ID: 1083969031

View in Genome Browser
Species Human (GRCh38)
Location 11:66061280-66061302
Sequence GTTTAGGGATGGAGGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083969021_1083969031 12 Left 1083969021 11:66061245-66061267 CCTGTCTTAGAAATGATAATAGT 0: 1
1: 0
2: 2
3: 38
4: 589
Right 1083969031 11:66061280-66061302 GTTTAGGGATGGAGGGGCCAAGG 0: 1
1: 0
2: 3
3: 28
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083969031 Original CRISPR GTTTAGGGATGGAGGGGCCA AGG Intronic
900139408 1:1133289-1133311 GTTTTGGGGTGGCGGGGCCTGGG + Intergenic
900651607 1:3732633-3732655 GGTTGGGGGTGTAGGGGCCAGGG + Intronic
900812954 1:4821815-4821837 GGTTGGGGTTGTAGGGGCCAGGG - Intergenic
901832113 1:11898909-11898931 GGTCCAGGATGGAGGGGCCACGG + Intergenic
902560490 1:17274319-17274341 GTAAGGGGATGGAGTGGCCATGG + Intronic
903268666 1:22174158-22174180 GTCCAGGGCTGGAGGGGGCAAGG - Intergenic
903363477 1:22792065-22792087 GCCAAGGGAGGGAGGGGCCAGGG + Intronic
904301344 1:29556725-29556747 GAGTAGGGGTGGAGGTGCCAGGG + Intergenic
904602276 1:31680181-31680203 CTCTAGAGATGGAGAGGCCAGGG + Intronic
905242125 1:36588186-36588208 GCTGAGGGAGGGAGGAGCCAGGG + Intergenic
905714967 1:40141338-40141360 GTTTAGGGCTGGTGGAGCCTGGG - Intergenic
906308257 1:44735070-44735092 GTATATGGAGGGAGGGGCGATGG + Intergenic
906647939 1:47489648-47489670 GTTTAGAGATGGATGGGGGATGG + Intergenic
908792171 1:67793770-67793792 GTTTGAGGAAGGAGGGGACAGGG - Intronic
909874893 1:80789499-80789521 GTTGGGGGATGGGGGGGCTAAGG + Intergenic
912447977 1:109751901-109751923 GTCCAGGGATGGAGCTGCCAAGG - Intronic
912789509 1:112638283-112638305 AATTAGGGAAGGAGGAGCCATGG + Intronic
912812150 1:112802604-112802626 GGGTAGGGATGGAGGTGTCAGGG + Intergenic
912967291 1:114247786-114247808 GTTAGGGGATGGGGGGGCTAGGG + Intergenic
913069474 1:115286007-115286029 GTTGAGGTAGGGAGGGGCCCAGG + Exonic
914680271 1:149934049-149934071 GTTTAGGGATCTAGGAGGCAAGG + Intronic
915143265 1:153779688-153779710 GTTTAGGGGAGGAGGTGACAGGG - Intronic
916437552 1:164791014-164791036 TTTTGGGGATGGAGGTGGCAGGG - Intronic
916877538 1:168985911-168985933 CTCAAGAGATGGAGGGGCCAAGG - Intergenic
919404816 1:197166036-197166058 GTTGGGGGATGGGGGGGCCTGGG + Intronic
921327778 1:214004528-214004550 GTTTTGGCATGGAGAGGACAGGG - Intronic
921488603 1:215746316-215746338 GTTCAGGGTTGGGGTGGCCAGGG - Intronic
923649387 1:235859331-235859353 TTTTAAGGATGGAGAAGCCAAGG - Intronic
924825009 1:247530473-247530495 GTTCAGGGAAGGAGGGGAAAAGG - Exonic
1063654349 10:7972797-7972819 GTTGAGTGAAGGTGGGGCCAAGG + Intronic
1065164438 10:22960471-22960493 TTTTAGGGAGGGAGGGGTGAGGG - Intronic
1065261508 10:23928220-23928242 GTTTAGGCTTGGTAGGGCCACGG + Intronic
1067099244 10:43322794-43322816 GGTGAGGGGCGGAGGGGCCACGG - Intergenic
1067569364 10:47360274-47360296 ATCCAGGGAAGGAGGGGCCAGGG + Intergenic
1067917529 10:50417171-50417193 GTTTGGGGAAGTAGGGGACAGGG - Intronic
