAGAAGCGGCTGGTGAAGGG + Exonic
1152126432 17:78450100-78450122 CTGCAGATGGAGCTGGAAGAGGG - Intronic
1152127182 17:78454258-78454280 CTGCAGGAGCAGCAGGTGATGGG + Intronic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152218750 17:79049390-79049412 TTGCAGGACCAGCTGGAGCAGGG + Exonic
1152536369 17:80952433-80952455 CTGCAGCAGAAGCTGGCGGAGGG - Intronic
1152757038 17:82091392-82091414 GTGCAGAAGCTGCTGGAGCAGGG - Exonic
1152926027 17:83088167-83088189 CTGCAGAGGCGGCTGGTGCAGGG - Intronic
1153621125 18:6979051-6979073 CAGCAGAAAAAGCTGGAAAAAGG + Intronic
1154438059 18:14361447-14361469 CGGCAGATGCAGCTGGAAGATGG - Intergenic
1155175432 18:23297702-23297724 CTGCAGAACCAGCTACAGCACGG + Exonic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155577016 18:27259270-27259292 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157468983 18:47973319-47973341 CTGGAAAAGCAGCTAGATAAGGG + Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157807533 18:50669178-50669200 CTGCAGAGGAAGCGGTAGAAAGG - Intronic
1158632066 18:59123886-59123908 AGTCAGAAGCAGCTGGATAATGG - Intergenic
1158889359 18:61858704-61858726 ATGGAGAAGAAGCTGGAGAGTGG + Intronic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160542274 18:79630599-79630621 CTGAAGGAGCCGCTGTAGAATGG - Intergenic
1160918019 19:1506917-1506939 CTGCAGGAGGACCTGGAGCAGGG + Exonic
1161163175 19:2771889-2771911 CGGAAGGAGCAGGTGGAGAAGGG - Intronic
1161299699 19:3536837-3536859 CTGCAGAAGCAGCTTCTGAGGGG + Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1163654835 19:18539612-18539634 CTGCAGACGTCGCTGGAGAATGG - Exonic
1164441576 19:28283809-28283831 GTGGAGAAGAAGGTGGAGAAAGG - Intergenic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165485412 19:36092567-36092589 TTCCAGGAGCATCTGGAGAATGG + Intronic
1165933617 19:39375916-39375938 CTGCAGAAGCCCCTGGAAAAGGG - Intronic
1166398124 19:42457400-42457422 CTGGAGATGAAGCTGGTGAAGGG + Intergenic
1166523398 19:43495977-43495999 ATCCAGAAGCAGGTGGGGAAAGG + Intronic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166774946 19:45306787-45306809 ATGGAGAAGAAGTTGGAGAAAGG - Exonic
1167374337 19:49103066-49103088 CTGCAGACGCAGCTGGTGGGAGG + Intronic
1167442130 19:49514441-49514463 CTGCGGGAGCACCTGGAGAGGGG + Exonic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1168048389 19:53810397-53810419 CTCCAGCAGCAGCTGGAGGGTGG - Exonic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168269163 19:55240292-55240314 CTGCAGCAGCTGCGGGAGAGCGG + Exonic
1168339399 19:55614747-55614769 CTGCACACGGAGCAGGAGAAGGG - Exonic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926309218 2:11662329-11662351 CAGCAGAAGGAGCGGCAGAAGGG + Intronic
927093407 2:19729316-19729338 CAGCAGAAGCACCTGGAAAGCGG + Intergenic
927097676 2:19759990-19760012 CTGCAGAGGAAGCTGGTGTATGG - Intergenic
927105965 2:19825756-19825778 CTGGAAAAGGAGCTGGATAAGGG + Intergenic
927408268 2:22796836-22796858 CTGCAGAGGCAGATACAGAAGGG + Intergenic
927638457 2:24832233-24832255 CAGCAGCTGCAGCTGGAGAGTGG - Intronic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
929429856 2:41878081-41878103 GGGCAGTCGCAGCTGGAGAACGG + Intergenic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
931355961 2:61537917-61537939 CAGCAGAAGCGGCAGGAGTAGGG + Exonic
