ID: 1083958693

View in Genome Browser
Species Human (GRCh38)
Location 11:66002087-66002109
Sequence CAGTTGGACTGGTGGGAACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083958693_1083958701 30 Left 1083958693 11:66002087-66002109 CCCAGTTCCCACCAGTCCAACTG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1083958701 11:66002140-66002162 CCCTCCGAAAACCGTACTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083958693 Original CRISPR CAGTTGGACTGGTGGGAACT GGG (reversed) Exonic
900163549 1:1235782-1235804 CAGGTGGGCAGGTGGGAACCTGG - Intergenic
900506165 1:3030684-3030706 CACTTGGACTGGTGGGATGAGGG + Intergenic
900557214 1:3286663-3286685 CAGTTGGTGTGGGAGGAACTTGG - Intronic
902032514 1:13433588-13433610 TAGTTGATCTGGTGGGGACTTGG - Intergenic
903370143 1:22830045-22830067 AAGTTTGACTGGTGGGAAGGGGG + Intronic
903814872 1:26057572-26057594 CAGAGGTCCTGGTGGGAACTAGG + Intronic
906189167 1:43884876-43884898 CAGTTGGGTTGGTAGGAACTAGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
911585696 1:99688070-99688092 CAAATGGACTGGAGAGAACTGGG - Intronic
912985248 1:114421513-114421535 CAGATGGGCTGGTGGGACCTCGG + Exonic
915083644 1:153369480-153369502 CAGTTGGATAGAGGGGAACTTGG - Intergenic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916503643 1:165408259-165408281 CAGATGGACAAGTCGGAACTGGG - Exonic
919784694 1:201251854-201251876 CATGTTGACTGGTGGGAAGTCGG + Intergenic
919907846 1:202090258-202090280 GAGTTGGGCTGGTGGGACCAAGG + Intergenic
920016873 1:202918422-202918444 TAGTTGGACAGGTGTGATCTAGG + Intronic
920565199 1:206967484-206967506 TAGTTGGAATTGTGGGACCTTGG + Intronic
920705735 1:208249189-208249211 CAGTTGTACAGTTGGGAAATAGG - Intergenic
924092178 1:240512951-240512973 CAGGTGCAGTGGTGGGTACTAGG + Intronic
1064672820 10:17733345-17733367 CATTTGGACTGTTGAGCACTTGG + Intergenic
1071281899 10:84111034-84111056 CTATTGGACTGAAGGGAACTAGG + Intergenic
1071443763 10:85727517-85727539 CAGTACCCCTGGTGGGAACTAGG + Intronic
1071893987 10:90044167-90044189 CAGTTGGATTGGTGACAACTTGG + Intergenic
1073338335 10:102727147-102727169 CAGTTCTACAGGTGGGACCTGGG + Exonic
1076335859 10:129706083-129706105 CAGTGTGACTGGTGGGGGCTGGG - Intronic
1077258000 11:1597751-1597773 CAGTTGGACTGGCAGCAACAGGG + Exonic
1077977962 11:7269210-7269232 CAGTTGGGGGGGTGGGAAATGGG + Intronic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1084186747 11:67476673-67476695 CAGCTGCTCTGGTGGGGACTTGG + Intergenic
1084490221 11:69474389-69474411 CAGTTGGACTGGATGAGACTGGG + Intergenic
1086279581 11:85170873-85170895 GAGTTGGGCTGGTGGGACCAAGG - Intronic
1086700801 11:89898575-89898597 AAGTTGGTGTGGTGGGAAGTTGG - Intergenic
1086705368 11:89945952-89945974 AAGTTGGTGTGGTGGGAAGTTGG + Intergenic
1086832809 11:91586462-91586484 CAGTAGAAGAGGTGGGAACTTGG - Intergenic
