ID: 1083954968

View in Genome Browser
Species Human (GRCh38)
Location 11:65978076-65978098
Sequence TGCCCACTAGAGACAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083954968_1083954971 7 Left 1083954968 11:65978076-65978098 CCTCAGTTTGTCTCTAGTGGGCA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1083954971 11:65978106-65978128 CTCTTTGCAAGCCTGGCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 209
1083954968_1083954973 17 Left 1083954968 11:65978076-65978098 CCTCAGTTTGTCTCTAGTGGGCA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1083954973 11:65978116-65978138 GCCTGGCAGGAGGGTCAGACAGG 0: 1
1: 0
2: 2
3: 32
4: 330
1083954968_1083954972 8 Left 1083954968 11:65978076-65978098 CCTCAGTTTGTCTCTAGTGGGCA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1083954972 11:65978107-65978129 TCTTTGCAAGCCTGGCAGGAGGG 0: 1
1: 0
2: 3
3: 19
4: 226
1083954968_1083954975 24 Left 1083954968 11:65978076-65978098 CCTCAGTTTGTCTCTAGTGGGCA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1083954975 11:65978123-65978145 AGGAGGGTCAGACAGGCACTCGG 0: 1
1: 1
2: 4
3: 23
4: 235
1083954968_1083954969 0 Left 1083954968 11:65978076-65978098 CCTCAGTTTGTCTCTAGTGGGCA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1083954969 11:65978099-65978121 CAGCAGTCTCTTTGCAAGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 262
1083954968_1083954970 4 Left 1083954968 11:65978076-65978098 CCTCAGTTTGTCTCTAGTGGGCA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1083954970 11:65978103-65978125 AGTCTCTTTGCAAGCCTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 172
1083954968_1083954976 25 Left 1083954968 11:65978076-65978098 CCTCAGTTTGTCTCTAGTGGGCA 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1083954976 11:65978124-65978146 GGAGGGTCAGACAGGCACTCGGG 0: 1
1: 0
2: 0
3: 18
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083954968 Original CRISPR TGCCCACTAGAGACAAACTG AGG (reversed) Intronic
900964422 1:5947912-5947934 TGCCCATTAGGAACAAACTTTGG - Intronic
902545174 1:17185450-17185472 TACCCTCTGGAGATAAACTGGGG + Intergenic
906750466 1:48254089-48254111 TGCCCCAAGGAGACAAACTGTGG - Intergenic
909932921 1:81518601-81518623 TGATTTCTAGAGACAAACTGTGG + Intronic
910071806 1:83224735-83224757 TAACCTCTAAAGACAAACTGGGG - Intergenic
911049544 1:93659016-93659038 TGCCCTCCACAGGCAAACTGGGG + Intronic
918222102 1:182444527-182444549 TCCCCACTAGAGATGAACAGGGG + Intergenic
923739707 1:236644221-236644243 TGGGCACCAGAGACAGACTGTGG + Intergenic
923825952 1:237500995-237501017 TGCCCAGGAGAGACAAACAATGG - Intronic
1064130244 10:12702975-12702997 TCCCCATTACAGAGAAACTGAGG + Intronic
1067342509 10:45417305-45417327 TGCCCACTCTGCACAAACTGTGG + Intronic
1071588131 10:86845552-86845574 TGCCCACCAGAGCCACAGTGCGG + Intronic
1075921660 10:126218478-126218500 AGCCAACAAGAGACATACTGAGG + Intronic
1076018593 10:127050760-127050782 TGCCTAGTACAGACAAACTTTGG - Intronic
1076412632 10:130262754-130262776 AGCCCAAGAGAGAGAAACTGTGG - Intergenic
1081446504 11:43136317-43136339 TGCCCACAAGAGTCATTCTGTGG - Intergenic
1083954968 11:65978076-65978098 TGCCCACTAGAGACAAACTGAGG - Intronic
1086731900 11:90260689-90260711 TCTCCATTAGAGTCAAACTGAGG + Intergenic
1086928321 11:92665247-92665269 TGCACAGCAGAGACGAACTGAGG - Intronic
