ID: 1083969726

View in Genome Browser
Species Human (GRCh38)
Location 11:66067500-66067522
Sequence GTGGTGAAACTGGCTGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083969721_1083969726 -1 Left 1083969721 11:66067478-66067500 CCTAGTGTAATCCTTGAAATTAG 0: 1
1: 0
2: 0
3: 4
4: 130
Right 1083969726 11:66067500-66067522 GTGGTGAAACTGGCTGTGGATGG 0: 1
1: 0
2: 2
3: 27
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083969726 Original CRISPR GTGGTGAAACTGGCTGTGGA TGG Exonic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
902353409 1:15876934-15876956 GTGGTGACTCTAGCTGTGCAAGG + Intronic
902833065 1:19030015-19030037 GTGGGGACACTGGCTGTGCCTGG - Intergenic
903124683 1:21239639-21239661 CTGGTGCAGCTGGGTGTGGACGG - Intronic
903212243 1:21824684-21824706 GAGGTGAGACTGGCATTGGAAGG - Exonic
903593984 1:24479962-24479984 GTGGTAGATTTGGCTGTGGACGG + Intergenic
905406430 1:37735507-37735529 GTGGTCTAACGGGCTGTGGGCGG + Intronic
906921858 1:50072983-50073005 GAGGTGAAACTGGGTATAGATGG - Intronic
907365128 1:53952075-53952097 ATGGTCAATCTGGCTCTGGATGG + Exonic
907627078 1:56040657-56040679 ATGGTGAAAATGGCTCTGTATGG + Intergenic
909473368 1:76054621-76054643 GTGGGGAAATTGACTGGGGAAGG + Intergenic
910394900 1:86782448-86782470 GTGCTGAAACAGGCTGGGCATGG + Intergenic
917529473 1:175821912-175821934 GTGGTGAAACTGGAAGTTAAAGG - Intergenic
923117446 1:230956140-230956162 GTGGTTAAACTAGCTGTCCAAGG + Intronic
1063171134 10:3510949-3510971 GAGGTGAAACAGGCTATGGGAGG - Intergenic
1065468831 10:26055179-26055201 GTAGTGAAAGTTGCTGTAGAGGG + Intronic
1067294167 10:44965226-44965248 CTGGTGAAACAGGCTATGGAAGG + Intronic
1067813592 10:49451843-49451865 GTGGTAAAACTGTCTGTGCCTGG + Intergenic
1068023622 10:51616437-51616459 GTGTTGACAGTGGCTGTGGTGGG + Intronic
1068957405 10:62830704-62830726 GTGGTGAGATTAGCTGTAGAGGG - Intronic
1069896489 10:71683411-71683433 CTGGTGAAGCTGGCTGTGACAGG - Intronic
1070162200 10:73873571-73873593 GAGATGAAACCGGCTGTGGGGGG - Intronic
1075799108 10:125141864-125141886 GTGGGGGAAGTGGCTTTGGAGGG - Intronic
1077436400 11:2541420-2541442 TTTCTGAAACTGGCTGGGGAGGG + Intronic
1078329283 11:10406024-10406046 GTGGTGTCACTGGCTGGGGATGG + Intronic
1078715129 11:13832618-13832640 GTGGTAAAACTTGGTGGGGAAGG - Intergenic
1079103931 11:17558610-17558632 CTGGTACAACTGGCTGTGAAGGG - Exonic
1081183823 11:40018073-40018095 GTGGTGAGACTGACTCTGTAAGG - Intergenic
1081760354 11:45572554-45572576 GGGGTGATGATGGCTGTGGAGGG - Intergenic
1081963493 11:47155235-47155257 GTAGTAAAACTGGATCTGGAAGG - Exonic
1081994028 11:47352293-47352315 GCGGGGAACCTTGCTGTGGAAGG + Intronic
1083031418 11:59596440-59596462 TTGGAGAAACTGGTTGTTGATGG - Intronic
1083186111 11:61018862-61018884 GTGGGGAAAATGGATGTGGACGG + Intronic
1083969726 11:66067500-66067522 GTGGTGAAACTGGCTGTGGATGG + Exonic
1089135642 11:116246946-116246968 GAGGTGAAGGTGGCTCTGGATGG + Intergenic
1089632666 11:119793436-119793458 GTGGGGCAACTGGCAGTGAAAGG + Intergenic
1092715829 12:11389648-11389670 GTGATGAAACTGGCTGCAGTAGG + Intronic