1068587138 10:58812244-58812266 GTTGAGGGAAGGAGGAACCAAGG + Intronic
1070258266 10:74828315-74828337 GTTTGGGGTTGGAGGTACCAAGG + Intronic
1071416341 10:85445173-85445195 GATTAGGGATGGAGGTGTCTGGG + Intergenic
1073103518 10:101019291-101019313 GCTTAGGGGTGGAGGAGGCAAGG + Intronic
1073154070 10:101332700-101332722 GTTGAGGGCAGGAGGGGCAAGGG - Intergenic
1073486506 10:103822453-103822475 ATTTAGGGAATGGGGGGCCATGG - Intronic
1075704020 10:124488172-124488194 GTATTGGGATGGAGGGTCCTGGG + Intronic
1075912688 10:126139572-126139594 GGCTAGGTATGCAGGGGCCATGG + Intronic
1077205080 11:1338182-1338204 GTGAAGGGGTGGAGGGGCCCAGG - Intergenic
1080801114 11:35611197-35611219 GGTTATTGATGAAGGGGCCATGG + Intergenic
1081541348 11:44036810-44036832 GTTCTGGCATGGACGGGCCAGGG + Intergenic
1081807722 11:45899563-45899585 ATCTAGGGCTGGAGGGGCCCCGG + Intronic
1081866157 11:46361797-46361819 GCCTAGGGATGGTGGGGCCCGGG - Intronic
1083203815 11:61135395-61135417 GTTCAGGGATGTAGGGCCCAGGG + Intronic
1083309276 11:61776188-61776210 GCTTGGGAATGGAGGGGCCAGGG + Intronic
1083548524 11:63566955-63566977 ATTTAGGGATGGAAGGGCTAGGG + Intergenic
1083969031 11:66061280-66061302 GTTTAGGGATGGAGGGGCCAAGG + Intronic
1085887399 11:80536555-80536577 GTTTGGTGATTGAAGGGCCATGG - Intergenic
1086421734 11:86644215-86644237 GTGCTGGGATGGAGGGGTCACGG - Intronic
1086759048 11:90603835-90603857 ATTGAGATATGGAGGGGCCAGGG + Intergenic
1087052743 11:93903039-93903061 GCATAGGCATGGAGAGGCCAGGG + Intergenic
1087943645 11:104131488-104131510 TTTTAGTGATGGAGGAGCTATGG - Intronic
1088789487 11:113211762-113211784 GTTCAGGGATGCAGGGGCCTCGG + Intronic
1089078964 11:115760483-115760505 GTGGAGGGCTGGAGGGGCCGCGG + Intergenic
1089628610 11:119769629-119769651 GTTCAGAGAGGGAGGGGACATGG + Intergenic
1089739259 11:120571140-120571162 GTCTAGGGAGGAGGGGGCCAAGG - Intronic
1091062494 11:132476686-132476708 GTTTTGGGGTGGAGGGAGCAGGG + Intronic
1092526874 12:9314848-9314870 GTTTAGGAATGGGGGCCCCAGGG + Intergenic
1092540400 12:9416931-9416953 GTTTAGGAATGGGGGCCCCAGGG - Intergenic
1092945975 12:13454359-13454381 TCTTAGGGAAGGAGGGGCTAAGG - Intergenic
1093920241 12:24851382-24851404 GGTGAGGGATGGTGGGGCAATGG - Intronic
1094512648 12:31105548-31105570 GTTTAGGAATGGGGGCCCCAGGG + Intergenic
1096513232 12:52143421-52143443 GCTCAGTGATGGAGGGGCCAGGG - Intergenic
1096573593 12:52539169-52539191 CTTTAGGGATGGCTGGGACAAGG - Intergenic
1096616722 12:52837300-52837322 GAACAGGGATGGAGAGGCCAGGG - Intergenic
1097179725 12:57164858-57164880 GTTAAGGAATGGAGGGGCCAAGG + Intronic
1098917154 12:76269389-76269411 GTTTATGGATGGAGAGGTCAGGG - Intergenic
1099460126 12:82911205-82911227 GTTTGGGTGTGGGGGGGCCAGGG + Intronic
1099636877 12:85224730-85224752 GTTGAGGGGTGGGGGGGCTAGGG + Intronic
1101343884 12:103867093-103867115 ATTTCAGGATGTAGGGGCCAAGG + Intergenic
1102625843 12:114234906-114234928 GGTAAGGGATGGAGGGAGCATGG + Intergenic
