ID: 1083955066

View in Genome Browser
Species Human (GRCh38)
Location 11:65978471-65978493
Sequence TTCCCACTGCACCCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9468
Summary {0: 1, 1: 0, 2: 9, 3: 372, 4: 9086}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083955059_1083955066 5 Left 1083955059 11:65978443-65978465 CCAGCGTCTGTGCTCTTTTCCCA 0: 1
1: 0
2: 1
3: 29
4: 253
Right 1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG 0: 1
1: 0
2: 9
3: 372
4: 9086
1083955058_1083955066 16 Left 1083955058 11:65978432-65978454 CCTGCAGGGTGCCAGCGTCTGTG 0: 1
1: 0
2: 1
3: 38
4: 227
Right 1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG 0: 1
1: 0
2: 9
3: 372
4: 9086
1083955057_1083955066 17 Left 1083955057 11:65978431-65978453 CCCTGCAGGGTGCCAGCGTCTGT 0: 1
1: 0
2: 3
3: 30
4: 229
Right 1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG 0: 1
1: 0
2: 9
3: 372
4: 9086
1083955056_1083955066 29 Left 1083955056 11:65978419-65978441 CCTCTGCTGGGGCCCTGCAGGGT 0: 1
1: 0
2: 7
3: 68
4: 584
Right 1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG 0: 1
1: 0
2: 9
3: 372
4: 9086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083955066 Original CRISPR TTCCCACTGCACCCCAGGCC TGG Intronic
Too many off-targets to display for this crispr