ID: 1083968004

View in Genome Browser
Species Human (GRCh38)
Location 11:66054701-66054723
Sequence TTCCATGTTCCTTCTGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083968001_1083968004 16 Left 1083968001 11:66054662-66054684 CCAGATACAGTGGTTCCTGTTTA 0: 1
1: 1
2: 3
3: 18
4: 284
Right 1083968004 11:66054701-66054723 TTCCATGTTCCTTCTGATCCAGG 0: 1
1: 0
2: 1
3: 23
4: 232
1083968002_1083968004 1 Left 1083968002 11:66054677-66054699 CCTGTTTATGTAAGTCCTCTCAA 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1083968004 11:66054701-66054723 TTCCATGTTCCTTCTGATCCAGG 0: 1
1: 0
2: 1
3: 23
4: 232
1083968000_1083968004 17 Left 1083968000 11:66054661-66054683 CCCAGATACAGTGGTTCCTGTTT 0: 1
1: 1
2: 0
3: 14
4: 180
Right 1083968004 11:66054701-66054723 TTCCATGTTCCTTCTGATCCAGG 0: 1
1: 0
2: 1
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083968004 Original CRISPR TTCCATGTTCCTTCTGATCC AGG Intronic
900170223 1:1264167-1264189 GTTCCTGTTCCTTCTGCTCCAGG - Intronic
906166380 1:43689529-43689551 TCCCAAGTTCCTTCTGCTACTGG - Intronic
906357242 1:45117159-45117181 TACCTTGCTCCTTCTGATTCGGG - Intronic
911204672 1:95080314-95080336 TTCTTTGTTCCTTCAGATCTAGG + Intergenic
911648533 1:100360936-100360958 TTCCAAGTTCTTTCTGTGCCAGG + Intronic
913111776 1:115663734-115663756 CTCCATGTCCTTGCTGATCCTGG - Exonic
916951171 1:169781799-169781821 TTCCAAGTTTTTACTGATCCAGG + Intronic
918132102 1:181638553-181638575 TCCCCTGTGCCTTCTGAGCCTGG + Intronic
920379565 1:205527796-205527818 TTTCATGTTCCAGCTGCTCCGGG + Exonic
921310712 1:213840531-213840553 TTCCAAGTTTCCTCTGATACTGG - Intergenic
921540856 1:216413379-216413401 TTCCATGTTCCTATTGATTGAGG - Intronic
921749687 1:218777888-218777910 TGCCGTGTCCCTTCTGAGCCTGG - Intergenic
922392887 1:225165181-225165203 TTCCATTTTCCTGTTGCTCCAGG + Intronic
924629030 1:245719918-245719940 TTTGTTGTTCCTTCTGTTCCTGG + Intergenic
1063193771 10:3720949-3720971 TTCCATGTTCCCCCTGAAACTGG + Intergenic
1064282096 10:13960053-13960075 TTCTCTCTTCCCTCTGATCCCGG - Intronic
1064839210 10:19572010-19572032 TTCTATATTCCTTCTGATTATGG - Intronic
1065329380 10:24578655-24578677 TTCCCTGTTTCTTCTTATCTAGG - Intergenic
1068844641 10:61658454-61658476 TTTTTTGTTCTTTCTGATCCTGG - Intergenic
1069980388 10:72248510-72248532 CTCCAAGTTCCCTCTGATTCAGG + Intergenic
1070568516 10:77622186-77622208 TTTAAGGTTCCTTCTCATCCTGG + Intronic
1073033726 10:100548501-100548523 TTCCCTGTTCCTTCTGGGTCAGG + Exonic
1073072461 10:100803336-100803358 CTCCTTGGACCTTCTGATCCAGG + Intronic
1073541650 10:104320123-104320145 TTCCAGGTCTCTCCTGATCCAGG + Intronic
1073671194 10:105592019-105592041 TTTCTTGTTCCATCTTATCCAGG + Intergenic