1087509300 11:99069842-99069864 CAGTAGCACTGGTGTGAACAGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1096775048 12:53958466-53958488 CAGCTGGAATGGTGGTAATTTGG - Exonic
1110982307 13:81916533-81916555 CAGTTGGACTGGTTACAGCTTGG - Intergenic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1120641078 14:87013605-87013627 GAGTTGGTCTTGTGTGAACTTGG + Intergenic
1120909850 14:89656412-89656434 CATTTGGACTGTTGAGACCTAGG - Intergenic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1122753388 14:103956752-103956774 CAGTTGTACTCTTGGGAACTGGG - Intronic
1124714001 15:32041540-32041562 CACCTGGACTGTTAGGAACTGGG - Intronic
1126189929 15:45868683-45868705 CACTTGGAATGGTGGTAAATGGG - Intergenic
1126364605 15:47881481-47881503 AACTTAGACTGGTGAGAACTAGG + Intergenic
1126736897 15:51739120-51739142 CAGTTGGGCAGGTGGGAAAAAGG - Intronic
1128188009 15:65660380-65660402 CACTTGGACTGGAGGTATCTTGG - Exonic
1128908088 15:71486315-71486337 CAGTTCCACTTGTGGGACCTTGG + Intronic
1132624139 16:882134-882156 CAGTTGCCTTGGTGGGAAGTGGG - Intronic
1140041788 16:71413032-71413054 CATTTGTAGGGGTGGGAACTTGG - Intergenic
1140486849 16:75300236-75300258 CAATTGGACTTGTGGGATGTTGG + Intronic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1145034138 17:19528420-19528442 AAGCTGGAATGGTGAGAACTCGG - Intronic
1147014981 17:37484580-37484602 GAGTTGGAGTGGTGTGATCTCGG + Intergenic
1148063849 17:44854530-44854552 CAGCAGAACTGATGGGAACTGGG - Intronic
1149881206 17:60292913-60292935 TAGTTGGAATGGTGTGAACAAGG - Intronic
1150053060 17:61984214-61984236 GAGTTGGACTGTTGGAAAATTGG - Exonic
1150775918 17:68081235-68081257 TAGTTAGTCTGGTGGGGACTTGG + Intergenic
1150775932 17:68081395-68081417 TAGTTAGTCTGGTGGGGACTTGG + Intergenic
1151884671 17:76916467-76916489 CAGGTGGAGTGGGGAGAACTTGG + Intronic
1152925255 17:83084714-83084736 CAGGTGCACTGGAAGGAACTGGG + Intronic
1153980280 18:10302884-10302906 CAGGTGGACTGGAGGGGGCTGGG - Intergenic
1156793009 18:41001348-41001370 GAGTTGGACTCATGGAAACTGGG + Intergenic
1159677535 18:71304447-71304469 CAGTTTCACTGGTGGAAACGTGG - Intergenic
1165942906 19:39424175-39424197 AAGCTGGAGTGGTGGGAACGTGG - Exonic
1168119875 19:54245930-54245952 CAGTGGGACTGCTGAGATCTAGG + Intronic
1168420596 19:56200184-56200206 CAGTTGCAGTGGTGCGATCTTGG + Intergenic
925913460 2:8587992-8588014 CAGTGGGGCAGGTGGGAACCTGG + Intergenic
930936214 2:56955240-56955262 CAGTTACACTGGTGGGAAGGTGG - Intergenic
932423584 2:71615287-71615309 CAGCAGCACTGGTGGGAGCTGGG + Intronic
932693094 2:73930148-73930170 CAGAGGGTGTGGTGGGAACTTGG + Intronic
932890527 2:75592526-75592548 TAGATGGACTGATGAGAACTAGG + Intergenic
933856798 2:86421993-86422015 CAGTTGGACTGGTAAGATCAAGG - Intergenic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
941309354 2:163910105-163910127 CAGTTAATCTGGTGGGGACTTGG + Intergenic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
