ID: 1083979415

View in Genome Browser
Species Human (GRCh38)
Location 11:66153919-66153941
Sequence CACTTTAAACACAGAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083979414_1083979415 -6 Left 1083979414 11:66153902-66153924 CCTGCTTAGAAGAGACACACTTT 0: 1
1: 0
2: 4
3: 17
4: 180
Right 1083979415 11:66153919-66153941 CACTTTAAACACAGAGACACAGG 0: 1
1: 0
2: 4
3: 33
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083979415 Original CRISPR CACTTTAAACACAGAGACAC AGG Intronic
900343605 1:2200421-2200443 AAATTTGGACACAGAGACACAGG + Intronic
900752238 1:4405931-4405953 CCCTTTAAAAACAGAGATGCTGG - Intergenic
900905145 1:5551863-5551885 CTCATGAAACAGAGAGACACTGG - Intergenic
901567108 1:10126214-10126236 CACTTGAACCCCAGAGGCACAGG + Intronic
902011997 1:13277295-13277317 GTCTTTAAACAAAGAGTCACCGG - Intergenic
902109747 1:14068217-14068239 CACATTAAACTTAGAGACAAGGG + Intergenic
904509628 1:30993023-30993045 CTCTTTAAATACAGAGACAATGG + Intronic
904930526 1:34083337-34083359 CACTTAAAACACAGATATATAGG - Intronic
904951523 1:34244805-34244827 CATTTTAAATATAAAGACACAGG - Intergenic
905019419 1:34798156-34798178 AAATTTAGACACAGAGACACAGG - Intronic
905022425 1:34827022-34827044 CCCTGTACACACAGAGACTCTGG + Intronic
905111221 1:35595805-35595827 CACTTGACACACACACACACAGG - Intergenic
905498218 1:38413426-38413448 AAATGTAAACACTGAGACACAGG - Intergenic
906717552 1:47981367-47981389 GAGTTTAAACACAGAAACTCTGG - Intronic
906954856 1:50365356-50365378 CAATGAGAACACAGAGACACAGG + Intergenic
906959660 1:50411296-50411318 AACTGTAAAGACAGAGAAACAGG + Intergenic
907854331 1:58287115-58287137 CAATGTAAATACATAGACACAGG + Intronic
909512087 1:76464774-76464796 CACTTTATAGACAGAGAAGCTGG + Intronic
910286597 1:85562588-85562610 AAATTTGATCACAGAGACACAGG + Intronic
910539613 1:88341182-88341204 AATTTTTAACACAGAGTCACAGG + Intergenic
910913079 1:92258700-92258722 CAATTTGAACACATGGACACAGG + Intronic
912793240 1:112674277-112674299 CACCTTTATCTCAGAGACACTGG + Intronic
914217901 1:145650179-145650201 CAATGTGAACACACAGACACAGG - Intronic
914470455 1:147972854-147972876 CAATGTGAACACACAGACACAGG - Intronic
915441031 1:155945621-155945643 CATTTCACACACAGGGACACAGG - Intergenic
916023923 1:160817964-160817986 CACTTGAAACACTGTGACACTGG + Intronic
916712398 1:167423535-167423557 CACTTTGAGCACAGAAACAAAGG + Exonic
917584353 1:176410851-176410873 CAATTAGAACACATAGACACAGG - Intergenic
917703723 1:177609603-177609625 AACATTAAACACAACGACACAGG + Intergenic
918047458 1:180950084-180950106 CACTTTAAAAGCAGAGACAGTGG + Exonic
919369667 1:196707522-196707544 CACTTAAAACACAGTGAAAGAGG + Intronic
919620356 1:199858215-199858237 CCCTGTAAACACAGACAGACAGG + Intergenic
919680815 1:200432767-200432789 CACTGTAAATACTGAGAAACAGG - Intergenic
919927500 1:202199793-202199815 CATTTTAAAGACTGAGAGACTGG - Intronic
920734689 1:208521170-208521192 CACTTTAAACATAAAGACACAGG - Intergenic
922475771 1:225906114-225906136 CATTTTAAAGAGAGAGAAACTGG + Intronic
922623208 1:227007912-227007934 CCCTTTAAACATAGAAACCCAGG + Intronic
923025364 1:230199589-230199611 CACTTTTAACACTGTGACCCAGG - Intronic
923261933 1:232276031-232276053 CTCTTCAAAAACAGAGACATAGG + Intergenic
923263033 1:232285389-232285411 CACTTTCAACATAAGGACACTGG + Intergenic
924072950 1:240300939-240300961 CAATTCAAACACAGAGACACAGG - Intronic
924077101 1:240351345-240351367 GACTTGAAACACCCAGACACTGG + Intronic
924678408 1:246204410-246204432 CACTGGAAATATAGAGACACAGG - Intronic
1062807616 10:436221-436243 CACTGCATACACAGAGAAACCGG - Intronic
1063281677 10:4636501-4636523 CAATTTAAACATAGAGAAAGAGG - Intergenic
1063585859 10:7351774-7351796 CACTTGAAATACAGCCACACGGG - Intronic
