ID: 1083986730

View in Genome Browser
Species Human (GRCh38)
Location 11:66220515-66220537
Sequence CTCTGGCATGTCCCTTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083986724_1083986730 30 Left 1083986724 11:66220462-66220484 CCCTCAGGCTGGATCATGGAAAT 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1083986730 11:66220515-66220537 CTCTGGCATGTCCCTTAAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1083986725_1083986730 29 Left 1083986725 11:66220463-66220485 CCTCAGGCTGGATCATGGAAATG 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1083986730 11:66220515-66220537 CTCTGGCATGTCCCTTAAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1083986728_1083986730 -8 Left 1083986728 11:66220500-66220522 CCAGCCAGTGTGAAGCTCTGGCA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1083986730 11:66220515-66220537 CTCTGGCATGTCCCTTAAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083986730 Original CRISPR CTCTGGCATGTCCCTTAAGC AGG Intronic
902719837 1:18296590-18296612 CTCTGACCTTTCCCTGAAGCAGG - Intronic
909447386 1:75762919-75762941 CTCTGTTATGTCTCTTAAGCAGG + Intronic
909603164 1:77481673-77481695 CTCTGGCTTGTGCTTTATGCTGG - Intronic
912145870 1:106793832-106793854 CTCTGAAATGCCCCTTCAGCTGG + Intergenic
915981172 1:160420739-160420761 CTATGGCATGTCCCCTGATCTGG + Intronic
919972106 1:202587712-202587734 CCCTTGCATGTCCCTTATTCAGG - Exonic
920657630 1:207888224-207888246 CTCTGGCCTGTCCCCTACCCTGG - Intronic
923715643 1:236422780-236422802 CTCTGGCATGTTCCATCTGCAGG - Intronic
1063994854 10:11610425-11610447 CTCTGGCAAGTTCCTTCAGGGGG - Intronic
1065000840 10:21336417-21336439 GTCTAGCCTGTCCCTTAATCGGG - Intergenic
1067539836 10:47143503-47143525 CTCAGGCAGGTCCCTGAAGAGGG + Intergenic
1071733681 10:88274031-88274053 TTTTGGCATTTCCCTTAAACAGG + Intronic
1071892557 10:90027303-90027325 CTCTGGTAGATTCCTTAAGCAGG - Intergenic
1077433152 11:2526043-2526065 CGCTGGCAGGACCCTCAAGCTGG + Intronic
1078568749 11:12439552-12439574 CCCAGGCCTGTCCCTTCAGCTGG - Intronic
1083011885 11:59409428-59409450 CTCTGGAATGTCTCTTCAACTGG + Intergenic
1083986730 11:66220515-66220537 CTCTGGCATGTCCCTTAAGCAGG + Intronic
1085766860 11:79290990-79291012 CCCTGGCATGTCTCTTCAGGAGG - Intronic
1087212399 11:95457383-95457405 TGCTGGCATGTCATTTAAGCAGG - Intergenic
1090643673 11:128750126-128750148 CTCTGGCATATCCATTACCCAGG - Intronic
1090969094 11:131624171-131624193 CTCTGGCAGGTCCCTTAGTGCGG + Intronic
1091337660 11:134784527-134784549 CTCTGCCTTGTCCATGAAGCTGG - Intergenic
1091920085 12:4297123-4297145 CTGTGGAATGTCCCTTAGGCAGG - Intronic
1102850443 12:116239063-116239085 CTGTGGCATGTCACTCAGGCTGG - Intronic
1103592971 12:122005374-122005396 CTATGGCAGGTTCATTAAGCTGG + Intergenic
1104762269 12:131304581-131304603 CTCTCCCATGGCCCCTAAGCAGG - Intergenic
1104817507 12:131656215-131656237 CTCTCCCATGGCCCCTAAGCAGG + Intergenic
1108434126 13:50385078-50385100 CTTTGGCATCTCCCTTTTGCAGG - Intronic
1109798537 13:67345885-67345907 CTCTTACATGTTCCTGAAGCAGG - Intergenic