1102676642 12:114664041-114664063 GTGTAGGGGTGCAGGGGCCAGGG + Intergenic
1102870831 12:116412655-116412677 GTTTAGGAACATAGGGGCCACGG + Intergenic
1103142622 12:118562996-118563018 GGTTAGGGATGGGGAGGGCATGG - Intergenic
1104646757 12:130502916-130502938 TGGTAGGGATGGAGGGGACAGGG + Intronic
1104844699 12:131840922-131840944 GGTTGGGGATGGGGGGGCCATGG - Intronic
1105407009 13:20141738-20141760 GTTTGGGGGTGGCGGGGACAAGG - Exonic
1106559080 13:30833313-30833335 GTTCAGGTCTGCAGGGGCCAAGG - Intergenic
1107628438 13:42316353-42316375 GTTAAGGGGTGGAGGGGTCCTGG + Intronic
1108218889 13:48213131-48213153 GTTCAGGGCTGGAGGGGCAGAGG - Intergenic
1108315709 13:49235134-49235156 GTGGAGGGATGGAGGGGGAAGGG + Intergenic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1109992972 13:70082972-70082994 GGGTAGGGAAGGAGGGGCCCAGG + Intronic
1110492542 13:76125686-76125708 CTTCAGGGAGGGAGGGGGCAAGG + Intergenic
1113677127 13:112214944-112214966 GGTGAGGGCTGGAGGGGCGAAGG + Intergenic
1114484917 14:23056766-23056788 GTGGAGGCAGGGAGGGGCCACGG + Intronic
1115446688 14:33498685-33498707 GTTGGGGGATGGGGGGGCTAGGG + Intronic
1117474892 14:56084144-56084166 GGTTGGGGATGGAGGCGGCAGGG - Intergenic
1119103948 14:71906587-71906609 ATTTAGGGAAGGAAGGGCAAGGG - Intergenic
1119569047 14:75653789-75653811 TTTTATGGATGAAGAGGCCAAGG + Intronic
1119728031 14:76933854-76933876 GATTTGGGAAGGAGGGGACACGG - Intergenic
1121278010 14:92680813-92680835 GTTTAGCAAAGGATGGGCCATGG + Intronic
1121656328 14:95598905-95598927 GTTTATGGATGTGGGGGGCAGGG + Intergenic
1122601286 14:102923154-102923176 GTTTAGGGAAGGGGGCGCCAGGG - Intronic
1122754830 14:103970159-103970181 GTTGTGGCAAGGAGGGGCCATGG + Intronic
1123411728 15:20066501-20066523 ATTTGGGGATAGAGGGACCACGG - Intergenic
1123521072 15:21073620-21073642 ATTTGGGGATAGAGGGACCACGG - Intergenic
1125634178 15:41173323-41173345 GGTTAGGAAAGGAGGAGCCAAGG + Intergenic
1128561648 15:68672711-68672733 GTTCTGGGATGGAGTGGCCTAGG + Intronic
1128601120 15:68996280-68996302 GAGTAGGCATGGAGGGGCCCTGG - Intronic
1128621860 15:69157965-69157987 CTGTAGGGCTGAAGGGGCCATGG + Intergenic
1128983582 15:72203196-72203218 GTTTAGGGGAAGAGGGGGCAAGG + Intronic
1130802751 15:87282368-87282390 GATTAGGGATAGAGTGGCAAAGG + Intergenic
1130904953 15:88233740-88233762 GTGTAGGGAGGAAGGGGGCAGGG - Intronic
1132660943 16:1061292-1061314 CATTAGGGACGGCGGGGCCAGGG - Intergenic
1133237726 16:4395371-4395393 GATTAGGGCTGGAGGGTCCCTGG + Intronic
1133895827 16:9928103-9928125 TCTTAGGGATGGAGGAGTCACGG - Intronic
1134912354 16:18039175-18039197 GTTTGGGGGTGGAGGGGGCTAGG - Intergenic
1137420131 16:48326321-48326343 GGTTAGGGATGGAGGAGGGAAGG - Intronic
1140308181 16:73823367-73823389 CTTGAGGGATGGATGGGCCCAGG - Intergenic
1141579332 16:84986526-84986548 GTAAAGGGATGCAGGGCCCAGGG + Intronic
1143596102 17:7915287-7915309 TTTTCAGGATGGAGTGGCCAAGG - Intergenic