1063596280 10:7438686-7438708 ACCCTTAAACACACAGACACGGG - Intergenic
1063868569 10:10393614-10393636 CATCTTATAAACAGAGACACTGG + Intergenic
1064364918 10:14699070-14699092 CACTGAAAACAAAGAGACAGAGG + Intronic
1064795657 10:19008543-19008565 CATTTTAAACAGAGTGACAAAGG - Intergenic
1065085956 10:22176620-22176642 CATTTTAAACACAAAGACTCAGG + Intergenic
1066187958 10:33028947-33028969 CACTTTTATAACAGAGACAGAGG + Intergenic
1067956141 10:50793869-50793891 CACTGTAGAGACAGAGACATTGG - Intronic
1068002081 10:51347628-51347650 CATTTTAGACCCAGAGACATGGG - Intronic
1068243189 10:54332430-54332452 CAGTGTAAACACATAGAGACAGG - Intronic
1068493062 10:57748457-57748479 CAATGTGAACACATAGACACAGG - Intergenic
1068540637 10:58290993-58291015 TACATTATCCACAGAGACACAGG - Intergenic
1069122293 10:64581957-64581979 CAATATGAACACATAGACACAGG - Intergenic
1069279397 10:66635936-66635958 CAATTTATACTCAGAGACAAGGG - Intronic
1070062756 10:73000941-73000963 CACTTTAGATCTAGAGACACAGG - Intergenic
1070725048 10:78781987-78782009 CATTGTAAATACAGAGACAAAGG - Intergenic
1071278776 10:84080411-84080433 CACTTCAAATACAAAGACCCAGG - Intergenic
1072045879 10:91654457-91654479 CACTTTAAATATAAAGACACAGG - Intergenic
1073174349 10:101543399-101543421 CATTTTAAATATAAAGACACAGG - Intronic
1073899316 10:108201577-108201599 CCATGTAAACACAGAAACACAGG - Intergenic
1074264317 10:111886188-111886210 CACTTCCAACACAGCCACACTGG + Intergenic
1074947068 10:118290534-118290556 CACATCATACACAGAGAAACAGG + Intergenic
1075486422 10:122825487-122825509 CACTTTAAATATAAAGACACAGG - Intergenic
1075855140 10:125623458-125623480 CACATTTAGCACAGAAACACTGG + Intronic
1076801363 10:132831614-132831636 CACTTTAAATACAAAGAAAATGG - Intronic
1078798667 11:14620593-14620615 CTCTGTAAAGACAGAGATACTGG + Intronic
1078802074 11:14656611-14656633 TAATTTATACACAGAGAAACTGG - Intronic
1079017401 11:16880975-16880997 AACTGCAAACACAGAGACAGAGG + Intronic
1081108844 11:39106716-39106738 AAATTTGAACACAGAGACACAGG - Intergenic
1081216860 11:40410922-40410944 CACTTTAAAAAAAGACACAGAGG - Intronic
1082022240 11:47544409-47544431 CACTTTAAAGACAGGAAAACAGG + Intronic
1083979415 11:66153919-66153941 CACTTTAAACACAGAGACACAGG + Intronic
1083993853 11:66262557-66262579 CACTCTGTACACAGGGACACAGG + Intronic
1084686858 11:70701280-70701302 AACTTTAAACAAAGAGAAAAAGG + Intronic
1086408772 11:86522574-86522596 CAGTGAAAACACACAGACACAGG - Intronic
1087018177 11:93574917-93574939 CAATGTAAACACATGGACACAGG + Intergenic
1087694828 11:101364673-101364695 CAATCTGAACACATAGACACAGG - Intergenic
1087698669 11:101411515-101411537 CTCTTTAAAGTCAGAGACAAGGG - Intergenic
1087948143 11:104190123-104190145 CATTTTAAAAACACAGAAACAGG - Intergenic
1088637995 11:111842955-111842977 GTTTTTAAAAACAGAGACACAGG + Intronic
1090586932 11:128223090-128223112 CAATGTGAACACATAGACACAGG - Intergenic
1092969245 12:13676136-13676158 CAATGTGAACACATAGACACAGG + Intronic
1096161568 12:49382786-49382808 CACTTGAACCAGGGAGACACAGG - Intronic
1096399755 12:51296060-51296082 AACTTAGAACACAGAGAGACAGG - Intronic
1097353796 12:58578318-58578340 CAATGTGAACACATAGACACAGG - Intronic
1097449950 12:59725081-59725103 AAATTTAATCACAGAGATACTGG + Intronic
1098303258 12:69076116-69076138 CCCTTAACACACACAGACACTGG - Intergenic
1098573840 12:72018329-72018351 CACATTAACCAAAGACACACTGG + Intronic
1098786609 12:74766095-74766117 CACTTGAAGCACAGAGAGAGAGG - Intergenic
1099664316 12:85608276-85608298 AAATTTAGACATAGAGACACAGG - Intergenic
1099668901 12:85665206-85665228 CACTTAGAACTCAGAGAAACAGG - Intergenic
1100460870 12:94798109-94798131 CACCTTGACCACAGAGACAAAGG - Intergenic
1101002205 12:100367890-100367912 TACATTATACACAGAGATACAGG - Intronic