1096805003 12:54135371-54135393 GGGATGAGCCTGGCTGTGGAAGG - Intergenic
1096864640 12:54555161-54555183 ATGGTCAAACTGGAAGTGGATGG + Intronic
1097158656 12:57030171-57030193 GTGATGGAACTGGCTGTGCAGGG + Intronic
1098264409 12:68704227-68704249 GTGGTAAAACTGGCCTTGGCTGG + Intronic
1098636035 12:72784524-72784546 GTTGTAAAAATGGCTTTGGAAGG - Intergenic
1099877944 12:88432281-88432303 GTGGTTAGACTGTCTTTGGAGGG + Intergenic
1100214731 12:92435703-92435725 GTGGTGAAAATGGGTGTGCCCGG - Intergenic
1100473597 12:94915651-94915673 GTGGTGATATTGGCTGAGGTGGG - Intronic
1101960588 12:109246453-109246475 GTCGTGAAACTGGCGGGGCAGGG + Intronic
1102033500 12:109758280-109758302 GGGCTGGAACTGGCAGTGGAGGG - Intronic
1102130817 12:110527436-110527458 GCCGTGATACTGGCTGTGGCAGG - Intronic
1105756839 13:23473536-23473558 GTGGGGCACCTGGATGTGGACGG - Intergenic
1107095059 13:36527105-36527127 ATGCTGCAAGTGGCTGTGGATGG - Intergenic
1107111004 13:36698218-36698240 GCGGGGAAACTGGCAGAGGAAGG + Intergenic
1107725297 13:43293026-43293048 ATGGTGAAGGTGGCTGTGGTGGG - Intronic
1107725344 13:43293314-43293336 GTGGTGAAGATGGCCGTGGTGGG - Intronic
1108022096 13:46137992-46138014 CAGGTCAAACAGGCTGTGGATGG - Intronic
1108470978 13:50766697-50766719 GAGTTTAAACTGGCTGTGCAGGG - Intronic
1108514758 13:51190353-51190375 CTGGTGAAACTGGAAGTGGGTGG + Intergenic
1110869476 13:80433482-80433504 GTGGTGACACAAGCTGTGGAAGG - Intergenic
1112440597 13:99422079-99422101 GTGGGAAGACAGGCTGTGGAGGG - Intergenic
1112934406 13:104781154-104781176 GTGGTGGAAATGGCTGTGTGGGG + Intergenic
1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG + Exonic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1120022801 14:79549653-79549675 ATGGTGAATGTGGCTGTGGATGG - Intronic
1122970825 14:105151547-105151569 GTGGGGCAACTCGCTGGGGATGG - Intronic
1123926641 15:25119107-25119129 TTGGTGAAGCTGGCAGTAGAAGG - Intergenic
1124066917 15:26353460-26353482 CAGGTGGAACAGGCTGTGGAGGG + Intergenic
1125726662 15:41871708-41871730 GTGGGGAAGCTGGCTCTGGCGGG - Intronic
1127430899 15:58907167-58907189 GAGGTGAATCTGGCTGTGAGAGG + Intronic
1130251574 15:82303514-82303536 GGGGTGAAACTGGCTGAGCACGG - Intergenic
1130323161 15:82856827-82856849 GTGGCGGCTCTGGCTGTGGAAGG + Intronic
1130805180 15:87313539-87313561 GTGGTGCAACTGACCTTGGATGG + Intergenic
1131380835 15:91962623-91962645 GAGGTGGAAATGGCTGTGGAAGG + Intronic
1133601581 16:7345028-7345050 GTGGTGACAAAGGCTGAGGAAGG + Intronic
1134489065 16:14682121-14682143 TTGGGGAAACTGGCTGGGCATGG - Intronic
1137637502 16:49999635-49999657 GAGGTGACCCTGGCTGTGAAGGG + Intergenic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1139018520 16:62719750-62719772 GTAGTGAAACTGGCTGTGCACGG + Intergenic
1139542127 16:67626000-67626022 GTGATGACAATGGGTGTGGATGG - Intronic
1140954426 16:79849158-79849180 GTGGTGAAAGGGCCTTTGGAGGG - Intergenic
1141191648 16:81829397-81829419 ATGGTGAAACTGGCTAGGCACGG - Intronic
1141464537 16:84197073-84197095 GGGGTGAAACTGGGGCTGGAGGG + Exonic
1141741386 16:85895414-85895436 GTCCTGAGGCTGGCTGTGGAAGG + Intergenic