1143765948 17:9137906-9137928 GTTTCGGGATGGCCAGGCCAGGG + Intronic
1143960572 17:10714625-10714647 GTTTAGGGCTGGACTGGGCATGG + Exonic
1145762506 17:27433836-27433858 GCTGAGGGATGGAGGGGGCAGGG - Intergenic
1145770126 17:27486759-27486781 GTTTGGGGTTGGAGTGGCCTGGG + Intronic
1146620110 17:34390616-34390638 GCTTTGGGATGGAGGGACGAAGG + Intergenic
1147118848 17:38323260-38323282 GTTGGGGGAGGCAGGGGCCATGG + Intergenic
1147537730 17:41331840-41331862 GCTGAGGGATGGAGGAGACAGGG - Intergenic
1148579812 17:48735789-48735811 GTTTAGGACTTGAGGGGCCAGGG - Intergenic
1148591083 17:48817187-48817209 GATTCGGGAGGGAGGGGGCATGG - Exonic
1149026640 17:52035171-52035193 GATGAGGCATGGTGGGGCCATGG - Intronic
1149693621 17:58598963-58598985 GTTTAAAGATGGAGGGCCCACGG + Exonic
1150193687 17:63271604-63271626 GTTGGGGGATGGGGGGGGCAAGG - Intronic
1150300826 17:64045606-64045628 GATGAGGGAGGGAGGGGGCAGGG - Intronic
1150645035 17:66972549-66972571 GTTTAGGGTTGCAGGGACAAAGG + Intronic
1151206655 17:72513023-72513045 GTGGGAGGATGGAGGGGCCAGGG - Intergenic
1151903486 17:77033205-77033227 GCTGAGGGATGGAGGGACAAAGG - Intergenic
1151978378 17:77495057-77495079 AGTTAGGGATGGATGGGCCTGGG + Intronic
1152224245 17:79085407-79085429 CTGGAGGGATGGAGGGGCCCTGG + Intronic
1152325802 17:79635223-79635245 GTTAAGGGCTGGAGGGGGCATGG + Intergenic
1153106081 18:1528732-1528754 GTTTAGGGAGGAAGTGGTCAAGG + Intergenic
1156352294 18:36311756-36311778 GTTGAGGCAGGCAGGGGCCAGGG - Intronic
1157537538 18:48471065-48471087 GTTTGGGGAGGGATGGGCAAGGG - Intergenic
1157633208 18:49121559-49121581 GTTTGGGGGTGGAGTGACCATGG - Intronic
1158245163 18:55423993-55424015 GGTTGGAGAGGGAGGGGCCATGG - Intronic
1159145056 18:64443507-64443529 GGTTAGGGCTGAAAGGGCCATGG + Intergenic
1159430087 18:68340258-68340280 GGTTATGGAGGGAGGGGGCAAGG + Intergenic
1160184631 18:76665951-76665973 GGTTAGGGATGGTGGGGATAGGG + Intergenic
1160317434 18:77860341-77860363 GTTTAGGGAAGAAGGGTCCAGGG + Intergenic
1161021777 19:2014468-2014490 GTCCAGGGATGGAGGGGCCTGGG + Intronic
1161021862 19:2014694-2014716 GTTTGAGGATGGAGGGGCCCAGG + Intronic
1161165204 19:2783130-2783152 GTTTGGGGATCGTGAGGCCAGGG - Intronic
1161624306 19:5317069-5317091 TTTGAGGGCTGGAGTGGCCATGG + Intronic
1163191582 19:15680552-15680574 GTCTTGGGGTGGAGGGACCATGG + Intronic
1163201633 19:15774008-15774030 GTCTTGGGGTGGAGGGACCATGG - Intergenic
1163400704 19:17090858-17090880 GATTGGGGATGGAGGAACCAGGG - Intronic
1166626277 19:44358912-44358934 GTATAGGGGTGGTGGGGGCAGGG + Intronic
1167622470 19:50567534-50567556 GTGGAGGGTGGGAGGGGCCATGG + Intronic
1167768929 19:51501734-51501756 GTGTCGGGTTGGAGGTGCCAGGG + Exonic
1167782512 19:51608302-51608324 CTTTTGGGAAGGAGAGGCCAGGG + Intergenic
924988994 2:295142-295164 GTTTATGGATGAAAGGGGCAGGG + Intergenic
925293989 2:2765918-2765940 GTATGGGGAAGGAGGGGACAGGG - Intergenic
926156597 2:10458338-10458360 GTTTAGGAAGGGTGGGTCCAGGG - Intergenic