1101609159 12:106274646-106274668 CTCTTGAAACACAGAGAGAGTGG + Intronic
1101843942 12:108346672-108346694 CATTTCACACACACAGACACAGG + Intergenic
1102524011 12:113498317-113498339 CACGTCAAAGACAGACACACAGG - Intergenic
1102922372 12:116801515-116801537 CATTTTAAAGACAGAGAAACTGG - Intronic
1103438058 12:120942216-120942238 TAATTTAAACACAGTGGCACAGG + Intergenic
1104200929 12:126588115-126588137 AACATTAAACACAGAGAGAAAGG + Intergenic
1104241129 12:126990605-126990627 CTCTTTATCCCCAGAGACACTGG - Intergenic
1104327679 12:127815374-127815396 CACTTTAAACAGGAAGACTCAGG + Intergenic
1104594898 12:130114300-130114322 CACTTTACACACATGGACTCAGG - Intergenic
1105312259 13:19222849-19222871 CACTTCAAACGCAGAGGCAGAGG + Intergenic
1105363850 13:19746316-19746338 CACTTGAAACACAGAGGCAGAGG + Intronic
1105671451 13:22621596-22621618 CTCTTTAAATATAAAGACACAGG - Intergenic
1105885787 13:24639834-24639856 CAATTTAGACACAGAGGCCCAGG - Intergenic
1106010152 13:25813011-25813033 CAGTGTGAACACATAGACACAGG + Intronic
1108714398 13:53064563-53064585 AAATTTCAACACAGAGACATGGG - Intergenic
1108957104 13:56173058-56173080 CACTTTAAAAAGAGTGATACAGG + Intergenic
1109838647 13:67893054-67893076 CAATGAAAACACATAGACACAGG + Intergenic
1110169429 13:72483367-72483389 CATTTCAAACACAGAGAAAAGGG - Intergenic
1110383325 13:74879166-74879188 AACTTTGGACACAGACACACAGG - Intergenic
1111073595 13:83202879-83202901 CACTTTAAAGCCAGATACTCAGG - Intergenic
1111183639 13:84700269-84700291 CAATGTGAACACATAGACACAGG + Intergenic
1111551135 13:89814335-89814357 AAATTTAGACACAGACACACAGG + Intergenic
1111893083 13:94107312-94107334 AACTTTAAAAACAGAGACTCCGG - Intronic
1112609368 13:100940873-100940895 CAATTTAGACAAAGAGAGACTGG - Intergenic
1113754275 13:112798927-112798949 CACTTTAAATATAAAAACACGGG + Intronic
1114998640 14:28392894-28392916 CAATGTAAACAGAGAGATACTGG - Intergenic
1115735651 14:36326063-36326085 CACTTTAAATATAAAGACAGAGG + Intergenic
1115758999 14:36559232-36559254 CACTTGAACCACAGAGTCAGAGG - Intergenic
1116088051 14:40266733-40266755 CAATGAAAACACATAGACACAGG + Intergenic
1118737550 14:68712914-68712936 CACTTTACAGATAGAGAAACTGG - Intronic
1119525167 14:75317156-75317178 CATTTTAAACACACAGAGGCTGG - Intergenic
1120825092 14:88947680-88947702 CACATTAAAGACACAGAAACTGG - Intergenic
1121313322 14:92946747-92946769 CACATTACACACAGGGAAACCGG + Intronic
1121754832 14:96393610-96393632 AAGTTTTGACACAGAGACACAGG - Intronic
1122120950 14:99553070-99553092 CTCTGTAATCACAGAAACACTGG + Intronic
1123584094 15:21741886-21741908 CACTCCAAATACAGAGCCACTGG + Intergenic
1123620744 15:22184489-22184511 CACTCCAAATACAGAGCCACTGG + Intergenic
1123754864 15:23389312-23389334 AGCTTAAAACACAGATACACTGG - Intergenic
1124167923 15:27345077-27345099 CATTTTAAACATAAAGACTCAGG - Intronic
1124346537 15:28926057-28926079 TACTTTAAATGCAGAGACACTGG - Intronic
1124378971 15:29148792-29148814 CACTTTAAAAACACAGAAAAGGG - Intronic
1124682233 15:31742731-31742753 CACTTTAAATATAAAGACATAGG + Intronic
1124712294 15:32024529-32024551 AAATTTGAACACAGACACACAGG + Intergenic
1124895605 15:33773942-33773964 CACTTTAACCTCAGAAACTCTGG - Intronic
1125071109 15:35554174-35554196 CACTTTAAATATCAAGACACAGG + Intergenic
1125363871 15:38892965-38892987 CACTGTGAACACATAGACACAGG + Intergenic
1125368552 15:38945584-38945606 CACTGTACTCACTGAGACACAGG + Intergenic
1125450528 15:39802140-39802162 TACTGCAAACACAGGGACACTGG + Exonic
1127726821 15:61758510-61758532 CTTTTTAAACACAGAAACAAGGG + Intergenic
1127932956 15:63609488-63609510 CACTTTACACACACAGGCACTGG - Intronic
1128462818 15:67884224-67884246 CACTTTAAAGATAGGGACGCAGG - Intergenic
1128569318 15:68722079-68722101 CTCTTTGAAGATAGAGACACAGG + Intronic