1141919861 16:87128448-87128470 TTGGTGAAGCAGGGTGTGGAAGG - Intronic
1142267403 16:89070889-89070911 GGGGTGAGAGTAGCTGTGGAGGG - Intergenic
1143172126 17:4936427-4936449 GTGGTTAGACTGGCTGGGGATGG - Intergenic
1143658343 17:8310467-8310489 ATGGTGAGACTCGCCGTGGAGGG + Intronic
1143748882 17:9013963-9013985 GGGGTGAAAATGCCTGTGGATGG - Intergenic
1144887419 17:18472748-18472770 GTGGTGGAAATGGCACTGGATGG + Intergenic
1144949138 17:18984730-18984752 GGGGTGATACTGGGTGTGGAGGG - Intronic
1145144797 17:20471546-20471568 GTGGTGGAAATGGCACTGGATGG - Intergenic
1145302766 17:21652787-21652809 GTGAGGATACAGGCTGTGGATGG - Intergenic
1145347536 17:22050402-22050424 GTGAGGATACAGGCTGTGGATGG + Intergenic
1145416044 17:22714927-22714949 GTGAGGAAACAGGCTGTGGATGG - Intergenic
1146354130 17:32119836-32119858 GTGGTGGAAATGGCACTGGATGG + Intergenic
1146402414 17:32510356-32510378 GTGGTGAAAGTGCCTGTGCAGGG - Intronic
1147204262 17:38825293-38825315 GTGGTGAAACTGGCAGTTGACGG - Exonic
1148535835 17:48437995-48438017 GTGGGGAAATTGGATGTGGGAGG - Intergenic
1148712713 17:49693401-49693423 GTTCTGTAACTGTCTGTGGAAGG - Intergenic
1148769006 17:50056271-50056293 GCTGTGAAACTGGCTGGGGCTGG + Intronic
1149445467 17:56710096-56710118 CTGGTGAAACTAGCTGCAGAAGG + Intergenic
1149458229 17:56806865-56806887 GTGGTGGAGGTGGCAGTGGAGGG + Intronic
1151230275 17:72679751-72679773 GTGGTAAAATTGGCTGGGCACGG + Intronic
1151487016 17:74407426-74407448 GAGGTGAGGCTGGCTGTGCATGG + Intergenic
1151672449 17:75578904-75578926 GAGGTGAAAGTTACTGTGGATGG + Intergenic
1151822480 17:76504200-76504222 GCCGGGAAACTGGCTGTGGTGGG + Intergenic
1203161906 17_GL000205v2_random:60297-60319 GTGGTGAAGCTCGCTGTGTACGG + Intergenic
1156478311 18:37420404-37420426 GTGCTGAGAATGGCTGTGAACGG + Intronic
1156666859 18:39419344-39419366 GTGTTAAAACTGTCAGTGGAAGG + Intergenic
1157272004 18:46283352-46283374 GTGCTGGAACTGGGTGTGCAAGG - Intergenic
1157324095 18:46656853-46656875 GTGGTGCAGCTGGCTGCGGTGGG - Intronic
1157612470 18:48966584-48966606 GTGATGACACTTGGTGTGGATGG - Intergenic
1160681562 19:413756-413778 GTGGTGAAGCTGGTTTTGGAGGG - Intergenic
1162302906 19:9854303-9854325 GTGGGAATACTGGTTGTGGAAGG + Exonic
1162590232 19:11586611-11586633 GTGGTGAAACAGGCATTGGGGGG + Intronic
1165362682 19:35346423-35346445 GTCAGGAAACTGGCTGTGGCCGG - Intronic
1165650272 19:37481840-37481862 GAGGTCAAACAGACTGTGGAAGG - Intronic
1166360466 19:42250954-42250976 GTGGTGCAACTGGCTCTGAATGG - Intronic
1166776391 19:45315464-45315486 GTGGAGAAGCTCTCTGTGGAAGG - Exonic
1167418142 19:49387981-49388003 TTGGTGAAATGGGCTGAGGAAGG - Intergenic
925366546 2:3315459-3315481 GTGGTGGTAGGGGCTGTGGATGG - Intronic
925366597 2:3315607-3315629 GTGGTGGTAGGGGCTGTGGATGG - Intronic
925366723 2:3315975-3315997 GTGGTGGTAGGGGCTGTGGATGG - Intronic
925461192 2:4064077-4064099 GTGGTGAAAATGGATGTAAAAGG + Intergenic
926286641 2:11494011-11494033 GTGGTGAAGCAGCCTGTGTAAGG - Intergenic
927219148 2:20690679-20690701 GTGGTGGCACTGGCGGGGGATGG + Intronic