1077579914 11:3410421-3410443 TTCCACTTCCCATCTGATCCCGG + Intergenic
1080197730 11:29631764-29631786 ATCCAGCTTCCTTCTGTTCCAGG - Intergenic
1081217751 11:40422397-40422419 TTACATTTTTTTTCTGATCCTGG + Intronic
1083968004 11:66054701-66054723 TTCCATGTTCCTTCTGATCCAGG + Intronic
1086146861 11:83561422-83561444 TCCCATGGACCTTCAGATCCTGG + Intronic
1086391359 11:86367554-86367576 TTCATTTCTCCTTCTGATCCTGG + Intergenic
1087449251 11:98296984-98297006 TTCCATTTTCTTTCTGTTCTTGG + Intergenic
1087663304 11:101012905-101012927 TTTCATGTTCATTATGATACTGG + Intergenic
1089915275 11:122148854-122148876 TTCCATGTACGTTCTTATTCTGG + Intergenic
1090668010 11:128927727-128927749 TTCCATGGTCCCTGTGATTCTGG + Intergenic
1091263534 11:134253119-134253141 GTCCTTGGTCCTTCTCATCCAGG + Exonic
1092881895 12:12893133-12893155 TTCCATGTTCCTGCGGAGCTGGG - Intronic
1093472238 12:19514594-19514616 TTCCATGTGCCTTCACATTCTGG - Intronic
1094414008 12:30199442-30199464 CTCTATGTTCCATCTGGTCCAGG - Intergenic
1094601927 12:31916427-31916449 TTCCCTGTTTCTTCTTTTCCAGG + Intergenic
1095048269 12:37533937-37533959 TTTCATGTTCCTCATGAACCTGG + Intergenic
1096966113 12:55629374-55629396 TTCCTTGTTCATTATGCTCCAGG - Intergenic
1097365845 12:58711588-58711610 TCCCTTGTTCACTCTGATCCAGG + Intronic
1098091510 12:66907024-66907046 TACTATGGTCCTTCTGTTCCAGG + Intergenic
1100560738 12:95746972-95746994 TTACATGTCACTTCTCATCCAGG - Intronic
1101683957 12:106998548-106998570 TTCTATTTTCTTTCTGATCAAGG - Intronic
1103649895 12:122423660-122423682 TTCCCTCTTCCTGCTGGTCCAGG - Intergenic
1105660784 13:22492167-22492189 TTCCATGTTGCTTCTGGACTTGG - Intergenic
1106196464 13:27498172-27498194 TTCCAAGTTCATTCTCTTCCTGG - Intergenic
1106307968 13:28530482-28530504 TTCCATTTTCTTTCTCATCGAGG + Intergenic
1108641428 13:52385966-52385988 TTCAATATTCCTTCTGATGAAGG + Intronic
1112640144 13:101264498-101264520 TTCCAGGTTGCTGCTGGTCCAGG - Intronic
1113508007 13:110830535-110830557 TTCCCTGTCCCTTCAGCTCCCGG - Intergenic
1114852239 14:26395088-26395110 TTCCTTCTTCCTTGTGGTCCAGG - Intergenic
1118719441 14:68583810-68583832 TGCCTTGTGCATTCTGATCCTGG - Intronic
1118867906 14:69717856-69717878 TTCCTAGTTCCTTCAGATCAGGG + Intergenic
1119521553 14:75289724-75289746 TTCCATGTAACTCCTGAACCTGG - Intergenic
1120134349 14:80848282-80848304 TACCATGTACCTCCTGCTCCTGG - Intronic
1122251351 14:100442055-100442077 CTCCATGTTCCTGCTCCTCCTGG - Intronic
1123122501 14:105924048-105924070 TCCCATGTTCCTCCAAATCCTGG + Intronic
1123405150 15:20015471-20015493 TTCCATGTTTCTCCAAATCCTGG + Intergenic
1123514479 15:21022119-21022141 TTCCATGTTTCTCCAAATCCTGG + Intergenic
1123539757 15:21276506-21276528 TTCTATGTTCCTTTTGACCAGGG + Intergenic