1130299758 15:82671197-82671219 CACTTGAACCACAGAGGCAGAGG + Intronic
1130830042 15:87590045-87590067 CTATTTACACAAAGAGACACTGG - Intergenic
1132391637 15:101443420-101443442 CACTTTAAATACAGCAAGACAGG - Intronic
1133042886 16:3069888-3069910 CACTTGAACCAGAGAGACAGAGG - Intronic
1133547753 16:6824320-6824342 CACTTGAACCAGAGAGGCACAGG + Intronic
1134161499 16:11893764-11893786 CACTTCAACCACAGAGACCTGGG + Intronic
1135133861 16:19873514-19873536 AACTTTAAAGACACAGCCACAGG + Intronic
1135823837 16:25708752-25708774 AACTTTTGACACAGATACACAGG - Intronic
1136870454 16:33802890-33802912 ACCTGCAAACACAGAGACACTGG - Intergenic
1137063809 16:35815598-35815620 CACACTAATCACAGAGTCACCGG + Intergenic
1137384730 16:48030763-48030785 CCCTTTCAACACAGAGGCAGAGG - Intergenic
1138728044 16:59162423-59162445 TAGTATAAACACAGAGAGACTGG - Intergenic
1139001716 16:62518868-62518890 CAATGAGAACACAGAGACACAGG - Intergenic
1140219774 16:73035267-73035289 CACATTAAACAATGAGAAACAGG - Intronic
1140301539 16:73762773-73762795 CAGTGTGAACACATAGACACAGG + Intergenic
1140467618 16:75195160-75195182 CATTTTAAATATAAAGACACAGG + Intergenic
1203101718 16_KI270728v1_random:1313160-1313182 ACCTGCAAACACAGAGACACTGG + Intergenic
1143040144 17:4028675-4028697 CACTTTAAATGTAAAGACACAGG + Intronic
1143075399 17:4338353-4338375 AATTTTAAACACAGATACAATGG + Intronic
1144211565 17:13019894-13019916 CACTTGAACCCCAGAGACAGAGG + Intergenic
1144469921 17:15529725-15529747 CACTTTAGATTCAAAGACACAGG - Intronic
1144623351 17:16832120-16832142 CACTTTACAAACAGGGAGACTGG - Intergenic
1144883081 17:18440596-18440618 CACTTTACAAACAGGGAGACTGG + Intergenic
1144926420 17:18813920-18813942 CACTTTAGATTCAAAGACACAGG + Intergenic
1145149150 17:20503790-20503812 CACTTTACAAACAGGGAGACTGG - Intergenic
1146557771 17:33841574-33841596 CACTTTACACAGTGAGAAACAGG + Intronic
1147481080 17:40763569-40763591 CACTTCAAACATAGTGACACAGG - Intergenic
1147577675 17:41612057-41612079 CACTTTACAAACAGGGAGACTGG - Intronic
1148227646 17:45910130-45910152 CACTGGAAACACACAGGCACGGG + Intronic
1149021826 17:51975928-51975950 TTCTTTAAACACAAAGACACAGG + Intronic
1149198595 17:54154674-54154696 CACTGAGAACACAGGGACACAGG + Intergenic
1149524381 17:57343052-57343074 GATTTTAAAAAAAGAGACACGGG + Intronic
1153066112 18:1046774-1046796 CAATGAAAACACATAGACACAGG - Intergenic
1153752441 18:8246793-8246815 CACTTTAAAAATATAAACACAGG + Intronic
1154114798 18:11603799-11603821 CACTTTAAATACGAAGATACAGG + Intergenic
1154324815 18:13382262-13382284 CACTGTAAAAACAGATACATGGG - Intronic
1156118072 18:33811217-33811239 CACTTTAAATATAAAGACACAGG + Intergenic
1156946056 18:42832968-42832990 CACTTGAACCCCAGAGACAGAGG + Intronic
1157126509 18:44961164-44961186 CACCTTAAACACAGAGGCAGAGG + Intronic
1158752231 18:60275325-60275347 CACTTGAACCACGGAGACAGAGG - Intergenic
1159589584 18:70318850-70318872 CACTTGAAACTGAGAGACAGAGG + Intronic
1159823538 18:73176845-73176867 CACTTTAAACAAAAGGAAACTGG - Intronic
1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG + Intronic
1162490781 19:10990235-10990257 CACTTGAACCACAGAGGCAGAGG - Intronic
1163935186 19:20436075-20436097 GGCTTTAGACACAAAGACACAGG - Intergenic
1164434994 19:28221385-28221407 CATCTTAATTACAGAGACACTGG - Intergenic
1164512320 19:28907664-28907686 TACTTTAAACAAAGAGCCGCTGG + Intergenic
1164537110 19:29093990-29094012 CACTTTAACTCCAGAGGCACTGG - Intergenic
1165145469 19:33727377-33727399 CACTCTACACACACAGACACGGG - Intronic
1165281319 19:34800373-34800395 CACTTTAAATATAAAGATACTGG - Intergenic
1167388172 19:49176936-49176958 CACTTTCCACAGAGAGAAACTGG - Intronic
925284749 2:2708625-2708647 CACTTTACACACACAGAGCCTGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926348975 2:11978086-11978108 TAATTTAATTACAGAGACACAGG + Intergenic