928229559 2:29485692-29485714 GGGGTGAGCCTGGCTGGGGAAGG - Intronic
930845653 2:55900712-55900734 ATGGGGAAACTGGATGTGGCTGG + Intronic
931639870 2:64372398-64372420 AAAGTGAGACTGGCTGTGGATGG - Intergenic
932023235 2:68109481-68109503 ATGGTGAAACTGGCATGGGAAGG - Intronic
932415872 2:71573562-71573584 GGGGTGAAATTGGCTGTGGTTGG + Intronic
932430248 2:71669907-71669929 GTGGTGACACTGGCAGTGCTGGG - Intronic
932838633 2:75060879-75060901 CTGGTGGACTTGGCTGTGGATGG + Intronic
933833121 2:86226187-86226209 GTTGTGAAAGTGGCTGTGAAAGG - Intronic
934666218 2:96172906-96172928 GAGGTGAAACTGGCTGTCCCTGG + Intergenic
936878057 2:117216030-117216052 GTGGTAAAACTGGTTTTGAAAGG - Intergenic
937264264 2:120606253-120606275 GTGATGAACCTGTCTGTGGATGG + Intergenic
938196652 2:129334528-129334550 GGGGTGAAACGGACAGTGGAGGG - Intergenic
938317520 2:130340330-130340352 ATGGTGCAACTGGCTGTACAGGG - Intronic
945557730 2:211300166-211300188 CTGCTGAAAGGGGCTGTGGAGGG + Intergenic
946190446 2:218005035-218005057 CTGGTGATAGTGGCTGAGGAGGG - Intergenic
947091279 2:226513719-226513741 GTGGTGAAGCTGGCCATGAAGGG - Intergenic
947745995 2:232507671-232507693 GGGGAGACACTGGCTGGGGATGG - Intergenic
948468773 2:238164420-238164442 GTGGTTAAACAGGCACTGGACGG + Intronic
1171451410 20:25238530-25238552 GTAGTGACACAGGCTGAGGAAGG + Intergenic
1171519354 20:25764318-25764340 GTGAGGAAACAGGCTGCGGATGG - Intronic
1171557569 20:26092173-26092195 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1172040399 20:32040634-32040656 GGGGTGAGACTGGGTGGGGACGG - Intergenic
1173125507 20:40332643-40332665 GTGATGATACTGCCTGTAGATGG - Intergenic
1173942844 20:46926703-46926725 CTAATGAAAGTGGCTGTGGAGGG + Intronic
1174756375 20:53162572-53162594 GGGCTGACACTGGCAGTGGAAGG - Intronic
1174844060 20:53926597-53926619 CTGTTGAAACTGGCAGTGGTGGG - Intergenic
1175592953 20:60207789-60207811 TTGGTGAAAATGACTGGGGAGGG + Intergenic
1176186645 20:63783879-63783901 CTGCTGAAACAGGCTGTGAAAGG + Intronic
1176653496 21:9570599-9570621 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1176907913 21:14526156-14526178 GTTATGAAACTGGCTGGGCATGG - Intronic
1177179132 21:17726129-17726151 GTTGGGAAACTGGCTCTGTAGGG - Intergenic
1177777843 21:25589251-25589273 ATGTTGAAACTGGCTGTTTAAGG - Intronic
1178248756 21:30980726-30980748 GTGGTAAAGCTGGCTGTGCAGGG - Intergenic
1180981933 22:19882647-19882669 CTGCTGAAAGTGGCTCTGGAGGG - Intronic
1181115609 22:20631228-20631250 AGGGTGGAACTGGCTGGGGAAGG - Intergenic
1182011922 22:27008200-27008222 GTAGTTAAACTGCCTGTGTAGGG + Intergenic
1182511168 22:30821554-30821576 GTGGTACAAATGGCGGTGGATGG + Intronic
1182891091 22:33819480-33819502 TTGGTGAAACAGCCTGTGGATGG - Intronic
1183112536 22:35661033-35661055 GTAGTGACACAGGCTGTGGGAGG + Exonic
1183935294 22:41258419-41258441 GTGGGGACCCTGGCTGTGGTGGG + Intronic
1185192207 22:49446125-49446147 GTTTTGATACTGGGTGTGGAGGG - Intronic
949519501 3:4836979-4837001 GTGGTGATAGTGGGTGTGGGTGG - Intronic
949735423 3:7166498-7166520 GTGGAGACAGTGGCTGGGGAAGG - Intronic
951801384 3:26600237-26600259 GTTGTGAAACCAGATGTGGATGG - Intergenic
