ID: 1083966418

View in Genome Browser
Species Human (GRCh38)
Location 11:66046589-66046611
Sequence CAGGAGTAAGAGAGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2515
Summary {0: 1, 1: 3, 2: 34, 3: 402, 4: 2075}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083966403_1083966418 26 Left 1083966403 11:66046540-66046562 CCCTACGGAGGATCTCCAGGAGA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG 0: 1
1: 3
2: 34
3: 402
4: 2075
1083966404_1083966418 25 Left 1083966404 11:66046541-66046563 CCTACGGAGGATCTCCAGGAGAA 0: 1
1: 0
2: 1
3: 3
4: 100
Right 1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG 0: 1
1: 3
2: 34
3: 402
4: 2075
1083966406_1083966418 11 Left 1083966406 11:66046555-66046577 CCAGGAGAAGGTGAGCTTCCATC 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG 0: 1
1: 3
2: 34
3: 402
4: 2075
1083966409_1083966418 -7 Left 1083966409 11:66046573-66046595 CCATCCCAGGTAAGCCCAGGAGT 0: 1
1: 0
2: 0
3: 16
4: 201
Right 1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG 0: 1
1: 3
2: 34
3: 402
4: 2075

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083966418 Original CRISPR CAGGAGTAAGAGAGGGGAGG AGG Intronic
Too many off-targets to display for this crispr