1124000394 15:25754566-25754588 TTCCATTTTCTGTCTGACCCAGG - Intronic
1124066772 15:26352248-26352270 TTCCCTGTTTCCTCTCATCCAGG + Intergenic
1126386057 15:48094569-48094591 TTCCCTCTTCTTACTGATCCTGG + Intergenic
1126871788 15:52997021-52997043 TTCCTTGATCCTTCAGATCTTGG + Intergenic
1126899011 15:53292203-53292225 CTCCATGTTGCTTCGGAACCGGG - Intergenic
1127093631 15:55491359-55491381 TTCCATGTTCCTTGTGAAGTTGG - Intronic
1127657360 15:61068522-61068544 TTCCATGTTCCTTGACATCCTGG + Intronic
1127998820 15:64171985-64172007 TGCAATGTTCCTTGTGCTCCAGG - Exonic
1128678358 15:69628242-69628264 TTCCCTGTTCCTTGAGATCCAGG + Intergenic
1129552769 15:76471726-76471748 TTCCATGATCTTTCTTATCCCGG - Intronic
1130402712 15:83572409-83572431 TTTCTTTTTCATTCTGATCCAGG + Intronic
1202948066 15_KI270727v1_random:3672-3694 TTCTATGTTCCTTTTGACCAGGG + Intergenic
1133038748 16:3048659-3048681 TTCAATGCTCCTTTTGCTCCAGG - Intronic
1133348426 16:5085704-5085726 TTCCACTTCCCATCTGATCCCGG + Exonic
1134072396 16:11268933-11268955 TTCCAAGTTCTTTCTGTTCTTGG + Exonic
1135481788 16:22826755-22826777 TTCCATATTCTTTCAGAACCAGG - Intronic
1135878720 16:26231018-26231040 TTCCATGTTCCTTTTGTTGATGG - Intergenic
1140506632 16:75477729-75477751 TCCCTTGGTCCTTCTGGTCCAGG - Exonic
1141742714 16:85904686-85904708 TTCCAGATTCTTTCTGATCAAGG + Intronic
1144581416 17:16461498-16461520 TGCCATGTTCCTGCAGCTCCAGG - Intronic
1145119289 17:20242173-20242195 GTCATTGTTCATTCTGATCCAGG - Intronic
1145411538 17:22670117-22670139 TTCCATGTTCCTCATGAACCTGG + Intergenic
1146414489 17:32619465-32619487 TCCCATTTTCCTTCTGATTATGG + Intronic
1146482677 17:33217668-33217690 ATCCAGGTTCCCTCTCATCCTGG + Intronic
1146718596 17:35106984-35107006 TTACCTGTTCCTCCTCATCCTGG + Exonic
1148818479 17:50346803-50346825 CTCCCTGTTCCTTCAGTTCCCGG - Intronic
1149028557 17:52058179-52058201 TTCTGAGTTCCATCTGATCCAGG - Intronic
1149481405 17:57006167-57006189 TTCTAGGTTCCTTCTGACCAAGG + Exonic
1150680211 17:67278460-67278482 TTCCTTGCTACTTATGATCCAGG - Intergenic
1151245437 17:72790887-72790909 TTCCTTCTTCCTTCTGCTCAGGG - Intronic
1156601735 18:38615224-38615246 TTCCATGTAGCCTCTGATCCTGG - Intergenic
1156974090 18:43195748-43195770 TTCTATGTCCCTTCTGTTCTAGG - Intergenic
1158638364 18:59180846-59180868 TTCCATTTTTCTTCTGGTACAGG - Intergenic
1158918491 18:62162263-62162285 TCCCATGTTCCGTTTGATCTTGG - Exonic
1159340223 18:67124987-67125009 TTTCTTGTTCCTTCAGTTCCAGG + Intergenic
1159884299 18:73889543-73889565 TTCCATGTTCTTCCTGACCCAGG + Intergenic
1160922242 19:1526445-1526467 TTACATTTGCCTTCTAATCCGGG + Intronic
1162162238 19:8726953-8726975 TTCCATTTTCCTTTTGAAACAGG + Intergenic
1162679296 19:12327729-12327751 TTTCATGTTCCTTTTGATTAGGG - Intronic