954978341 3:54719354-54719376 GTGGTAAAAATGGATGTGAATGG + Intronic
957242396 3:77675588-77675610 GTGTTGAAACTTGCTCTGCAAGG + Intergenic
959783444 3:110264707-110264729 GTTGTCAAACTGTCTCTGGAGGG + Intergenic
959857867 3:111181089-111181111 GTGGTGATACTGATGGTGGAGGG - Intronic
963292198 3:143503473-143503495 GTGGCGAAGCAGGCTTTGGAGGG - Intronic
963359174 3:144248738-144248760 ATGGGGAAAATGGCTGTTGATGG - Intergenic
963685912 3:148433857-148433879 CTGGTGAAGCTAACTGTGGAAGG + Intergenic
963760955 3:149287028-149287050 GTGGTTGAAGTGGCTTTGGAGGG - Intergenic
965894914 3:173563859-173563881 GTGTAGAAACTGGTTGTAGAGGG - Intronic
967156088 3:186693746-186693768 GTGGTGACACTGGTTGTTTATGG - Intergenic
969455829 4:7299095-7299117 GTGGTGAGACAGGCTGGGGGAGG + Intronic
969673616 4:8602966-8602988 GTGGTGGAGCTGCCTGTGGGAGG + Intronic
969732245 4:8964118-8964140 GAGGTGACACGGGCTCTGGAAGG - Intergenic
970630790 4:17941948-17941970 GTGTTGAAAGTGGCTGTGATAGG - Intronic
971466542 4:26969276-26969298 TTGGGGAAAGTGGCAGTGGAGGG + Intronic
972681194 4:41308580-41308602 GTGGTGAAGCAGTCTGTGCACGG - Intergenic
976124501 4:81819108-81819130 ATGGTGAAGCTGGCTGGGCACGG + Intronic
977399750 4:96517681-96517703 GGGGAAAAACTGGCTTTGGAAGG + Intergenic
982325928 4:154128201-154128223 GTGTTGTAAATGGCTGTGCATGG + Intergenic
984237239 4:177174348-177174370 GTGGTGAAAGTAGGTGTAGATGG - Intergenic
985545235 5:505764-505786 GTGGGGAGAGTGGCTGTGGGGGG + Intronic
986794060 5:11191966-11191988 CTGGTGAAAACGCCTGTGGAAGG - Intronic
987598358 5:20031581-20031603 GTAGTGACCCTGGCTGTGAAGGG + Intronic
987694900 5:21315646-21315668 TTGGTGATACTGGCTGTTGCTGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992834795 5:80629751-80629773 GTGGAGAAGCTGGGTTTGGAAGG - Intronic
994837149 5:104870618-104870640 GTCCTGAAAATGGATGTGGATGG + Intergenic
997716006 5:136043613-136043635 ATGATGAAATTGGCTGAGGATGG + Intronic
1003313288 6:4987558-4987580 GTGGTGGAGCAGGATGTGGAGGG - Intergenic
1005665686 6:28051467-28051489 GTCGTGAAAATTGCTGTTGATGG - Intergenic
1006038543 6:31234026-31234048 GTGGTGCTACTGGCTGTGGCGGG + Intergenic
1007155120 6:39735335-39735357 GCGGTGAAGCAGGCTGTGTAGGG - Intergenic
1007267167 6:40605397-40605419 GTGGGGAAAGAGGCTGTTGAGGG - Intergenic
1012932745 6:105333883-105333905 GGGGTGAAAGTGTCTGTGGTTGG - Intronic
1014047120 6:116902746-116902768 GTTGTTCAACTGGCTGTGAACGG - Intronic
1014812741 6:125904571-125904593 ATGGTTAAACTGGGTGTTGAGGG - Intronic
1018148217 6:160913107-160913129 GTGGTGAGACTGGCTGTCAGTGG - Intergenic
1020658461 7:10954571-10954593 CTGGTGAAACTGTATGGGGATGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021777075 7:24064429-24064451 TTGGAGAGACTGGCTGTTGATGG + Intergenic
1024231625 7:47367787-47367809 GTGGGGAGACTGGTTATGGAAGG - Intronic
1025279835 7:57619258-57619280 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1025304897 7:57846243-57846265 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1025719222 7:63994537-63994559 GTTGTGAGACTTGCTGTGGGGGG + Intergenic