927706895 2:25302020-25302042 GAGGATGGATGGAGGGGCCAGGG - Intronic
928115733 2:28544144-28544166 GTGTAGGGAGGGAAGGGGCACGG + Intronic
930749838 2:54923795-54923817 GCTGAGGGAGGGAGGGGGCATGG - Intronic
934151730 2:89153991-89154013 GTGTAGTGATGAAGGGGCCATGG - Intergenic
934215530 2:90027915-90027937 GTGTAGTGATGAAGGGGCCATGG + Intergenic
936457658 2:112687644-112687666 GCTAAGGGATGGCGTGGCCATGG + Intergenic
937581065 2:123488382-123488404 GATTTGGGAAGAAGGGGCCATGG - Intergenic
938406181 2:131034642-131034664 CTTTGGGGAGGGATGGGCCAGGG - Intronic
938547208 2:132345480-132345502 GTATAGGGGTGGTGGGGGCAGGG - Intergenic
938786029 2:134630688-134630710 GGGTAGGGAGGGAGGGGCCCAGG - Intronic
938817403 2:134918520-134918542 GTCTAGGGTTGGCGGGGCGAAGG - Intronic
939576663 2:143903443-143903465 CTGTAGGGAAGGAGGGCCCAGGG - Intergenic
939790602 2:146569666-146569688 GTTAAGGGATGGAGGCCCCTGGG + Intergenic
940086854 2:149869374-149869396 GGTTAGGGATGGCGGGGTGAGGG + Intergenic
946248907 2:218401443-218401465 GTGTCTGGATGAAGGGGCCACGG + Intronic
948478579 2:238236855-238236877 CTTTAGGGCTGGAGGGGCACAGG + Intergenic
1169118336 20:3081481-3081503 GGGGAGGGGTGGAGGGGCCAAGG + Intergenic
1169329697 20:4706618-4706640 GTCTAGGGGTGGAGGGACTATGG - Intergenic
1169860035 20:10141528-10141550 GTTTAGGGATGGAGGGCCGAAGG - Intergenic
1171876079 20:30578239-30578261 GTATAGGGGTGGTGGGGGCAGGG - Intergenic
1171933775 20:31254020-31254042 GTTTAGGGATGGAGGGTGCAGGG + Intergenic
1172473510 20:35219282-35219304 ATTTTTGGATGGAGTGGCCAGGG - Intergenic
1173351638 20:42250984-42251006 ATTTAGGGATGGGGGGACGAGGG + Intronic
1173846782 20:46193405-46193427 GCTTTGGGCTGGAGGGTCCAGGG - Intronic
1174342215 20:49905098-49905120 GTTTAGGAAGGGGGCGGCCAAGG + Exonic
1174386295 20:50190303-50190325 GTTTACGGGAGGAAGGGCCACGG + Intergenic
1175935106 20:62510573-62510595 GTAGAGGGATGGAGGGGTAAGGG - Intergenic
1175941043 20:62537646-62537668 GTCTTGGAGTGGAGGGGCCAGGG + Intergenic
1178321185 21:31607069-31607091 GGTGAGGGATGGTGGGGGCATGG - Intergenic
1178442918 21:32612966-32612988 TTTTCAGGACGGAGGGGCCAGGG + Intergenic
1179427572 21:41294186-41294208 GTTTAGTGAAGGTGGGGCTAGGG - Intergenic
1179595267 21:42438872-42438894 GGGCAGGAATGGAGGGGCCATGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1182430673 22:30297179-30297201 GTTCAGGGCTGGAGGGGACAGGG + Intronic
1183110048 22:35642275-35642297 GCTTAGAGAGGGAGGGGCCCTGG + Intergenic
1183453080 22:37906920-37906942 GTTTAGGGTAGGAGAGGCCCAGG - Intronic
1184335897 22:43852924-43852946 GTTCAGGGATGGAATGTCCAGGG + Intronic
1184586727 22:45452916-45452938 GCTGAGGGATGGTGGGGCCCAGG - Intergenic
1184592867 22:45496829-45496851 ATTAGGGGATGTAGGGGCCAGGG - Intergenic
949905637 3:8856241-8856263 GGCTGGGGAGGGAGGGGCCAAGG - Intronic
950729138 3:14941546-14941568 GTGGGGGGATGGAGGGGCAATGG + Intergenic
951776589 3:26317068-26317090 GTTCAGGGAGTGAGGGGCAAGGG - Intergenic