1162688469 19:12408578-12408600 TTCCATATTCCTTTTGATTAGGG - Intronic
1164858989 19:31547619-31547641 TTCCTTCTTCCTTCTCAGCCTGG + Intergenic
1167947897 19:53003860-53003882 TTCCATTTTCCTGCTGACCATGG + Intergenic
1168495460 19:56844416-56844438 TACTATCTTCCTTCTGTTCCAGG + Intergenic
1168658603 19:58148429-58148451 TTCCCTGTTTCTTCTTTTCCAGG + Intronic
925720331 2:6820979-6821001 GTCCATGGTCCCTCTGTTCCTGG - Intergenic
925951586 2:8918271-8918293 TTGCAGATTCCTTCTTATCCTGG + Intronic
927831916 2:26358669-26358691 CTCCAGATTTCTTCTGATCCTGG - Intronic
930692263 2:54376670-54376692 CTCCATGTTACTCCTCATCCTGG - Intronic
931529092 2:63192119-63192141 TAACATGTTCCTTTAGATCCAGG + Intronic
934776280 2:96939609-96939631 TTCCATCTTCCTTCTGCCACAGG - Intronic
934964159 2:98705371-98705393 TTCCTTGTTCCACCTGATCATGG + Intronic
935039507 2:99412294-99412316 TTCCATTTTCCTTCAGATTATGG - Intronic
936341909 2:111641141-111641163 CTCCATTTCCCTGCTGATCCAGG + Intergenic
937142847 2:119617004-119617026 TTCCTTGCACTTTCTGATCCTGG + Intronic
939372884 2:141325588-141325610 TTCCATTTTCCTTCTAATCTAGG + Intronic
940904311 2:159155237-159155259 TTCTTTGTTTCTTCTCATCCAGG - Intronic
941032041 2:160523571-160523593 TTCCATGTACGTTCTGAGCTGGG + Intergenic
941049414 2:160715596-160715618 TCCCCTGTTCCTTCAGTTCCTGG + Intergenic
941137688 2:161738013-161738035 TTTCAGGTTTATTCTGATCCTGG + Intronic
941893749 2:170609100-170609122 TTTCATGTTTCTTCTGATGTAGG + Intronic
942161899 2:173198004-173198026 TTCCATTTTCTTTTTGTTCCAGG + Exonic
942221830 2:173776276-173776298 TTCCATTTTCCTTTTTATACAGG + Intergenic
942345755 2:175001104-175001126 GTCCATGTTCCTTCTTGTACTGG - Intronic
943341822 2:186691484-186691506 TTCCAAGTTACCTCTGCTCCTGG - Intergenic
945710723 2:213291069-213291091 TTCCATGTCCCTTTTTACCCTGG + Intronic
947235943 2:227941062-227941084 TTCCTGGTTCCTTCTCATGCGGG + Intergenic
947924557 2:233909832-233909854 CTCCATCTTCCTTCTGATCTAGG - Intergenic
948604904 2:239128923-239128945 TCCCAGGCTCCTTCTGGTCCAGG + Intronic
1170470259 20:16661610-16661632 TTCCACCTTCCTTCTGATCTAGG + Intergenic
1171156248 20:22877454-22877476 CTTCATGTTGCTTCTGATCAGGG - Intergenic
1171453293 20:25251287-25251309 TTCCACGCTCCTTTTCATCCTGG + Intronic
1171489173 20:25504490-25504512 GGCCATGTTCCTTCTCCTCCTGG - Intronic
1171542809 20:25977414-25977436 TTCCATGTTCCTCATGAACCTGG + Intergenic
1171798246 20:29583111-29583133 TTCCATGTTCCTCATGAATCTGG - Intergenic
1171845842 20:30274063-30274085 TTCCATGTTCCTCATGAACCTGG + Intergenic
1174479164 20:50818820-50818842 TTCCATCTTCCTCCTCAGCCAGG - Intronic
1174540334 20:51284403-51284425 TTCCATGCTTCTTCTGCTCTGGG + Intergenic
1174781153 20:53390028-53390050 ATCCCTGTTCCTTTTGAGCCAGG + Intronic