942692088 2:178596390-178596412 GAGTTGGACAGGAGGGAGCTGGG + Intronic
944483697 2:200181968-200181990 CAGTGGAGCTGGTGGGAGCTGGG + Intergenic
945069727 2:205977721-205977743 TAGTTAGTCTGGTGGGGACTTGG + Intergenic
1169371323 20:5030471-5030493 CAGAGGGATTGATGGGAACTAGG + Intergenic
1169606787 20:7330931-7330953 CATTTGGACTGGGCTGAACTGGG + Intergenic
1171797888 20:29580507-29580529 CCCCTGGACTGGTGGGACCTTGG - Intergenic
1173879562 20:46401674-46401696 CAGGTGGTCTGGTGAGAACATGG - Intronic
1174091577 20:48053003-48053025 CAGTTGCTCTGGTTGAAACTGGG + Intergenic
1175048343 20:56128325-56128347 GAGTGGGACAGGTGGGGACTAGG + Intergenic
1175691296 20:61067711-61067733 CAGTAGAACTGGGGGCAACTGGG - Intergenic
1175919312 20:62442617-62442639 TAGTGGGGCTGGTGGGACCTTGG + Intergenic
1178709544 21:34902839-34902861 CACTTGGAATTGTGGGAAATCGG + Intronic
1179727945 21:43350701-43350723 CAGTTGGGATGGTGGGGCCTTGG - Intergenic
1181037713 22:20177970-20177992 CACTGGGACTGGTGGGAAACTGG + Intergenic
949315029 3:2743859-2743881 CAGTTGCAGTGGTGTGACCTTGG + Intronic
949793212 3:7816489-7816511 CAGTTGTATTGGTGAGAGCTGGG + Intergenic
953755300 3:45640930-45640952 CAGTTGGAATGTTGGAGACTGGG + Intronic
954636638 3:52074439-52074461 CAGTGGGACTGGTGGGGATGGGG + Intergenic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
960868469 3:122226795-122226817 TAGTTAGTCTGGTGGGGACTTGG - Intronic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
962134368 3:132718701-132718723 CAGATGTGCTGGTGGGAGCTGGG + Intronic
962435851 3:135366072-135366094 CTGTTGGGCTGGACGGAACTGGG - Intergenic
964393678 3:156223651-156223673 TAGCTGATCTGGTGGGAACTTGG - Intronic
966677238 3:182602686-182602708 CAGTTGGAGTGGTTGGAGATGGG - Intergenic
967128502 3:186448252-186448274 CAGTAGTACTGATGGGAAGTGGG + Intergenic
970174438 4:13324638-13324660 CAGATGAACAGGTGGGAACCTGG - Intergenic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971480235 4:27108502-27108524 CAGATGGACTTGTTAGAACTTGG + Intergenic
972938230 4:44166614-44166636 CAGTTGGTTTGAGGGGAACTGGG + Intergenic
975491747 4:74996580-74996602 CAGCTGGAATGATGGGAGCTGGG + Intronic
976935587 4:90628085-90628107 CAGATGGACTGTTGGGCATTCGG - Exonic
979412187 4:120393023-120393045 CAGTTGTAGTGGTGGAACCTAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985136574 4:186792007-186792029 CAGTTGGAGAGTGGGGAACTAGG - Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
987355947 5:17062810-17062832 CAGTTAATCTGGTGGGGACTTGG + Intergenic
988854927 5:35219126-35219148 GAGTTGGACTGGTGGGGAGATGG - Intronic
988867172 5:35348191-35348213 CTGTTGGAGTGTGGGGAACTAGG - Intergenic
990446836 5:55901214-55901236 GTGTTGGACAGGCGGGAACTAGG - Intronic
990510780 5:56487547-56487569 CAATAGGACTAGTGGGAAGTTGG + Intergenic
991326645 5:65440722-65440744 CAGTTGGTCTGGGTGGATCTAGG - Intronic