932494816 2:72141060-72141082 ATGGAGAAGGAGCTAGAGAATGG - Intronic
932609904 2:73191166-73191188 CTGCAGAGGCATCTGAAGAGAGG - Intergenic
933381082 2:81546582-81546604 CTCTGGAAGCTGCTGGAGAAAGG + Intergenic
933646180 2:84814460-84814482 CAGCACATGCAGCTGGTGAAAGG - Intronic
933785602 2:85838761-85838783 CTGCACAAGCAGTTGCAGGAAGG + Intergenic
933916004 2:86994211-86994233 CTTCAGAATCACCTGGAGTAAGG + Intronic
934006989 2:87775691-87775713 CTTCAGAATCACCTGGAGTAAGG - Intronic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934761873 2:96861038-96861060 CTGCGGGAAGAGCTGGAGAAAGG - Exonic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
935312674 2:101801074-101801096 CAGCAGCAGCAGCTGGGGAAAGG - Intronic
935644744 2:105325054-105325076 ATCCAGAAGTAGCTGGAGAATGG - Intronic
935770632 2:106416597-106416619 CTTCAGAATCACCTGGAGTAAGG - Intronic
935909454 2:107879338-107879360 CTTCAGAATCACCTGGAGTAAGG + Intronic
935967585 2:108496340-108496362 CTTCAGAATCACCTGGAGTAAGG + Intronic
936131231 2:109844474-109844496 CTTCAGAATCACCTGGAGTAAGG + Intronic
936213466 2:110527011-110527033 CTTCAGAATCACCTGGAGTAAGG - Intronic
936422604 2:112381570-112381592 CTTCAGAATCACCTGGAGTAAGG - Intronic
937053145 2:118908496-118908518 CTGAAGATCCAGCTGGGGAAAGG + Intergenic
937073967 2:119087601-119087623 CTGTAGAAGCATCTGGAAATGGG - Intergenic
937079692 2:119131874-119131896 CTGCTGAGGCACCTGGAGAAGGG + Intergenic
937357723 2:121208858-121208880 CAGCAGAAGGTGCTGGAGAGGGG + Intergenic
937769171 2:125698512-125698534 TTGTAGAAGACGCTGGAGAATGG - Intergenic
938282181 2:130072241-130072263 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
938332808 2:130460813-130460835 CTGCAGAGGCAGTGGCAGAAAGG + Exonic
938357000 2:130659858-130659880 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
938433436 2:131266664-131266686 CTGCAGAGGCAGTGGCAGAAAGG - Intronic
938477477 2:131629247-131629269 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
939649401 2:144742803-144742825 CTGCAAAAACAGCTGCAAAATGG - Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
940694544 2:156961881-156961903 TTAAAGAAGGAGCTGGAGAAAGG - Intergenic
941115426 2:161466822-161466844 CTTCAGATAGAGCTGGAGAAAGG - Intronic
941180175 2:162250247-162250269 CTTCAGAAGTGGCTGGAGATAGG - Intergenic
941323661 2:164086511-164086533 GTGCAGAAGTAGCTGGACCAAGG - Intergenic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942334069 2:174862167-174862189 CTGCAGGATCAGCTGTAGAAAGG + Intronic
942485302 2:176433061-176433083 CTCCAGAAGCTTCTTGAGAAAGG + Intergenic
942620650 2:177842222-177842244 CTGCAGCAGGAGCTGGGGAGAGG + Intronic
942831801 2:180245333-180245355 TTTAAGAAGAAGCTGGAGAACGG - Intergenic
944229190 2:197376217-197376239 CTCCAGCAGCACCTGGATAAGGG + Intergenic
944441453 2:199747764-199747786 GTGCAGAATGAGCTGGAAAATGG - Intergenic
945517576 2:210781887-210781909 CTCCAGCAGCAGCTGAATAAAGG - Intergenic
946386139 2:219385662-219385684 ATCCAGGAGGAGCTGGAGAAGGG - Exonic
946416068 2:219540359-219540381 CAGAAGCAGCAGCTGGTGAATGG - Exonic
946434270 2:219641576-219641598 TTGGAGGAGGAGCTGGAGAATGG + Intronic
947531466 2:230911375-230911397 CTTCAGGAGCAGCTGGATCAGGG + Intronic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
948356841 2:237384847-237384869 CTGGAGAAGCAGCTGCTGTAGGG - Intronic