1174941952 20:54939031-54939053 TTCCAGCTTCCTTCTGATAATGG - Intergenic
1175252004 20:57615481-57615503 TTGCATGTCCCTTCAGTTCCCGG - Intronic
1175432221 20:58913411-58913433 TTCCCTTTTCCCTCTGACCCTGG + Intergenic
1175450584 20:59062707-59062729 TTCAATATTCCCTCTGATTCTGG - Intergenic
1175532806 20:59685572-59685594 TGCCATTTTCCTGTTGATCCTGG + Intronic
1176993276 21:15523545-15523567 TTCTATCTTCCTACTGATACAGG + Intergenic
1178625602 21:34215519-34215541 TTCCTTGTGACTTCTCATCCTGG + Intergenic
1179049388 21:37875678-37875700 TTCCTTCTACCTTCTGAGCCTGG - Intronic
1179465442 21:41568613-41568635 TTTTATGTTCCTCCTGTTCCAGG - Intergenic
1184554924 22:45227935-45227957 TTCCAGGTTTCTCCTGATCCAGG - Intronic
949513830 3:4789381-4789403 TTCCATGTTCATGAGGATCCTGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
951801533 3:26602086-26602108 TTTCATGTTCATTTTGATCCAGG - Intergenic
953467244 3:43133252-43133274 ATCCATTTGTCTTCTGATCCTGG - Intergenic
954202558 3:49032773-49032795 TTGCATTTTACTTGTGATCCAGG - Exonic
954593686 3:51805821-51805843 TTCCAGGGTCCCTCTCATCCTGG - Intergenic
954803588 3:53201921-53201943 TTACATGTTCCTCCTGATACAGG - Intergenic
955824518 3:62931332-62931354 TTCCAAGTTCCTTCTGCTTTAGG + Intergenic
956177384 3:66485669-66485691 TTCCATGTTCCTTTGGTTTCTGG - Intronic
956884955 3:73549946-73549968 ATCCATGTCCTTTCAGATCCTGG + Intronic
957247490 3:77733322-77733344 TTCCATGTCCCTGATCATCCAGG + Intergenic
960705286 3:120475447-120475469 TTGCATCTTCTTTCTGATCCCGG - Intergenic
961302069 3:125928501-125928523 TTCCACTTCCCATCTGATCCTGG - Intergenic
961586176 3:127927719-127927741 TTTCATGTTACCTCTAATCCTGG + Intronic
962190385 3:133304299-133304321 TTGCATGTTCCTTCTAAACTTGG + Intronic
963422530 3:145078322-145078344 TTCCTTGTTCCTTCAGCTTCTGG + Intergenic
964031536 3:152144724-152144746 TTCCAATCACCTTCTGATCCTGG + Intergenic
964299454 3:155271646-155271668 TTCCTTGTTCCTTCTCATTTGGG - Intergenic
966229364 3:177634403-177634425 TTCCATGTTCCTTCTTCACCTGG - Intergenic
968995574 4:3943344-3943366 TTCCACTTCCCATCTGATCCTGG + Intergenic
969044405 4:4326337-4326359 TTCCAGGCTGCATCTGATCCTGG - Intergenic
969453199 4:7286554-7286576 GACCATGTCCCTTCTGGTCCTGG - Intronic
970078393 4:12251573-12251595 TTCCATGATCCTCTTAATCCAGG + Intergenic
971218346 4:24682484-24682506 TTGCAAATTCCTTCTGATCCTGG + Intergenic
972600801 4:40570614-40570636 GTCCATTTTCCTTCTGCTTCAGG - Intronic
972874440 4:43341073-43341095 TGCCATGTGACTTCTGATGCTGG - Intergenic
974041304 4:56860202-56860224 TTCATTGTCCCTTCTGATCTTGG - Intergenic
974274177 4:59694627-59694649 TTACATGTCACTTCTGATACAGG + Intergenic
976743664 4:88382414-88382436 TTCCAATTTCCTTCTGAGCAAGG + Intronic