992081688 5:73239599-73239621 CATTTGGGCTGGGGAGAACTAGG + Intergenic
996865162 5:128112428-128112450 ATGTAGGACTGGTGGCAACTAGG + Intronic
998250606 5:140549678-140549700 AAGTGGGCCTGGTGGGAGCTGGG - Intronic
999242574 5:150136364-150136386 CTTTTGGGCTGGAGGGAACTGGG + Intronic
1002070214 5:176674442-176674464 CGGGTGGCCTGGTGGGAACTGGG + Intergenic
1002899642 6:1400159-1400181 CAGTTGGATTGCTGTGGACTTGG - Intergenic
1003565936 6:7222275-7222297 CAGTTGGTCTGGGGTGATCTAGG + Intronic
1004166635 6:13262502-13262524 CATCTGAACTGGTGGGATCTGGG + Intronic
1005373077 6:25155089-25155111 CAGTAGGCCTGTTGGAAACTAGG - Intergenic
1007504868 6:42327876-42327898 GAGATGGACAGGTGTGAACTCGG + Intronic
1008385037 6:50879609-50879631 AACTAGGAGTGGTGGGAACTGGG + Intergenic
1018231246 6:161677919-161677941 CAGTTGTACTGAAGTGAACTGGG + Intronic
1019102682 6:169644321-169644343 CAGTGTGACTCGTGTGAACTAGG - Intronic
1019102767 6:169645096-169645118 CAGTGGGACTCCTGCGAACTAGG - Intronic
1019102787 6:169645374-169645396 CAGTGGGACTCCTGCGAACTAGG - Intronic
1019102802 6:169645590-169645612 CAGTGGGACTCCTGCGAACTAGG - Intronic
1019452443 7:1106767-1106789 CAGTTGGTCTTTTGGGAGCTGGG - Intronic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1031869415 7:127075852-127075874 CAGTGAAACTGGTGGGAGCTTGG - Intronic
1032413667 7:131719594-131719616 CAGATGGACTCTTGGGACCTGGG + Intergenic
1032839659 7:135703981-135704003 CTTTTGTGCTGGTGGGAACTGGG - Intronic
1033638550 7:143237699-143237721 CAGTGGTAGTGGTGGGCACTGGG + Intergenic
1033758517 7:144417708-144417730 TAGTTAGTCTGGTGGGGACTTGG - Intergenic
1033813348 7:145043847-145043869 CAGATGGGATGGTGGGATCTAGG + Intergenic
1034877772 7:154740724-154740746 CAGTTGCAATGGTGGGGGCTGGG + Intronic
1035612838 8:979660-979682 GGGTTGGATTGGTGGAAACTAGG + Intergenic
1040954483 8:52965571-52965593 GAGTTGGACTTATGAGAACTGGG - Intergenic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1044735107 8:95270861-95270883 CAGTTGGTCTGATGGTAACATGG - Intergenic
1048362269 8:133708171-133708193 GAGTTTGACTGGGGGAAACTGGG - Intergenic
1050008261 9:1157767-1157789 AAGTAGGAGTGGTGAGAACTGGG + Intergenic
1051449299 9:17178151-17178173 TAGTTAATCTGGTGGGAACTGGG - Intronic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1056850884 9:90082608-90082630 TGGATGGACTGGTGGGAACCAGG + Intergenic
1185489173 X:507702-507724 CCGATGGTCTGTTGGGAACTAGG + Intergenic
1187274245 X:17804569-17804591 CAGTAGGACTGGTGAGGACAAGG + Intronic
1187438251 X:19292401-19292423 CAGTTGGACAGGCTGGAAATAGG - Intergenic
1192019079 X:67365065-67365087 CAGATGACATGGTGGGAACTGGG - Intergenic
1193134026 X:77949611-77949633 CAATTCTACTGGTGGGAACAAGG + Intronic
1196700420 X:118661868-118661890 CAGCTGGACTCCTGGGAAGTAGG - Intronic
1201469198 Y:14315071-14315093 TAGTTAGTCTGGTGGGGACTTGG + Intergenic