1088740032 11:112759768-112759790 TGCCCACTACAGAGGTACTGAGG + Intergenic
1091415348 12:278099-278121 TGCCTACTTGAGTCAATCTGTGG + Intergenic
1100897384 12:99199004-99199026 GGCCCATTAGAGAAAAACTAAGG + Intronic
1104067329 12:125316728-125316750 TGTCCACTAGACACAAAGTGGGG + Intronic
1107202112 13:37734017-37734039 TGCCCAGCAGAGATAAAATGAGG + Intronic
1108666776 13:52640662-52640684 TGCCCTCCAGAGACACACTGGGG + Intergenic
1110796485 13:79644415-79644437 TAGCCACAAGAGATAAACTGGGG - Intergenic
1111857204 13:93653166-93653188 TGCCCAAGGGAGAGAAACTGAGG - Intronic
1114726125 14:24939656-24939678 TGTCCAATAGAAACAAAATGTGG + Intronic
1115415083 14:33123280-33123302 GACCTACTAGAGACAAAGTGGGG + Intronic
1120514769 14:85457594-85457616 TGACCCCTAGAGTCAAACTAGGG + Intergenic
1121678026 14:95770232-95770254 TTCCAAATAGAGACACACTGGGG - Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1125574132 15:40743909-40743931 TACCCACTAGGGACAAACTCTGG - Intronic
1127068799 15:55267909-55267931 TGCCCACAAGACAGGAACTGTGG - Intronic
1127184983 15:56469491-56469513 AGCCCAGAAGAGGCAAACTGTGG + Intergenic
1129075026 15:72986963-72986985 TGCACACTGGAAACAAACTGAGG + Intergenic
1131823121 15:96293069-96293091 TTCCCACTGGAGCCACACTGAGG + Intergenic
1132082411 15:98878228-98878250 TGTCCCGTAGGGACAAACTGGGG - Intronic
1134034582 16:11020036-11020058 TGAACACCAGAGACACACTGGGG - Intronic
1135652998 16:24223236-24223258 AGTCCATCAGAGACAAACTGGGG - Intergenic
1138766014 16:59604968-59604990 TGACCACTGAAGAGAAACTGAGG - Intergenic
1140179259 16:72697807-72697829 AGGCAACTAGAGATAAACTGAGG - Intergenic
1143040827 17:4035271-4035293 TGCCCTCTTGAGTCACACTGAGG - Intronic
1150475548 17:65471835-65471857 TGTCAAATAGAGAGAAACTGAGG + Intergenic
1152293843 17:79455361-79455383 TGCCCAGGAGAGACCACCTGAGG + Intronic
1152395552 17:80030741-80030763 TGCCCACTAGTGACAGGCAGGGG + Intronic
1155363468 18:25027252-25027274 TGCCCCTTATAGACAAATTGGGG + Intergenic
1157353808 18:46915469-46915491 TGCCCAACAGAGACTAACTGGGG - Intronic
1158704940 18:59783896-59783918 TGACAACTAGATGCAAACTGTGG + Intergenic
1167224785 19:48230572-48230594 TGCCCATCAGAGAGAAGCTGGGG + Exonic
1168492360 19:56821542-56821564 TGCCCCCTAGAGTCCAGCTGGGG - Intronic
929917548 2:46148585-46148607 TGCCCAGTAGATACACACAGTGG + Intronic
930324347 2:49896099-49896121 TGCCTGCTAGAGATACACTGAGG + Intergenic
934698987 2:96423534-96423556 TCCCCACTTGAAACAAAGTGAGG - Intergenic
939597836 2:144149219-144149241 TTCCTGCTAGAGACACACTGTGG - Intronic
940085905 2:149858350-149858372 TGTCCACTAGGGAATAACTGAGG + Intergenic
944269063 2:197760458-197760480 TGCCCACCAGAGGCAGCCTGTGG - Intronic
948807036 2:240457495-240457517 TACCCACTAGAGGCCATCTGGGG - Intronic
1173152598 20:40580666-40580688 TGCCCACTGGAGAGGTACTGAGG - Intergenic
1173831617 20:46092468-46092490 TCCCCACTAGATACAGAGTGTGG - Intergenic
1175040310 20:56043452-56043474 AGCCCACAAGTGACAAAATGAGG + Intergenic
1175615995 20:60398708-60398730 TGCTCACCAGAGACGCACTGCGG - Intergenic
1175812505 20:61866086-61866108 TGGCCACTACAGAACAACTGAGG - Intronic
1177406185 21:20671497-20671519 TGCCCACATGAGATTAACTGGGG + Intergenic
1177617123 21:23537474-23537496 TACCCAAGAGAGACATACTGTGG + Intergenic
1182605729 22:31501824-31501846 TGCCAACTACAGACAGACAGTGG - Intronic
1183305377 22:37080213-37080235 TGCCCACTTGAGCCCAGCTGAGG - Intronic