1029373859 7:100166523-100166545 GTGGTGACAGAGGATGTGGAAGG + Exonic
1030797483 7:113806581-113806603 GTGGTGAAAGGGGGTGGGGAGGG - Intergenic
1033226851 7:139569231-139569253 GTGGTGAAATTTCCTGGGGAAGG + Exonic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034523034 7:151635453-151635475 ATGGTGAAGCGGGCTGTGGTAGG + Intronic
1035325222 7:158061597-158061619 GTGAGCACACTGGCTGTGGACGG + Intronic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1037537776 8:19842666-19842688 ATGGTGAAATTGGCTTTTGATGG - Intronic
1040759155 8:50816983-50817005 ATGGTCAAACTGGCTGGGCACGG + Intergenic
1041625962 8:60027273-60027295 GTGGAGAGACTGACTGTAGAAGG - Intergenic
1043751634 8:83943441-83943463 GTGTTGAAACAGGCTGTGACAGG + Intergenic
1044700050 8:94957523-94957545 GTACTGAAACTGTCTTTGGAAGG + Intronic
1045546119 8:103130252-103130274 TTGGTAAAAGTGGCAGTGGAGGG - Intergenic
1047439295 8:124862246-124862268 GTGGTGTAACAAGCGGTGGAGGG - Intergenic
1047618824 8:126585809-126585831 AGGGTGGAAATGGCTGTGGAGGG + Intergenic
1047914226 8:129564999-129565021 GTGGAGAAACTGGCTGTGATGGG - Intergenic
1047998426 8:130358060-130358082 GTGGTGAAGCTGGACGTGGTGGG + Exonic
1048813619 8:138310581-138310603 GGAGATAAACTGGCTGTGGAGGG - Intronic
1049391169 8:142372466-142372488 GTGGGCACACTGGCTTTGGAAGG + Intronic
1052367088 9:27624336-27624358 GAGGGAAAACTGGCTGTCGATGG + Intergenic
1052691842 9:31825238-31825260 TTGGTGAAAGGGACTGTGGAGGG + Intergenic
1053062643 9:35044021-35044043 GAGGTGAAACTGGGTCTGCAGGG - Exonic
1056456307 9:86764328-86764350 GTGAGCAAACTGGCTGTGAAGGG - Intergenic
1056810226 9:89758072-89758094 CTGGTGACACTGCCTATGGAGGG + Intergenic
1057677086 9:97144403-97144425 GGGGTGAAAATGGCTGTTGGGGG - Intergenic
1058525885 9:105857347-105857369 GTGGTATACCTGGCTCTGGAAGG - Intergenic
1059031120 9:110697445-110697467 GTGGTGAAGCTGGAAGTTGAGGG + Exonic
1060307715 9:122431192-122431214 GTTGTCAAACTGCCTGTGTAAGG + Intergenic
1060417464 9:123442337-123442359 GTGATGAAAGAGGCTGTCGATGG + Intronic
1061108368 9:128549988-128550010 GGGGTGAGACAGGGTGTGGAGGG + Intergenic
1062148814 9:135007056-135007078 GGGGAGGACCTGGCTGTGGAGGG - Intergenic
1062282983 9:135760193-135760215 CTGCTGCACCTGGCTGTGGATGG - Intronic
1203631216 Un_KI270750v1:74046-74068 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1187087455 X:16056044-16056066 TTGGTGATACTGGCTGTTGCTGG + Intergenic
1188550357 X:31357680-31357702 GTGGTCAAATTGACTGTGAAGGG - Intronic
1189193566 X:39133000-39133022 GTGGTGATGATGGGTGTGGATGG - Intergenic
1190892963 X:54586965-54586987 GTGTTGGAACTGGCTGTGATGGG - Intergenic
1191715964 X:64193700-64193722 GTGGTGCTATTGGCTGTGGGAGG + Intronic
1192235276 X:69291636-69291658 GAGGTGATACTGGCTTTGGGTGG + Intergenic
1192434229 X:71132934-71132956 CTGGTGCACCTGGCTGTAGAGGG - Exonic
1192817826 X:74613464-74613486 ATGGTGAAACTGTCTAGGGAAGG + Intronic
1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG + Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1197594675 X:128451127-128451149 GTGGTGGCAGTGGCTGTGGTAGG + Intergenic