952433844 3:33252406-33252428 GTTTAGGGCTGGAGGAGGAATGG - Intergenic
952713499 3:36454590-36454612 GTTTAAGGATGGAGTGGAGAGGG - Intronic
953305003 3:41821060-41821082 GTTGAGGGAAAGAAGGGCCAAGG - Intronic
953415595 3:42714069-42714091 CTTTAAAGATGGAGGGGGCAAGG - Intronic
954674177 3:52306626-52306648 GGATAGGGCTGGAGGTGCCAAGG + Intergenic
954887339 3:53887280-53887302 TCTTAGGGAAGGAGGGGCCAAGG + Intronic
955680118 3:61491581-61491603 GTTGAGGCTTGGAGGGGACAGGG - Intergenic
956310310 3:67871246-67871268 GATCTGGGTTGGAGGGGCCAGGG + Intergenic
958966468 3:100564049-100564071 GTTTGGGGATGGAGAGGCAAGGG + Intronic
959822457 3:110752655-110752677 TTTTAGGTATGCAAGGGCCAAGG - Intergenic
959937292 3:112042148-112042170 GTTTAGGGAAGTAGAGGGCAGGG + Intronic
960157937 3:114317062-114317084 GTTTGAGCATGCAGGGGCCATGG - Intergenic
961445669 3:126980177-126980199 GCTGAGGGATGCAGGGGACATGG + Intergenic
961468131 3:127093680-127093702 GTTCATGGATGGAGGGCCCTGGG + Intergenic
961931713 3:130540652-130540674 GTTGAGGGAGGGTGGGGTCAGGG - Intergenic
962506114 3:136047953-136047975 GGGTAGGGATGGAGGGAGCAAGG + Intronic
963764238 3:149317088-149317110 GATTTGGGATGGTGGGGACATGG - Intergenic
967097909 3:186192952-186192974 GGATAGAGATGGAGGGGACAGGG - Intronic
967222252 3:187257158-187257180 GTTTTGAGATGGAGTGGTCAGGG + Intronic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969430852 4:7153486-7153508 GTTTGGGGAAGGAGGAGCAAGGG - Intergenic
969582552 4:8073544-8073566 GGTGAGGGAGGGAGAGGCCACGG + Intronic
970741004 4:19237507-19237529 GTTTAGGGATGAAGGCTCAATGG + Intergenic
971013510 4:22464551-22464573 GATAAGGGATGCTGGGGCCATGG - Intronic
976715754 4:88120860-88120882 GATTTGGGAGGGAGGGGCCAGGG + Intronic
980158581 4:129134105-129134127 GGTGGGGGATGCAGGGGCCAGGG + Intergenic
980478005 4:133345067-133345089 GTAGAGGGAAGGAGGGTCCAGGG + Intergenic
984584157 4:181543687-181543709 GTTGAAGAATGGAGGTGCCAGGG - Intergenic
987431115 5:17834540-17834562 GTGTAGGGATGGGGAGGCAAGGG - Intergenic
991571243 5:68055405-68055427 TTTTAAAGATGAAGGGGCCAAGG - Intergenic
992904726 5:81334871-81334893 GATTAGGGATGCAGGAGACAGGG + Intronic
994475522 5:100263765-100263787 GGTTAGGGATGGTGGGGAAAAGG - Intergenic
998286989 5:140871815-140871837 GTTTAGAGATGAAGGGGCATGGG - Intronic
999720411 5:154395117-154395139 TTTTAGGGATGAAAGAGCCAAGG - Intronic
1000571820 5:162924199-162924221 GTGGAGGGAAGGAGGGCCCAGGG + Intergenic
1001050865 5:168413241-168413263 CTTTAGAGATGGGGTGGCCAGGG + Intronic
1001682627 5:173570163-173570185 GTTGGGGGATGGAGGGGCTGGGG - Intergenic
1002172897 5:177385266-177385288 GTTTGGGGCTGGAGGGGGCCAGG - Intronic
1002477742 5:179478299-179478321 GGTTAGGGATGGTGGGGACATGG - Intergenic
1003630857 6:7785708-7785730 GTTTATGGAGGGAGAGGACATGG + Intronic
1004220793 6:13744470-13744492 GTTTAGGAATGGCTAGGCCATGG - Intergenic
1004593821 6:17079749-17079771 GTTGAGGGGTGGGGGGGCAAGGG + Intergenic