926725312 2:15993131-15993153 GAGTTGAAACACTGAGACACAGG - Intergenic
927399279 2:22692143-22692165 CACTGTAGACACAAAGCCACAGG - Intergenic
929102367 2:38328006-38328028 CACTTTACAAAGACAGACACAGG + Intronic
930213288 2:48666171-48666193 CACTTTAAATACAATGACACAGG - Intronic
931099808 2:58984580-58984602 CCCTTTAAACACAAGGAGACAGG + Intergenic
932342248 2:70972356-70972378 CACTTTAGATTCAAAGACACAGG - Intronic
932508927 2:72265447-72265469 CAATGAAAACACAGGGACACAGG - Intronic
933161858 2:79033986-79034008 CAATTGAAACACATGGACACAGG + Intergenic
933408427 2:81893225-81893247 CAGTTTAAAAACAGAAAAACAGG + Intergenic
935233184 2:101117034-101117056 CACTGAAGACACAGACACACAGG + Intronic
935870884 2:107447972-107447994 CACTTTAAATATAAAGGCACAGG + Intergenic
936275536 2:111093562-111093584 CACTTTAAAAACATAAATACTGG + Intronic
936782164 2:116047428-116047450 AAAGTTAAAAACAGAGACACAGG - Intergenic
936793412 2:116178700-116178722 CACTTTAAACATAAGGACACAGG + Intergenic
937730856 2:125227062-125227084 CATTTTAAACAAAGACAAACAGG + Intergenic
937897654 2:126990750-126990772 CACTTGCAACACATACACACAGG + Intergenic
939555704 2:143670267-143670289 CACTAGAAATACAGAGAAACAGG - Intronic
940429691 2:153575436-153575458 CACCTTGAAGAGAGAGACACAGG - Intergenic
941030403 2:160504637-160504659 CACTTTAAGCAAAGAGCCAATGG + Intergenic
941101701 2:161303638-161303660 CACTTTAGATTCAGTGACACAGG - Intergenic
941501954 2:166290110-166290132 CAATTTGAACACATGGACACAGG - Intronic
943420864 2:187667461-187667483 CACTTTAACCAGAGAGGCAGAGG + Intergenic
943448752 2:188021565-188021587 CACTACAAACACACAGGCACAGG + Intergenic
943614370 2:190075715-190075737 CACTTTAAAAATAAAGACACAGG - Intronic
945327950 2:208504958-208504980 CAATGTGAACACATAGACACAGG - Intronic
946922518 2:224594550-224594572 CACTTGAACCACAGAGGCAGAGG - Intergenic
947320221 2:228908873-228908895 CAATGTGAACACATAGACACAGG - Intronic
1168862386 20:1055106-1055128 CACTTAAAACACAGACTCCCAGG - Intergenic
1169482222 20:5994637-5994659 CACTGTAATCACAGTGACTCAGG + Exonic
1171913643 20:30991254-30991276 CAATGAAAACACATAGACACAGG + Intergenic
1172086970 20:32393349-32393371 CACTTTAAACATAAAGACACAGG - Intronic
1172254616 20:33506337-33506359 TACAATACACACAGAGACACAGG + Intronic
1173382849 20:42561514-42561536 AACTTTAAACACAGCTTCACAGG - Intronic
1174542207 20:51298399-51298421 CTCTTTGAAAACAGAAACACTGG + Intergenic
1174813810 20:53669715-53669737 CACTTGAAACCCAGAGGCAGAGG - Intergenic
1177386515 21:20416485-20416507 CACTGTAAAAATATAGACACTGG + Intergenic
1177412190 21:20743747-20743769 AACTTTAAACACTGAGAAACTGG - Intergenic
1178205859 21:30464198-30464220 CACTTTTAGCACAGAGAAAGTGG + Intergenic
1178405125 21:32317300-32317322 CTCTTTAAACACAGGGAATCAGG + Intronic
1179059120 21:37963513-37963535 CAATGAAAACACAGGGACACAGG - Intronic
1180757617 22:18173602-18173624 AAGTTTAAACACAGGGACAAGGG + Intronic
1181074157 22:20363843-20363865 AAGTTTAAACACAGGGACAAGGG - Intronic
1181431939 22:22887196-22887218 CACCTGTAAAACAGAGACACTGG + Intronic
1182307052 22:29377254-29377276 CACTTTACAGACAGGGAAACAGG + Intronic
1184365205 22:44046761-44046783 AACTTTGAACACAGAGACACTGG - Intronic
949559713 3:5189682-5189704 CACTTTAACCACAGAGGCGGAGG - Intronic
950293787 3:11810065-11810087 CATTTCAAACACAGGGAGACTGG + Intronic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
950555912 3:13695959-13695981 CACCTTGAACTCAGAGACAGAGG - Intergenic
952511489 3:34061286-34061308 CACTGAAAACACATGGACACAGG + Intergenic
952639525 3:35576952-35576974 CACTTGAACCCCAGAGACAGAGG - Intergenic
954032870 3:47832519-47832541 GACATTAAACACAGAGAGAATGG - Intronic