948608354 2:239151006-239151028 TTGCAGAAACTGCTGGAGAGGGG - Intronic
948643003 2:239387279-239387301 CTGCAGCAGGGGCTGGAGAGTGG + Intronic
948987249 2:241533102-241533124 TTCCAGAAGCAGCTGCCGAACGG - Intergenic
1169144541 20:3243828-3243850 GAGCAGCTGCAGCTGGAGAAGGG - Intergenic
1169777003 20:9265892-9265914 CTGAAGAAGCATCTTGGGAATGG + Intronic
1170052927 20:12166503-12166525 CTGCAGAAACTGCTGGCCAATGG - Intergenic
1170555145 20:17508941-17508963 CTGCGGAGTCAGCTGGAGGAGGG - Exonic
1170571562 20:17635633-17635655 CTTCAGGAGCAGCTGGAGAATGG - Exonic
1171388567 20:24786585-24786607 CTCAGGAAGCAGCTGGAGAAGGG - Intergenic
1171393384 20:24815655-24815677 CAACAGAGGCAGGTGGAGAAGGG - Intergenic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1171506738 20:25642450-25642472 CAGCAGAAGGTGCAGGAGAAAGG + Intergenic
1172100799 20:32483279-32483301 CGGCGGCAGCAGCCGGAGAAGGG + Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172192401 20:33069830-33069852 CGGCAGAAGGAGCTTGAGGACGG - Intronic
1172233000 20:33349667-33349689 CTTCAGAGGCCGCTGGAGAGTGG - Intergenic
1172483650 20:35286231-35286253 ATGCACAAGCTGCTGGAGAAGGG - Exonic
1172602097 20:36190870-36190892 CTGCAGAATGAGCAGGAAAATGG + Intronic
1172782914 20:37447786-37447808 CTGCAGAGGAAACAGGAGAAGGG - Intergenic
1172887461 20:38240837-38240859 CTGCAGGAGAAGCTGGGGACAGG + Exonic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1174164405 20:48574631-48574653 CTCCAAAAGCAGCTGGACCAAGG + Intergenic
1174465120 20:50711389-50711411 GTGCAGAATCAACTGGAGAGGGG + Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175245849 20:57581511-57581533 CAACAGAAGGGGCTGGAGAATGG - Intergenic
1175478621 20:59295443-59295465 CTCCAGAACCAGCAGCAGAATGG - Intergenic
1175750558 20:61494087-61494109 CTCCAGGAGCAGGTGGAGACAGG + Intronic
1176457618 21:6928022-6928044 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1176835790 21:13793106-13793128 CGGCAGATGCAGCTGGAAGATGG + Intergenic
1177168962 21:17634505-17634527 TTGCAGATGTAGCTAGAGAAAGG + Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179996497 21:44976768-44976790 CGGCAGATGCAGCTGGAAGATGG + Exonic
1180038992 21:45266129-45266151 CTGGAGAAACCCCTGGAGAAGGG - Intronic
1180084583 21:45502107-45502129 CTGCAGAAGGACCCGGAGCAGGG + Intronic
1180129415 21:45817505-45817527 CTGCGGCAGCAGCTGGAATATGG - Intronic
1180590340 22:16931913-16931935 TTGCAGAAGAAACTGCAGAAGGG + Intergenic
1181409808 22:22710925-22710947 TGGCAGAAGCACCTGGAGATGGG + Intergenic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG + Exonic
1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG + Intergenic
1182432588 22:30309042-30309064 ACACAGAAGCATCTGGAGAAGGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182529605 22:30945047-30945069 CTGCAGGGCCACCTGGAGAAAGG - Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182558466 22:31141503-31141525 CTGGAGAAGCAGCAGGCTAATGG - Intergenic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1183404327 22:37623040-37623062 CTTCAGAAGCACCTGGTGAGGGG + Intronic
1183674191 22:39290701-39290723 GTGGAGGAGCAGCTGGGGAAAGG - Intergenic
1183711175 22:39504381-39504403 CGGGAGAGGCAGCTGGAGAAGGG + Exonic
1184080237 22:42214177-42214199 CCACAGAGGCAGCTGGAGAAGGG + Exonic