1113433447 13:110269962-110269984 TTCTGGCATCTCCCTAAATCAGG - Intronic
1119197193 14:72725739-72725761 CTCTGGCCTGTCCTCAAAGCAGG + Intronic
1121333086 14:93060099-93060121 CCCAGGCATGTCACTGAAGCAGG - Intronic
1121373244 14:93380367-93380389 CTCTGACATGACCCTTAATCTGG - Intronic
1129757789 15:78108959-78108981 CCCAGGCATGACCTTTAAGCAGG - Intronic
1133022997 16:2975036-2975058 CTCCGGCAAGGCCCTTAATCTGG + Intronic
1138615539 16:58162692-58162714 CTGTGGCATGGCCCTGCAGCTGG + Intronic
1146088616 17:29853550-29853572 CTTTTGCATGTCCCTTTGGCAGG + Intronic
1148187266 17:45653733-45653755 ATCTGGTTTGTCCCTCAAGCAGG - Intergenic
1150685444 17:67316937-67316959 CTGTAGCAGGTCCATTAAGCGGG + Intergenic
1150877193 17:68983368-68983390 CTCTGGCATGGGCTTTATGCAGG + Intronic
1151267447 17:72967691-72967713 CTCTGACATGTATCTTCAGCTGG + Intronic
1151323037 17:73362944-73362966 CCCCGGCATGTCCCTTAACTTGG + Intronic
1151973600 17:77471630-77471652 ATCAGGGATGTCCCCTAAGCAGG - Intronic
1152602997 17:81274512-81274534 GCCTGGTATGTCCCTTCAGCTGG - Intronic
1152925221 17:83084564-83084586 CTCTGCGATGTCCCTGAATCAGG - Intronic
1154091638 18:11369451-11369473 TTCTGGCTTTCCCCTTAAGCAGG + Intergenic
1156329910 18:36111205-36111227 GGCTGGCATGACCGTTAAGCAGG - Exonic
1157155026 18:45256893-45256915 CCCTGTGATGTCCCTTAGGCTGG + Intronic
1158312398 18:56171932-56171954 CTCTGGCAGGTCTCTAAAGCTGG - Intergenic
1159425127 18:68275328-68275350 CTCTGACAGGGCCCTTCAGCTGG - Intergenic
1165291563 19:34890097-34890119 CTCTGGCAAGGCCCTGAATCAGG - Intergenic
1165666993 19:37639857-37639879 ATCTGGCTTGTCACTTAAGTAGG - Intronic
927931897 2:27050683-27050705 CCCTGGCAGGTTCCTTCAGCTGG + Intronic
929173293 2:38953187-38953209 CTCAGGCAGGTCCCTTAGGTAGG - Exonic
929424040 2:41825981-41826003 CTCTGCCATTTCCTTTCAGCTGG - Intergenic
932104862 2:68933088-68933110 CTCTGGCAAGTCTCTTGAGATGG + Intergenic
936465722 2:112747593-112747615 TTCTGGCTTGTGCCGTAAGCAGG + Intronic
938589192 2:132720701-132720723 CCCTGGAATTTCCCTTAGGCAGG - Intronic
939374299 2:141344167-141344189 CTCTGTCATGTCCCCTTGGCTGG + Intronic
939986559 2:148834703-148834725 CTCAAGCATGTTCCTCAAGCAGG + Intergenic
944605218 2:201346464-201346486 CTTTGGCTTGTCCCTGAGGCCGG + Intronic
946558428 2:220885497-220885519 CTGTGGCATATCCCCTATGCAGG + Intergenic
1170846920 20:19969996-19970018 CTGTGGCAGGTCCCTGATGCTGG + Intronic
1174393268 20:50231282-50231304 CCCTGACATGTCCTTTCAGCTGG + Intergenic
1179789907 21:43750211-43750233 CTGTGGCATGGGCCTTAAGTGGG + Intronic
1182094896 22:27619458-27619480 CTCTGCCCTGTCCCTGAAACCGG - Intergenic
1183347815 22:37317629-37317651 CTCTACCCTGTGCCTTAAGCAGG + Intergenic
1184085547 22:42261078-42261100 TTCTGGAATGTCCATTAAGTGGG + Intronic
950668428 3:14511147-14511169 CTCTGGTATGGCCCTCATGCTGG - Exonic
952384100 3:32826790-32826812 CTCTGTCCTGTCCCTGAGGCTGG + Intronic
952817122 3:37455220-37455242 GACTGACATGTCCCTCAAGCAGG - Intronic
954211701 3:49101384-49101406 CTTTGGCATGTCCAATATGCAGG + Exonic
956707323 3:72010611-72010633 CTCTGCCATGTGCCTTAAATGGG + Intergenic