956687060 3:71839882-71839904 CATTTTAAAGATAGAGAAACAGG + Intergenic
957417666 3:79927878-79927900 CAATGTGAACACATAGACACAGG - Intergenic
957637746 3:82808348-82808370 CAATGTAATCATAGAGACACTGG + Intergenic
958195763 3:90240347-90240369 CACTTGAAATACAAACACACTGG + Intergenic
960825060 3:121773700-121773722 CACTTTAAAAAAAGAAAAACAGG + Intronic
960959209 3:123057344-123057366 CACTCCAAAGACAGAGCCACTGG + Intergenic
961070270 3:123917535-123917557 CAATTTAAACAAAGATACAAAGG + Intronic
961724664 3:128919282-128919304 AACTTTCAACACAAAGATACAGG + Intronic
964701158 3:159569098-159569120 CATTTAAAACACAGGGACTCAGG - Intronic
964968315 3:162526782-162526804 CACTTGAACCACAGACACAAAGG - Intergenic
965526050 3:169719481-169719503 CAATGTGAACACACAGACACAGG - Intergenic
967746284 3:193059575-193059597 CAGTTTAAAGACAGAGAGAAAGG - Intergenic
968216575 3:196896746-196896768 TACTTTACAAATAGAGACACTGG - Intronic
968618230 4:1591948-1591970 GACTTTAAATACAGTGAAACGGG + Intergenic
969195774 4:5562766-5562788 CATTATAAACACACAAACACCGG + Exonic
970455390 4:16218319-16218341 CACTTGAAACCCAGAGGCAGAGG + Intronic
970608052 4:17700283-17700305 CACTTTTAATAGAAAGACACAGG + Intronic
970716070 4:18924751-18924773 CACTTTAAAAATGAAGACACAGG + Intergenic
971835273 4:31755272-31755294 CAGTTTAAACACACAGAAAAAGG + Intergenic
972121544 4:35710272-35710294 CACTACAAAGACTGAGACACAGG - Intergenic
973062462 4:45744629-45744651 CAATGTGAACACATAGACACAGG - Intergenic
973264632 4:48198932-48198954 TACCTTAAAAACAGAGACAATGG - Intronic
973677434 4:53279423-53279445 CACTTTTAAGAAAGAGAAACAGG + Intronic
973864799 4:55101692-55101714 CAATGTGAACACATAGACACAGG - Intronic
973995036 4:56450118-56450140 CACTGAAAACACATGGACACAGG + Intronic
974561523 4:63528422-63528444 CACTCTAAACCCAAAAACACGGG + Intergenic
975490407 4:74982241-74982263 CAATGTGAACACATAGACACAGG + Intronic
978058328 4:104302601-104302623 CACTTTTAACATACAGACTCAGG + Intergenic
978076708 4:104540036-104540058 CAGTGAGAACACAGAGACACAGG - Intergenic
978623565 4:110659114-110659136 GACTTGAGACACAGAGACACAGG + Intergenic
979713574 4:123809831-123809853 CACTTGAACCCCGGAGACACAGG + Intergenic
980769843 4:137356830-137356852 CAATGAAAACACATAGACACAGG + Intergenic
980861777 4:138507624-138507646 TACTTCAAACACAGAAAAACCGG - Intergenic
982338086 4:154262108-154262130 CACTTTCTACTCAGTGACACGGG - Intronic
984472278 4:180191689-180191711 GACTCTAAACAGAGAGAAACTGG + Intergenic
984896197 4:184542572-184542594 CACTTTAAAGAAACAGACACTGG + Intergenic
985172165 4:187162987-187163009 AAATTTGAACACAGACACACAGG - Intergenic
985779601 5:1863329-1863351 CACTTTCAACACTGCCACACTGG - Intergenic
986349029 5:6859753-6859775 GAGATTCAACACAGAGACACAGG - Intergenic
986349667 5:6866095-6866117 AAATTTGGACACAGAGACACAGG + Intergenic
986530323 5:8730330-8730352 GACATTACACACAGACACACAGG - Intergenic
986954339 5:13132890-13132912 CACTTGAACCTCAGAGACAGAGG - Intergenic
987571243 5:19663019-19663041 CACATTAAACTCTGAGAAACTGG + Intronic
987703898 5:21438358-21438380 CACTTTACCCACAGAGGCAGAGG - Intergenic
987960429 5:24801204-24801226 CACTTTAAATATAAAGAAACAGG - Intergenic
988406554 5:30831147-30831169 CACTATTAACAGAGAGACTCAGG + Intergenic
988695211 5:33615091-33615113 CACCTTAAACATAGAGGCATTGG + Intronic
989722044 5:44540599-44540621 GACTTTAAGCACACAGACTCAGG - Intergenic
989785531 5:45323758-45323780 CAATGAGAACACAGAGACACAGG - Intronic
990077626 5:51870764-51870786 AACTTTAAATATAAAGACACAGG - Intergenic
990478703 5:56186453-56186475 CATTTTAAAGACAAAGAAACTGG - Intronic
990582597 5:57179896-57179918 CAATTCAAAAACAGAGACAAGGG - Intronic
990738934 5:58892836-58892858 CAATGTGAACACATAGACACAGG + Intergenic
990963421 5:61418680-61418702 TACTTTAAGGACAGAGACAAGGG + Intronic