1184095624 22:42314785-42314807 CTGGAGCAGCATCTGGAGAGGGG + Intronic
1185101205 22:48841811-48841833 CTGCAGATGGAGCTGGGGGATGG + Intronic
1185267568 22:49912281-49912303 CTGCAGCTTCAGCTGGTGAACGG - Intronic
949406342 3:3718644-3718666 CAGCACAGCCAGCTGGAGAATGG + Intronic
950234687 3:11308482-11308504 CTGCAGACTCTGCTGGGGAACGG - Intronic
950434950 3:12973904-12973926 GTGCAGAAGGAGCTGGGGAAAGG - Intronic
950456489 3:13095747-13095769 CTCCAGATGCAGCAGGACAATGG + Intergenic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950662551 3:14475574-14475596 CTGAAGAGGCTGGTGGAGAAGGG + Intronic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
953533432 3:43758476-43758498 CTTCAGTAGCAGCTGTGGAAGGG + Intergenic
953563687 3:44013661-44013683 CTGCAGCAGCCCCTGGGGAAGGG - Intergenic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954894341 3:53963311-53963333 CAGCAGAAGAGGCTGGAGGAAGG + Intergenic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
959018735 3:101165510-101165532 TTTCAAAAGCAACTGGAGAATGG - Intergenic
959601952 3:108197122-108197144 CTGCAGCAGTAACTGGAAAATGG - Intronic
960229130 3:115204167-115204189 CTGCAGAAGCATGTGGCAAAGGG - Intergenic
960583703 3:119301713-119301735 CTGCAGCAGTGGGTGGAGAAAGG + Intronic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960944525 3:122957031-122957053 CTGGAGAAGCTGGTGGAGAGAGG + Intronic
961356051 3:126340719-126340741 CTGAAAAAGCAGGTGGAGATGGG - Intergenic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
962592722 3:136907134-136907156 CTGCTGCAGCAGCAGGAGCAAGG - Intronic
964726561 3:159819845-159819867 CTGCAGAAGAATCTGTGGAAGGG - Intronic
964748401 3:160032858-160032880 CTGGAGAACCTGCTGGAAAACGG - Intergenic
964923478 3:161926763-161926785 CTGCAAAAGCAGCTGGGAAGGGG + Intergenic
965347901 3:167575053-167575075 ATGCAGAAGCTTCTGCAGAAGGG + Intronic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
968494282 4:906874-906896 CCGCAGAAGCAGCTTGTGAGGGG - Intronic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
968722827 4:2220321-2220343 CTGCAGAAGTAGCTGGGAAGTGG - Intronic
968813753 4:2811415-2811437 GGGCAGAGGCAGCTGGAGAAAGG - Intronic
969046834 4:4342473-4342495 CTGCCGAAGGAGCTGCAAAAGGG - Intergenic
969145742 4:5122888-5122910 CAGCTGAAGTAGGTGGAGAAGGG - Intronic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970575437 4:17422570-17422592 CTCCAGGAGCACCTGGAGCACGG - Intergenic
972218980 4:36931789-36931811 GTGCACAATCAGCTGAAGAATGG - Intergenic
972330237 4:38057409-38057431 CTGCAGGAGCTGCCGGAGATGGG - Intronic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
976187694 4:82458786-82458808 CTGCAGATGCCATTGGAGAAAGG - Intronic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976734637 4:88297076-88297098 CTGCAGCAGCGGCTGCAGCAAGG - Intergenic
977649529 4:99454034-99454056 CTGCAGAGGCAGTGGTAGAAAGG + Intergenic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
978387772 4:108192765-108192787 CTGCAGAAGGAGGTGGAGAGGGG + Intergenic
978850028 4:113323845-113323867 ATGCAGAAGGAGATGGCGAAAGG - Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982108299 4:152030253-152030275 CACCAGAAGCTGCTGTAGAAAGG - Intergenic
982392279 4:154877615-154877637 CTGCAGAACCAGCTGCTGAGAGG + Intergenic