977187729 4:93961186-93961208 TTAGGTGGTCCTTCTGATCCAGG - Intergenic
978605157 4:110471862-110471884 GGCCATGTTCTTTCTGATGCTGG - Intronic
979628720 4:122876388-122876410 TTCCATCTTCCTTCATAGCCAGG - Exonic
980786624 4:137564289-137564311 TTTCACCTTCCTTCTGATCCTGG + Intergenic
981189660 4:141847312-141847334 TTCCATGTTTTTCCTGATCCAGG + Intergenic
982349616 4:154400381-154400403 TTCCAGGGTCCTTCTCATCCAGG + Intronic
984394618 4:179179831-179179853 TCCAATGTTCCTTCTGTTACTGG + Intergenic
985826259 5:2193785-2193807 TTCCATTTTCCTGCTGAGCGGGG + Intergenic
987535389 5:19180716-19180738 TTCCACTTTCCTTCTCATTCTGG + Intergenic
988615101 5:32767899-32767921 TTACATGCTCCTTCTGATTTTGG + Intronic
990639894 5:57770971-57770993 ATCCAGGTTCCTTCTGAACAAGG - Intergenic
990691967 5:58374197-58374219 ATCCATCTTCCATCTGGTCCTGG + Intergenic
992178434 5:74173472-74173494 TGCCATTTTCCTGCTGAGCCTGG - Intergenic
993871079 5:93254888-93254910 TTCACTGTTGCTTCTGAACCTGG - Intergenic
994682981 5:102912461-102912483 TTCCATTTTCTTTCTGCCCCAGG + Intronic
998540570 5:142977679-142977701 TTCCATCTTCTTTCTTAACCAGG - Intronic
1003117512 6:3293062-3293084 TTCCCTGCTCCTCCTGAGCCTGG - Intronic
1004451710 6:15753825-15753847 TTCCATCTTCCTTCAGTGCCAGG + Intergenic
1005236986 6:23775629-23775651 TTCCATTTTCACTCTGCTCCAGG - Intergenic
1005266807 6:24120726-24120748 TTCTATGCTCCTGCTGAACCAGG + Intergenic
1006938482 6:37735359-37735381 TTCCAAGCTCCATCAGATCCCGG + Intergenic
1007833083 6:44653759-44653781 ATCCCTGTTCCTTCTGCTACCGG + Intergenic
1009195281 6:60677314-60677336 TGCCTTATTACTTCTGATCCAGG + Intergenic
1009885318 6:69617783-69617805 CTACATGTAGCTTCTGATCCTGG + Intergenic
1011069462 6:83364590-83364612 TTCCATGTGCTCACTGATCCAGG + Intronic
1011589739 6:88960799-88960821 TACCATTTTCTTTCTGATTCAGG + Intronic
1013944297 6:115704007-115704029 TTCCATGCTCCAGCAGATCCAGG - Intergenic
1014113266 6:117645034-117645056 ATCCATGTTGATTCTGATGCTGG - Intergenic
1015282732 6:131451239-131451261 TTCCTTGTTCCATAAGATCCTGG - Intergenic
1016994883 6:149954627-149954649 TTCCTTGATCCTTCTGACACGGG + Intergenic
1017003725 6:150014809-150014831 TTCCTTGATCCTTCTGACACGGG - Intergenic
1017383729 6:153859222-153859244 TTCCAGATTCCTGCTGACCCTGG - Intergenic
1017947342 6:159106386-159106408 TTCCTTGTTCTTTCCTATCCTGG - Intergenic
1018335362 6:162781385-162781407 TTCCATTTTCCTTCTGCTGGAGG - Intronic
1018444114 6:163839600-163839622 TTCCATTTGCCTTCTGGTCAAGG - Intergenic
1020319855 7:6931754-6931776 TTCCACTTCCCATCTGATCCTGG + Intergenic
1021258725 7:18427558-18427580 TACCATAATCCTGCTGATCCTGG + Intronic
1021577492 7:22117532-22117554 CTCCATGTTTCCTGTGATCCAGG + Intergenic