1005433973 6:25788053-25788075 GTTAAGAAATGGAAGGGCCAAGG - Intronic
1007102142 6:39256512-39256534 GCTAAGAGATGAAGGGGCCAGGG + Intergenic
1007295555 6:40818268-40818290 TGTTAAGGATGCAGGGGCCAGGG + Intergenic
1010123559 6:72407738-72407760 GTGAGGGGAGGGAGGGGCCATGG - Intergenic
1011769065 6:90655398-90655420 GGATAGGGAGGGAGGGGCCGGGG - Intergenic
1013177417 6:107689662-107689684 GTCTGAGGTTGGAGGGGCCATGG + Intergenic
1016003374 6:139065511-139065533 GTTTAGTGTTGCATGGGCCACGG + Intergenic
1016303568 6:142658367-142658389 GGGGAGGGATGGAGGGGACAAGG - Intergenic
1016398200 6:143649220-143649242 GGTTAGGGATGGAGTGGATAAGG + Intronic
1018042961 6:159941208-159941230 TTCTAGGGATGGAGAGGGCAGGG + Intergenic
1018087922 6:160320982-160321004 GTTTAGGGATTCAGTGGCCAAGG + Intergenic
1018910090 6:168096751-168096773 GTCGAGGGATGGAGGGGGCGCGG + Intergenic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019636441 7:2078579-2078601 GTTCAGACATGGAGGGGCCCTGG - Intronic
1020093038 7:5352023-5352045 GTTTGGAGCTGGAGGGGCCTTGG + Exonic
1021717838 7:23474942-23474964 GTTTAGGAAGGGAGCGGGCAGGG - Intergenic
1021802048 7:24316837-24316859 CTGTAGGGCTGGAGGGGCAAGGG - Intergenic
1022093833 7:27125666-27125688 GTTTAGGGATGCAGAGACCAGGG + Intronic
1022877885 7:34553383-34553405 CTGTAGTGTTGGAGGGGCCAAGG - Intergenic
1024710971 7:52014354-52014376 GTTTAAGGCTGTAGGGGCCTGGG + Intergenic
1024944676 7:54796771-54796793 GTCTAGGGAAGGCAGGGCCAAGG + Intergenic
1026846983 7:73703993-73704015 GTTTGGGGCTGGAGGGGCGGGGG - Intronic
1029423107 7:100481671-100481693 GTCTGGGGAAGGAGGGACCAAGG - Intergenic
1031096581 7:117427623-117427645 GGTTAGGGAGGGACGGGGCAGGG - Intronic
1032078923 7:128849096-128849118 GGTGAGGGAGGGAGGGGCCAGGG - Intronic
1032513447 7:132490182-132490204 GTGTAGGCATGGCAGGGCCAGGG - Intronic
1034269208 7:149795518-149795540 GCCTGGGGAGGGAGGGGCCAGGG - Intergenic
1034984686 7:155501836-155501858 GTTTAGGTGGGGAGGGGGCATGG + Exonic
1035666466 8:1384188-1384210 GTTAAGGGATGAAGTGGCCTTGG + Intergenic
1035675894 8:1455330-1455352 GTTTCCCGATGGTGGGGCCAAGG + Intergenic
1036628970 8:10497041-10497063 GTGAAGAGATGGTGGGGCCAGGG - Intergenic
1037361708 8:18081300-18081322 GTTGAAGGATGGTGGCGCCAGGG - Intronic
1037543902 8:19899142-19899164 GTATGAGGATGTAGGGGCCAAGG + Intergenic
1038898661 8:31816793-31816815 GTTTAGGGCTGAAGAGGCAATGG - Intronic
1041463302 8:58135127-58135149 GTTCAGCTATGGAGGGGCAAGGG - Intronic
1042005692 8:64177699-64177721 GTTTAGGCACTGAGGGGACATGG - Intergenic
1043270323 8:78325099-78325121 GTATAGGGATGGTGGGGGGAAGG + Intergenic
1043579015 8:81690191-81690213 GTTCAGGGGTGGAGTGTCCAAGG + Intergenic
1045888422 8:107126686-107126708 GATTTGGGAGGGAGGGGACAGGG - Intergenic
1047586458 8:126279304-126279326 GATACGGGATGGAGGGGGCAGGG + Intergenic
1048300306 8:133246358-133246380 CTTTGGGGATAGAGGGACCAGGG - Intronic
1049107623 8:140623686-140623708 CATTATGGAGGGAGGGGCCATGG - Intronic