982650431 4:158081662-158081684 CTGCAGGAGCAGCTGCAGGCAGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
985229333 4:187798522-187798544 CTGCAGCTGCTGCTGGAGGATGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
987108802 5:14665346-14665368 CTGCTGCAGCCGCCGGAGAACGG + Intronic
987249362 5:16082546-16082568 CTGCAGAAGCAGTTGTGCAAAGG + Intronic
987570677 5:19654100-19654122 CTGCAGAGGCTGCTAAAGAAAGG - Intronic
987764956 5:22214225-22214247 CTGCAGAAGCCCCAGGAGATGGG + Intronic
988730716 5:33970156-33970178 CTGCAGCAGCTGCTGGAGCAAGG - Intronic
989466004 5:41756697-41756719 CTGCTGAAGAAGGGGGAGAAAGG + Intronic
990013406 5:51027488-51027510 CTGCAGAGGAAGCTTGAGATGGG + Intergenic
990763191 5:59153222-59153244 CTCCAGTAGCAGCGGGTGAAAGG + Intronic
991230416 5:64326515-64326537 CTGCATATTCAGCTGGAGATTGG + Intronic
991547622 5:67800817-67800839 CTGCAGAAGCAGATGAGGAGAGG + Intergenic
992229330 5:74648459-74648481 CTGCAGATTGTGCTGGAGAAGGG - Intronic
992676329 5:79109802-79109824 CTGCAACAGCAGCTGGGGAAAGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994689838 5:103004064-103004086 GTGCTTAAGCAGATGGAGAAGGG - Intronic
995557052 5:113340622-113340644 CTCCAGAAGCTGCTCGAGTATGG - Exonic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
995927104 5:117387080-117387102 GGGCACAAGCAGCTGGAGAAGGG - Intergenic
996164140 5:120204756-120204778 CTTCATTAGCAGCAGGAGAATGG - Intergenic
996230771 5:121060879-121060901 CTTCAGAAGCATGTGGAGCATGG + Intergenic
996624138 5:125549553-125549575 TTGCAGAAACAGCTAAAGAAAGG - Intergenic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
997370624 5:133357376-133357398 CTGAAGATGCAGCTAGAGAGAGG - Intronic
998696521 5:144646812-144646834 CTGCAGTGGCAGCTGAAGAATGG - Intergenic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999124711 5:149238752-149238774 CTGGTGCAGCAGCTGGAGATGGG - Intronic
999200458 5:149812734-149812756 CTGCAGGAGCATTTGGACAAGGG - Intronic
999251009 5:150182365-150182387 CTTCACAAGCTCCTGGAGAATGG + Intronic
999269496 5:150288608-150288630 CTGCTGAGGCAGCAGGAGCACGG - Intronic
1001116725 5:168946588-168946610 CTGCAGAAGATGCTGGAGCCAGG - Intronic
1002170048 5:177369868-177369890 CTGCAGGAGCAGGTGGAGTGTGG - Intronic
1002433887 5:179219889-179219911 CTGCAGAGGCCGCTGGAGAGTGG - Intronic
1002999767 6:2319956-2319978 CAGAAGAAGCAGCTGGACACTGG - Intergenic
1003516902 6:6825365-6825387 CAGCAGTGGCACCTGGAGAAGGG - Intergenic
1003556789 6:7147004-7147026 CTCCAAAAACAGCTGGAGACTGG - Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003954790 6:11151794-11151816 CTGCAGAATCACCTGAAGAGAGG - Intergenic
1005822083 6:29606710-29606732 CTCCAGATTCAGCTGAAGAAAGG - Intronic
1006429653 6:33988023-33988045 CTTCGGGATCAGCTGGAGAACGG + Intergenic
1007177470 6:39906679-39906701 CAGCAGAACCAGCTCAAGAAAGG - Exonic
1007211164 6:40194405-40194427 CAGCAGAAACACCTGGGGAAGGG + Intergenic
1007322416 6:41037302-41037324 CTGCAGAAGCTCCTTGAGAGCGG - Intronic
1007402066 6:41608545-41608567 CTGCTGAGTCTGCTGGAGAAGGG - Intergenic
1007655726 6:43450027-43450049 CTGCAGCAGCTGCTGGAACAGGG - Exonic
1008711320 6:54230496-54230518 CTGCAGAAGAGGCTGGAGGCAGG + Intronic
1010314743 6:74434796-74434818 TTGCAGAAGACGATGGAGAATGG - Intergenic
1011063170 6:83294616-83294638 CTGCAGAGGCAGTGGCAGAAGGG - Intronic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1012535191 6:100287570-100287592 TTGGAGAGGCAGCTGGGGAAGGG + Intergenic