994640711 5:102406236-102406258 CAGTCTAAACATAAAGACACAGG + Intronic
996272312 5:121621398-121621420 CACTTTAAACAAAGATATATGGG - Intergenic
996683225 5:126250887-126250909 AAATTCAGACACAGAGACACAGG - Intergenic
997486813 5:134237987-134238009 CACTTGAAACCCAGAGGCAGAGG - Intergenic
998926718 5:147134765-147134787 CACATTAAATATAAAGACACAGG - Intergenic
999043962 5:148447634-148447656 CCTTTTAAACACAGAAACAGAGG + Intergenic
999071264 5:148746101-148746123 CAATGTGAACACACAGACACAGG - Intergenic
999554889 5:152729636-152729658 AACTTTAAGCAAAGAGATACAGG + Intergenic
1000174642 5:158739365-158739387 CACTTTAAACACAGTAACAGGGG - Intronic
1000695329 5:164373861-164373883 CACACTAAACACACACACACAGG - Intergenic
1001006979 5:168060803-168060825 CATTTTACACATAGAGAAACTGG + Intronic
1001348921 5:170937015-170937037 CACTTTAAATATAAAGACACAGG - Intronic
1004739293 6:18441863-18441885 AATTTTGAACACTGAGACACAGG - Intronic
1004983619 6:21055565-21055587 CAATGTGAACACACAGACACAGG - Intronic
1005238568 6:23795603-23795625 CAATGAAAACACACAGACACAGG + Intergenic
1008780427 6:55096754-55096776 CACTTAAAAATCAGAGAAACTGG - Intergenic
1009346700 6:62621557-62621579 CAATGTGAACACATAGACACAGG + Intergenic
1009528390 6:64777463-64777485 CACTATAAACACAGAAAAATAGG - Intronic
1010294387 6:74179374-74179396 CAATGTGAACACATAGACACAGG + Intergenic
1011319200 6:86071355-86071377 CATTTTGAACACATGGACACAGG - Intergenic
1011493883 6:87920031-87920053 CATTTGAGACACAGAGACGCGGG - Intergenic
1012125595 6:95424395-95424417 CTCTTTAAGAACAGAGACATAGG + Intergenic
1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG + Intergenic
1012942016 6:105425610-105425632 CAATGTGAACACATAGACACAGG + Intergenic
1013409599 6:109872212-109872234 CAATGATAACACAGAGACACAGG - Intergenic
1014362337 6:120494916-120494938 CACTTGAACCAGAGAGACAGAGG + Intergenic
1014837547 6:126176684-126176706 CACTTTAAAAAGAGAGAAAGAGG + Intergenic
1016024075 6:139267737-139267759 CACTTTAAATATAAAGACCCAGG + Intronic
1016184496 6:141182458-141182480 CAATGAAAACACAGGGACACAGG + Intergenic
1016256461 6:142111273-142111295 CACTGAAATCACTGAGACACAGG + Intergenic
1016266168 6:142234699-142234721 CACTTGAACCTGAGAGACACAGG - Intergenic
1016392553 6:143589606-143589628 AAATTTGGACACAGAGACACCGG - Intronic
1018389199 6:163329884-163329906 CATTTTACAGACAGAGAAACTGG - Intergenic
1018475342 6:164134968-164134990 CACTTGAATCCCAGAGACAGAGG - Intergenic
1019265347 7:113208-113230 CACTTGAAGAACAGAGACACAGG - Intergenic
1019757375 7:2782762-2782784 CACGTTTAACACTGAGTCACAGG - Intronic
1019954641 7:4403706-4403728 AAATTTTAACACAGAGACCCTGG + Intergenic
1021182817 7:17528155-17528177 CACTTTATACTCAAAGCCACTGG + Intergenic
1021531702 7:21653723-21653745 TACTTTAAACACAGATAGAGCGG - Intronic
1024370836 7:48582102-48582124 TAATTGAGACACAGAGACACAGG + Intronic
1027548887 7:79565822-79565844 CTCTATAAACACAGGAACACTGG - Intergenic
1027568885 7:79836254-79836276 CATTTTAAACATAAAGGCACAGG + Intergenic
1027944605 7:84728840-84728862 CATTTTGAACACATGGACACAGG + Intergenic
1028381130 7:90199744-90199766 AACTTTAATAAAAGAGACACTGG - Intronic
1029964654 7:104726526-104726548 CAATGTGAACACATAGACACAGG - Intronic
1030318356 7:108139332-108139354 GTCTGTAAACACAGTGACACTGG + Intergenic
1030573558 7:111257975-111257997 CAATGAAAACACATAGACACAGG - Intronic
1030920664 7:115381539-115381561 AACTTTAAATACACAAACACAGG - Intergenic
1031128597 7:117804717-117804739 CAATGTCAACACATAGACACAGG + Intronic
1031930897 7:127684822-127684844 CACCTTAAGCACACAGACCCTGG - Intronic
1032955174 7:136962214-136962236 CACTTGAACCTCAGAGACAGAGG - Intronic
1035655176 8:1300099-1300121 CACTTCAAACACAGCCACACTGG + Intergenic
