ID: 1083970130

View in Genome Browser
Species Human (GRCh38)
Location 11:66069840-66069862
Sequence GAGAGGTCGGCGGAGACCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083970130_1083970147 15 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970147 11:66069878-66069900 CAGGGCAGGGCTAGGTCGGCAGG No data
1083970130_1083970149 26 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970149 11:66069889-66069911 TAGGTCGGCAGGCGGAGAGCCGG No data
1083970130_1083970142 2 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970142 11:66069865-66069887 TTTGCCGGGGCCGCAGGGCAGGG No data
1083970130_1083970148 18 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970148 11:66069881-66069903 GGCAGGGCTAGGTCGGCAGGCGG No data
1083970130_1083970140 -3 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970140 11:66069860-66069882 CTCTGTTTGCCGGGGCCGCAGGG No data
1083970130_1083970141 1 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970141 11:66069864-66069886 GTTTGCCGGGGCCGCAGGGCAGG No data
1083970130_1083970145 11 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970145 11:66069874-66069896 GCCGCAGGGCAGGGCTAGGTCGG No data
1083970130_1083970144 7 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970144 11:66069870-66069892 CGGGGCCGCAGGGCAGGGCTAGG No data
1083970130_1083970139 -4 Left 1083970130 11:66069840-66069862 CCCCGGGTCTCCGCCGACCTCTC No data
Right 1083970139 11:66069859-66069881 TCTCTGTTTGCCGGGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083970130 Original CRISPR GAGAGGTCGGCGGAGACCCG GGG (reversed) Intergenic
No off target data available for this crispr