1183573454 22:38671604-38671626 TGCCCAGTACAGACCAGCTGAGG + Intronic
1184829604 22:46975949-46975971 TGCCCACTAGAGATATATTTTGG + Intronic
950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG + Intergenic
955802979 3:62705286-62705308 CTCCCACAAAAGACAAACTGAGG + Intronic
961786993 3:129353328-129353350 TGCTTACAAGAGACATACTGGGG - Intergenic
967211434 3:187173790-187173812 TGCCCTCTAAGGAGAAACTGAGG + Intronic
968264990 3:197355944-197355966 TGCCCACAAGAGTCAACATGGGG + Intergenic
971478827 4:27096310-27096332 AGCCCACCACAGACACACTGTGG - Intergenic
973035004 4:45395366-45395388 TGGACACCAGAGAGAAACTGAGG - Intergenic
975698187 4:77035360-77035382 AGCCCACTGGGAACAAACTGAGG - Exonic
981237349 4:142434729-142434751 TGCCATCTAGAGACAAGATGAGG + Intronic
987691160 5:21268678-21268700 TGCACACTAGAGAAAAAATATGG - Intergenic
988089444 5:26517270-26517292 TGACCATTAGAGAAAAATTGAGG - Intergenic
990757146 5:59086215-59086237 TGCCCACTACAGTCAAGCTCTGG + Intronic
993032010 5:82715585-82715607 TCCCCACTAGATACAGAGTGTGG - Intergenic
998543955 5:143010064-143010086 TGCCCACTAGCATCAGACTGAGG - Intronic
1004070456 6:12292505-12292527 TGCCCTCTAGAGACTTACTCGGG - Exonic
1004446215 6:15701385-15701407 TGGGCACTAGAGAGAGACTGTGG + Intergenic
1005124240 6:22428084-22428106 TGCCCAATAGAGTCAACTTGAGG + Intergenic
1005894958 6:30170194-30170216 TGCCCTCTAGAGACCAAAAGGGG + Intronic
1014529887 6:122546090-122546112 TGCCAACTAGAAATAAGCTGAGG + Intronic
1015708349 6:136112189-136112211 TGCCCTCCTGTGACAAACTGGGG - Intronic
1017727507 6:157285679-157285701 GGCCCACTTGCTACAAACTGTGG - Intergenic
1020837831 7:13176801-13176823 TGCCCTCTAGGGACTAAGTGAGG - Intergenic
1023178322 7:37455628-37455650 TCCACACTTGAGAAAAACTGAGG - Intergenic
1023237349 7:38104084-38104106 GGCACACCAGAGTCAAACTGAGG - Intergenic
1027289514 7:76689683-76689705 TAACCTCTAAAGACAAACTGGGG - Intergenic
1029353910 7:100036414-100036436 TGCCCTCTAGAAAGCAACTGAGG + Exonic
1030123727 7:106135092-106135114 TGCCCATTAGAAAGAAATTGGGG - Intergenic
1031037417 7:116802917-116802939 TTTCCATTATAGACAAACTGGGG + Intergenic
1035484466 7:159211902-159211924 TGCACAGTAGAGACACATTGTGG - Intergenic
1038355819 8:26828364-26828386 TCCTCATTAGAGACAAACTTTGG + Intronic
1044346094 8:91106067-91106089 AGCCCACAAGAGACACTCTGTGG - Intronic
1045026630 8:98093138-98093160 CCCCCATTGGAGACAAACTGTGG + Intronic
1049705218 8:144039003-144039025 TCCTCAATAGAGACTAACTGTGG + Intronic
1051080605 9:13289204-13289226 TGACCAATATAGGCAAACTGTGG - Intergenic
1051819053 9:21143286-21143308 TGCCCACCTGAGAAACACTGAGG - Intergenic
1055376385 9:75652953-75652975 GTCCACCTAGAGACAAACTGTGG - Intergenic
1056104331 9:83332050-83332072 TGCCCACCAGAGGCCAGCTGGGG - Intronic
1057637113 9:96779108-96779130 TTCCCCCCAGAGATAAACTGAGG - Intergenic
1057852727 9:98577740-98577762 TGCCCTTTAGAGACCTACTGTGG + Intronic
1060013867 9:120069234-120069256 TTCAAACTAGAGAAAAACTGAGG + Intergenic
1061816855 9:133202465-133202487 TGACCACTTGCGACCAACTGGGG - Intergenic
1061928746 9:133821299-133821321 TGCCAACAAGAGACCCACTGCGG - Intronic
1062227866 9:135463854-135463876 TGCCCACCAGAGTCAAAGTCTGG - Intergenic
1186959778 X:14723329-14723351 TGCCAACTAGAGACATAGAGGGG - Intronic
1194805751 X:98325616-98325638 GGCCCACCAGACCCAAACTGTGG - Intergenic
1195517237 X:105791082-105791104 GGCCGACTAGAGAAAAATTGGGG + Intergenic