1036394627 8:8358719-8358741 CACACTGAACAAAGAGACACAGG + Intronic
1036679176 8:10858274-10858296 CACGTTACAGACAGAGCCACTGG + Intergenic
1037639395 8:20729139-20729161 CATTTTAAAGACAGAGAAAATGG - Intergenic
1038283383 8:26185617-26185639 CACTCTAGATACAGAGATACAGG + Intergenic
1039519216 8:38156267-38156289 CACTTTTCACAGAGAGAGACAGG - Intergenic
1039718017 8:40132201-40132223 AATTTTAGACACAGACACACCGG - Intergenic
1040096745 8:43452527-43452549 AATTTTAAAGACAGAGTCACTGG + Intergenic
1042395162 8:68283563-68283585 CACTTTAAATTCAATGACACGGG - Intergenic
1043667048 8:82827418-82827440 AACTTTCAAAACAGAAACACTGG - Intergenic
1043796055 8:84541933-84541955 CACTTTAAATATTAAGACACAGG - Intronic
1045222418 8:100212216-100212238 GATTTTAAGCACAGAGACAGAGG - Intronic
1045517274 8:102871053-102871075 CACTTGAAACCCAGAGGCAGAGG + Intronic
1045546902 8:103137927-103137949 AACTTTAAACTCAGAGAGTCAGG + Intronic
1046751047 8:117926861-117926883 ACCTTTAAACCAAGAGACACTGG - Intronic
1046996051 8:120524572-120524594 CACTATAAACAAAAAGACAAAGG - Intronic
1047306309 8:123655681-123655703 CACTCTAATAAGAGAGACACAGG - Intergenic
1047919306 8:129617433-129617455 GACTTTAAAGACAGAGGAACAGG + Intergenic
1048492787 8:134910132-134910154 CACTTTACAGATAGAGAAACAGG - Intergenic
1050218313 9:3355319-3355341 CACTTTAAATATACAGAAACAGG + Intronic
1051253987 9:15192913-15192935 CTCTTTAAGCCCAGAAACACTGG - Intronic
1054153073 9:61620951-61620973 CAATTTAAACACAAGGAAACAGG + Intergenic
1056878781 9:90367774-90367796 CACTTTAAACACAAAAACCCAGG + Intergenic
1056968691 9:91185117-91185139 CACTTTAAAAACACAAACACTGG + Intergenic
1059281773 9:113140504-113140526 CAGTCTAATCTCAGAGACACTGG + Intergenic
1059307870 9:113368776-113368798 CACTTTACACACACTGACTCAGG + Intronic
1059648348 9:116289623-116289645 CACTTTATACAGAGAAGCACAGG + Intronic
1059784148 9:117562324-117562346 CACTCTTAACACAAAGACACTGG + Intergenic
1185496238 X:556400-556422 AACGTTCAACACAGAGAAACAGG + Intergenic
1185956838 X:4500308-4500330 CACTTCAAACACTGTGACATAGG + Intergenic
1186031274 X:5371991-5372013 GATTTTAAAAAGAGAGACACAGG - Intergenic
1187089214 X:16077015-16077037 CACTTGAAATAAAGACACACAGG - Intergenic
1187623363 X:21083611-21083633 TCCTTTAAAAACAGAGACTCTGG - Intergenic
1187719042 X:22132602-22132624 AACTGTTAACACAGAGAAACGGG - Intronic
1187755612 X:22522496-22522518 CTCTTTAAATGCAAAGACACTGG + Intergenic
1188567615 X:31544517-31544539 CTCTGAAAACACAGGGACACAGG + Intronic
1188714439 X:33443802-33443824 CAATGAAAACACATAGACACAGG + Intergenic
1189688078 X:43586676-43586698 TACTTCAAACACAGGGACAAGGG + Intergenic
1191235421 X:58130125-58130147 TATTTTAAAAATAGAGACACAGG + Intergenic
1191240694 X:58187869-58187891 CATTCTAAAGATAGAGACACTGG + Intergenic
1191749281 X:64523914-64523936 CAATGTAAACACATGGACACAGG + Intergenic
1192310594 X:70010487-70010509 CACTTTAAATATAAAGACACAGG - Intronic
1192436485 X:71146418-71146440 CACAGTCAACACATAGACACAGG - Intronic
1194242846 X:91472980-91473002 CATTTTAAATCCAGAAACACAGG - Intergenic
1195799412 X:108690172-108690194 CATTTTATACACAAAGAGACTGG + Intronic
1195951135 X:110274611-110274633 CACTTTAAGGATAAAGACACAGG - Intronic
1196078243 X:111601410-111601432 AACTTTAAACATAGAACCACAGG - Intergenic
1196166807 X:112544247-112544269 CAAGTTAAACAGAGAGTCACTGG + Intergenic
1197261774 X:124327584-124327606 CATTTTACAGACAGAGGCACTGG - Intronic
1201704591 Y:16922199-16922221 CAATGAGAACACAGAGACACAGG - Intergenic
1202047932 Y:20753021-20753043 CACTTGAAGCACAGAGAAAAGGG - Intergenic
1202102642 Y:21326658-21326680 CACTTTAAGCACAGAGAGTTAGG + Intergenic
1202184415 Y:22170036-22170058 CACTTCACACACACACACACTGG + Intronic
1202206945 Y:22416365-22416387 CACTTCACACACACACACACTGG - Intronic