1049290958 8:141801637-141801659 GATTTGGGATGCTGGGGCCAGGG + Intergenic
1051955436 9:22687493-22687515 GTTTAGGGGTGCAGGGTACAAGG - Intergenic
1052119227 9:24689374-24689396 GTTGAGTGATGGAGGTGCCTAGG - Intergenic
1052991169 9:34520219-34520241 GTTTGGGGAGGGAGGGGCTGTGG - Intronic
1054703260 9:68435425-68435447 GCTTAGGGATGGAGAGGTGATGG - Intronic
1055391145 9:75822915-75822937 GTCTAGTGAGTGAGGGGCCATGG - Intergenic
1057261466 9:93587171-93587193 GGTGAGGGATGGAGGAGCCTCGG + Intronic
1057261550 9:93587456-93587478 GATGAGGGATGGAGGAGCCCCGG + Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1058077173 9:100662940-100662962 GTTGGGGGATGGGGGGGCAAGGG - Intergenic
1058872776 9:109216897-109216919 GAGTAGGGGTGGAGGGGGCAAGG - Intronic
1058894107 9:109384936-109384958 GTTAAGGGCTGTAGGGCCCAAGG + Intronic
1059801602 9:117755005-117755027 GTTTAGAGATGGGTGGGGCAAGG - Intergenic
1060374964 9:123109338-123109360 GCAAAGGGATGGAGGGGCCGAGG - Intergenic
1060731455 9:126039557-126039579 ATTGAGGGATGGAGGGGGAATGG + Intergenic
1061036843 9:128118875-128118897 GTACAGGGATGGAGGGTGCAGGG + Intergenic
1061036865 9:128118938-128118960 GTACAGGGATGGAGGGTGCAGGG + Intergenic
1061478245 9:130883565-130883587 GTGCAGGGATGAAGAGGCCAGGG - Intronic
1061499125 9:130992175-130992197 GTCCTGGGATGGGGGGGCCAGGG + Intergenic
1061817979 9:133207671-133207693 GGTTAGGGATGGGGAGGCCGAGG - Intronic
1061932961 9:133842778-133842800 GCAGAGGGGTGGAGGGGCCATGG + Intronic
1062009357 9:134258927-134258949 GCTTGGGGATCGGGGGGCCAGGG - Intergenic
1062333657 9:136055528-136055550 ATCTAGGGGTGGAGGGGGCAGGG - Intronic
1062520486 9:136955721-136955743 GGGCAGGGATGGAGGGGCCTTGG - Intronic
1185758866 X:2673992-2674014 ATTCAGGGATGGGGAGGCCATGG - Intergenic
1185889597 X:3812655-3812677 GTGGAGAGATGGAGGGGCCAGGG + Intergenic
1188202009 X:27302938-27302960 GTTTAGTCTTGGAAGGGCCAAGG - Intergenic
1188520193 X:31030157-31030179 GTTGATGGAGGGTGGGGCCAAGG + Intergenic
1191806326 X:65138236-65138258 GGTTAGGGGTGGAGGGGAAAGGG - Intergenic
1192220843 X:69196435-69196457 GTTCAGGGAGGGAGGGGGGAAGG - Intergenic
1193526584 X:82598257-82598279 GTTTAAGGAGGGAGGTGGCATGG - Intergenic
1194225708 X:91254511-91254533 GTTGAGGGGTTGAGGGGCTAGGG - Intergenic
1195124713 X:101796138-101796160 GTTGTGGGATGGAGAGGCAAGGG + Intergenic
1197413330 X:126145117-126145139 GTTTGGGGGTGGTGGGGGCAGGG - Intergenic
1199047018 X:143186491-143186513 GGTTAGAGATGGTGGGGACAGGG - Intergenic
1199361466 X:146924405-146924427 GAGGAGGGATGGAGGGACCAAGG - Intergenic
1199710642 X:150466826-150466848 GTGCAGGGATGGAGGAGGCAGGG - Intronic
1199982211 X:152927444-152927466 GGTAGGGGATGGAGTGGCCAAGG - Intronic
1200036180 X:153332885-153332907 GGTCAGGGAAGGAGGGGTCAAGG + Intergenic
1200772586 Y:7140792-7140814 GTGGAGAGATGGAGGGGCCAGGG - Intergenic
1201906198 Y:19087785-19087807 GTGGAGAGATGGAGGGGGCAAGG - Intergenic