1022072006 7:26925367-26925389 TTCCTTTTTCCTACTGACCCAGG + Intronic
1024764798 7:52645023-52645045 TTCCCTGTTCATTCTGATGGTGG + Intergenic
1025294186 7:57762522-57762544 TTCCATGTTCCTCATGAACCTGG + Intergenic
1026311466 7:69189039-69189061 TCCCATGTTACTTCTTCTCCAGG + Intergenic
1026570775 7:71528508-71528530 CTCCATGTGTCTTCTCATCCTGG + Intronic
1027440270 7:78211916-78211938 TTTCCAGTTCCTCCTGATCCTGG + Intronic
1027640244 7:80724104-80724126 TGCCATGTTCCTTCTCATTCTGG - Intergenic
1029711643 7:102303266-102303288 TTCCATGTTCCTTTCGTTCTTGG - Intronic
1033038637 7:137898612-137898634 TTTTATGTTCCTTCTGATGGAGG + Intronic
1035097342 7:156366131-156366153 TTCCATTTTCTGGCTGATCCTGG + Intergenic
1037275415 8:17173068-17173090 CTCCCTGTTACTTCTGATCTGGG - Intronic
1038158087 8:25009712-25009734 TTCCAGATTTCTTCTGTTCCTGG + Intergenic
1038956789 8:32476583-32476605 TTCCATGTTCAATTTGATTCCGG + Intronic
1039368608 8:36960542-36960564 TTCCCTGTTCCCTCAGCTCCTGG + Intergenic
1039550178 8:38437678-38437700 TCCCATGAACCTTCTGTTCCTGG - Intronic
1039732312 8:40293260-40293282 TTCCTTATTCCTCCTGATACTGG - Intergenic
1043203846 8:77410250-77410272 TCCCATGTTTGTTCTGCTCCTGG + Intergenic
1043237385 8:77885049-77885071 TTCCTTGTTGCCTCTGATCAAGG - Intergenic
1044249565 8:89989925-89989947 TTCCATCCTCCTTCATATCCGGG + Intronic
1044876565 8:96673499-96673521 TTCCATTTTTCATCTGATACCGG + Intronic
1049481394 8:142825421-142825443 TGCCATTTTCCTTCTGGTCCTGG + Intergenic
1050001574 9:1083138-1083160 TTTTATGTTCTTTCTGGTCCAGG - Intergenic
1052349728 9:27446347-27446369 TTCCATCTTCTTTCTGCTGCAGG - Intronic
1054162232 9:61681781-61681803 TTCCATGTTCCTTGTGAACCTGG - Intergenic
1057603693 9:96482378-96482400 TTCAATGTTCCTTTTGCACCTGG + Intronic
1057607016 9:96506057-96506079 TTTCATGTTCCTTGGCATCCAGG - Intronic
1058195615 9:101971249-101971271 CTTCAAGTTCTTTCTGATCCAGG + Intergenic
1059292073 9:113234721-113234743 TTCCCTGATGATTCTGATCCAGG + Intronic
1060647416 9:125292785-125292807 TTCCATTTGGCTTCTGATACTGG + Intronic
1060771642 9:126336235-126336257 TTCCATGGCCCTCCTGAGCCTGG - Intronic
1062419053 9:136470374-136470396 TTCCGTTTTCCTTCTGCTGCTGG - Intronic
1186173825 X:6904554-6904576 TTCCCTCATCCTTCTGAGCCTGG - Intergenic
1186317017 X:8382057-8382079 TTCTGTGTGCCTTCTGTTCCTGG + Intergenic
1188929380 X:36087624-36087646 TTCCATGCTCCCAGTGATCCTGG - Intronic
1192089178 X:68134612-68134634 AACCATGATCCTTCTGCTCCAGG - Intronic
1193326230 X:80181219-80181241 TTCCTTGTATGTTCTGATCCAGG - Intergenic
1200926695 Y:8661106-8661128 TTTCATGTTCCTCATCATCCTGG + Intergenic
1202181519 Y:22143813-22143835 TTCCATATTCCTTGTCAGCCTGG - Intergenic
1202209841 Y:22442587-22442609 TTCCATATTCCTTGTCAGCCTGG + Intergenic