1013086207 6:106859872-106859894 CTGCAGCTGGAGCTGGGGAAAGG + Intergenic
1013343680 6:109239071-109239093 ATTCAGTAGCAACTGGAGAAAGG - Intergenic
1013632965 6:112002678-112002700 ATGGAGAAGAAGCTGGAGAGAGG + Intergenic
1013848656 6:114486205-114486227 CAGCAGAAGCTGGTGGATAAGGG + Intergenic
1015990606 6:138937624-138937646 ATGCAGAAGGAGATGGAGACAGG + Intronic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016580790 6:145627636-145627658 CTGCATGCGCTGCTGGAGAAGGG - Exonic
1017969049 6:159294705-159294727 CAGAAGAAATAGCTGGAGAAGGG + Intergenic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1018584292 6:165338756-165338778 CTGCAACGGCAGCTGTAGAAAGG + Intronic
1019148613 6:169989348-169989370 CAGCAGTAGCAGCTGAGGAAAGG - Intergenic
1020731064 7:11881264-11881286 CCTCAGAAGCAGTAGGAGAATGG + Intergenic
1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG + Intronic
1023048513 7:36231700-36231722 TTGCAGAATCAGCAGAAGAAAGG + Intronic
1024222998 7:47303039-47303061 CTGGAGAAGCCACTGGAGGAGGG + Exonic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1027225923 7:76243672-76243694 CCCCACAAGCAGCTGGGGAATGG + Intronic
1027525898 7:79268161-79268183 CCTTAGAAGCAGCTGCAGAATGG - Intronic
1028131553 7:87181547-87181569 CTGAGGAAGCATCTGGTGAATGG - Intronic
1028595035 7:92539146-92539168 CTCTGGAAGCAGCTGAAGAACGG + Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030319672 7:108152189-108152211 CTGCAGAAGGTGTTGGAGAAGGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1032017108 7:128387356-128387378 CTGCAGGAGTGGCTGGAGAGAGG - Intergenic
1032978190 7:137249981-137250003 CTGCAGAAGGTGATGGAGATTGG - Intronic
1033235803 7:139637006-139637028 CTGCCTAAGCAGCTGGAGGGTGG - Intronic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1033579002 7:142714546-142714568 CTCCAGAAGAAGCTGGTGAAAGG - Intergenic
1034056262 7:148038333-148038355 CTGCGGAAGCAGCTTGGGAAAGG - Intronic
1034073043 7:148206532-148206554 CTGCAGGTGCTGCTGAAGAAAGG - Intronic
1034441623 7:151088592-151088614 CTCCAGAAGGAGCTGGGGGAAGG - Intronic
1035049530 7:155990509-155990531 CTGGAGGAGCAGCTGGGGAAGGG + Intergenic
1035292637 7:157849467-157849489 CTGCAGCAGCATCTCGGGAAGGG - Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1037948101 8:23001834-23001856 CTGCTGAAGGGGCTGGGGAATGG + Intronic
1040571434 8:48614944-48614966 TTGCAGAAGCTACTGGAGCATGG + Intergenic
1041644068 8:60233618-60233640 CTGTTGTTGCAGCTGGAGAAGGG - Intronic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041876861 8:62698398-62698420 CTGCAGGAGGAGCTTGAGTAGGG - Intronic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1043484412 8:80685085-80685107 CTCCAGAAGAAGCTGGATAGTGG - Intronic
1044354008 8:91199222-91199244 CTGCTTAAGTAGTTGGAGAAAGG + Intronic
1044476377 8:92631093-92631115 TATCAGAAGTAGCTGGAGAATGG + Intergenic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046247555 8:111584700-111584722 ATGCAGAAGAAGCTGGAGAATGG + Intergenic
1046480994 8:114818317-114818339 CTGCAGCTGAAGCAGGAGAATGG + Intergenic
1048572027 8:135664444-135664466 CTGCAGAAGCAGCTGCTGCTCGG + Intergenic
1048919311 8:139213448-139213470 CTGCAGGTGCTGCTGCAGAAGGG - Intergenic