964553688 3:157912440-157912462 CTCTGGCATGTCCCTCATGGGGG - Intergenic
965347726 3:167572903-167572925 CTCAGGAATGTCCCTTGAGGTGG - Intronic
969505577 4:7585205-7585227 CTCTTGCATCTCCCTGAAGCAGG + Intronic
971706877 4:30056538-30056560 CTCTGGCATGGTCCTTATGATGG - Intergenic
972609073 4:40640552-40640574 CTCTCCCATGTCCCTCCAGCAGG - Intergenic
973152606 4:46907257-46907279 CTATGTCATTTCTCTTAAGCTGG + Intronic
976134659 4:81922508-81922530 CTCAGGCATGTCACCGAAGCTGG + Intronic
977254579 4:94726688-94726710 CTCTGACACTTCCCTTAAGGAGG - Intergenic
978736864 4:112093567-112093589 CACTGACATGTCCCCTAACCTGG + Intergenic
979547396 4:121953140-121953162 CTCTGGAATATCTCTAAAGCAGG + Intergenic
980104122 4:128570808-128570830 ATGTGGCATTTCCCTTCAGCGGG + Intergenic
980452644 4:132994812-132994834 CTCTGGCATGCACTTTAAGGGGG + Intergenic
984564130 4:181307450-181307472 TTTTGGCATGCCCCTTAAGAAGG + Intergenic
995657392 5:114442471-114442493 CTTTGGCAAGTCCCTTCACCAGG + Intronic
1005001850 6:21249475-21249497 CTCTGGAGTGTCCTTTAAGTTGG + Intergenic
1017433473 6:154393933-154393955 CTCTGACATGTTTCTTAAGTTGG - Exonic
1018420245 6:163634806-163634828 CTCTGGCAGGTCCCCGAGGCTGG + Intergenic
1019019529 6:168906342-168906364 CTCTGGCAGGGACCTTTAGCAGG + Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1023865864 7:44238163-44238185 CTCTGCCTTGTCCCCTTAGCTGG + Intronic
1023899885 7:44467515-44467537 CTCTGACTTGTCCCTTGATCTGG - Intronic
1024656847 7:51458231-51458253 CTCTGGCCTTCCCCTGAAGCAGG + Intergenic
1026646730 7:72177332-72177354 CTATGTCATGACTCTTAAGCAGG + Intronic
1030693776 7:112561416-112561438 CTCTGGTATGTGCCTAAATCTGG - Intergenic
1033034767 7:137863903-137863925 CACATGCATGTCCATTAAGCTGG + Intergenic
1033784068 7:144708788-144708810 CTCAGGCAGGTCCTTTTAGCAGG + Intronic
1035184338 7:157114003-157114025 CTCAGGGATGTCCTTTTAGCAGG + Intergenic
1036129265 8:6093160-6093182 ATCTGGCATAACCCTTCAGCTGG + Intergenic
1044477563 8:92646282-92646304 CTCTGACAAGTCCCTTCAGAAGG + Intergenic
1049195199 8:141311844-141311866 CTCTGGCCTGGCTCTGAAGCAGG + Intergenic
1049905318 9:211271-211293 CTCCAGCTTGTCCCTAAAGCAGG - Intergenic
1052956771 9:34258567-34258589 CTCTGGCCTGTCCCTTACATGGG - Intronic
1055754431 9:79542905-79542927 ATCTGGCCTGTCCCTTAACTTGG + Intergenic
1058575268 9:106394482-106394504 CTGTGGCACTTCCCTTAATCTGG - Intergenic
1058899491 9:109430157-109430179 CTCTGCCATCTCCCTGAAGTCGG + Intronic
1059149599 9:111937521-111937543 CTCCAGCATGTTCCTTAGGCTGG - Intergenic
1061221155 9:129253115-129253137 CACTGGAATGTCCTTTGAGCTGG + Intergenic
1061477536 9:130878446-130878468 CTATGGCATGTCCCCTTACCCGG + Exonic
1061775253 9:132958792-132958814 CTCTGGCATCTCAATTGAGCTGG - Intronic
1189982861 X:46528445-46528467 CTATGTCATGTCCCCTAAACAGG - Exonic
1198852632 X:140981596-140981618 CTCTGGCATATACCTAAAACTGG + Intergenic
1199532829 X:148869456-148869478 CTCTGGCATGTCCCTCCTACTGG - Intronic
1199658618 X:150023391-150023413 CTCTGGAAGGTGCCTTGAGCTGG - Intergenic
1201613296 Y:15867043-15867065 CTCTGGAAAGGCCCTTAAGAAGG + Intergenic