1049057659 8:140251614-140251636 CAGTAGATGCAGCTGGGGAAGGG - Intronic
1049066666 8:140321727-140321749 CTGCAGGAGGCGTTGGAGAATGG - Intronic
1049361276 8:142213549-142213571 GGGCAGAGGCAGCTGGAGACAGG + Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050426571 9:5517622-5517644 CTGCAGAATCAACTGCAGGAAGG + Intronic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1051067447 9:13121766-13121788 CTGCAGAAGAAGCCGGGAAAAGG - Exonic
1051091299 9:13412025-13412047 TCCCAGAAGGAGCTGGAGAAAGG - Intergenic
1051784786 9:20730553-20730575 CTTTAGAAGCAGCTTGAGAGAGG + Intronic
1052275693 9:26673723-26673745 CTTGAAAAGCAACTGGAGAAGGG - Intergenic
1052701793 9:31946906-31946928 CAGGAGGAGCAGCTGGACAATGG - Intergenic
1052752620 9:32508104-32508126 CTACAGAAGCAAGTGGAAAATGG + Intronic
1053000895 9:34576926-34576948 CTGCAGAAAGGGCAGGAGAAGGG + Intronic
1053086921 9:35232856-35232878 CTGGAGTAGAAGCTGGAGAGTGG + Intronic
1053305178 9:36979862-36979884 CTGCACAAGGAGCTGTAGACAGG - Intronic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1054755862 9:68957195-68957217 CTGCAGAAGTCCCTGGAGAGAGG - Intronic
1056127865 9:83554687-83554709 CTGCAGAAGCAGTGGAAGAGAGG + Intergenic
1056835486 9:89951772-89951794 CAGCTGGAGAAGCTGGAGAATGG - Intergenic
1057313841 9:93956920-93956942 CAGCAGCTGGAGCTGGAGAAAGG - Intergenic
1057750447 9:97788316-97788338 CTGCTGAAGCCACTGTAGAAAGG - Intergenic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059070771 9:111133653-111133675 CTGCTGAAGCAGCTGGATTATGG + Intergenic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1059506729 9:114806009-114806031 CTCCAGGAGCAGCAGGAGCATGG - Exonic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060934750 9:127508480-127508502 CTGCACCAGGAGCTGGGGAAGGG - Exonic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1061768340 9:132897183-132897205 CAGCTGAAGCAGCAGAAGAAAGG - Exonic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1186444024 X:9610605-9610627 ATGCAGAAGCAGCAAAAGAATGG - Intronic
1187881807 X:23854199-23854221 GTGCAGAAGCAGCTGGACTGTGG - Intronic
1188286811 X:28336558-28336580 CTGTAAAAGCTGCTGGAGCAGGG + Intergenic
1189227059 X:39421827-39421849 CTGCTGAGGAGGCTGGAGAAAGG + Intergenic
1190114585 X:47618412-47618434 TTGAAGAAGTAGCTGGAGAACGG + Intronic
1191122991 X:56925609-56925631 CTGCAGAGGCAGTGGCAGAAGGG + Intergenic
1191714914 X:64187570-64187592 CTCCAGACCCTGCTGGAGAAGGG - Exonic
1191922503 X:66271410-66271432 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
1191966969 X:66769276-66769298 CTGGAGAACAAGCTAGAGAAAGG - Intergenic
1192495610 X:71615045-71615067 CTGCAGAAACGGCCGGAGATGGG - Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1194448982 X:94018812-94018834 CTGCTCAAGTAGCTGCAGAATGG - Intergenic
1194542884 X:95196552-95196574 CCGCAGAAGCAGCGGCAGCATGG + Intergenic
1198963874 X:142207833-142207855 CTGCTGTAACACCTGGAGAAAGG - Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199871270 X:151900987-151901009 CCTCAGAAGGAGCTGGAGAGGGG + Intergenic
1199996542 X:153029967-153029989 CTGCAGATGGCCCTGGAGAAGGG + Intergenic
1200034647 X:153319560-153319582 CTGCAGAAGGCCGTGGAGAAGGG - Intergenic
1200093888 X:153648281-153648303 CTGCAGAAGCTGCGAGAGGAAGG + Exonic
1200397491 X:155999668-155999690 CCCCAGAAGCAGCTGGAGCCTGG - Intronic