ID: 1083989510

View in Genome Browser
Species Human (GRCh38)
Location 11:66238199-66238221
Sequence CAGGAAGACCAGAGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 995
Summary {0: 1, 1: 0, 2: 9, 3: 96, 4: 889}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083989503_1083989510 2 Left 1083989503 11:66238174-66238196 CCCCATTCAGTACACTTCCAGAT 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989497_1083989510 10 Left 1083989497 11:66238166-66238188 CCCCCCACCCCCATTCAGTACAC 0: 1
1: 0
2: 1
3: 29
4: 347
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989500_1083989510 7 Left 1083989500 11:66238169-66238191 CCCACCCCCATTCAGTACACTTC 0: 1
1: 0
2: 0
3: 12
4: 165
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989502_1083989510 3 Left 1083989502 11:66238173-66238195 CCCCCATTCAGTACACTTCCAGA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989495_1083989510 20 Left 1083989495 11:66238156-66238178 CCTAAAGAACCCCCCCACCCCCA 0: 1
1: 0
2: 4
3: 66
4: 570
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989505_1083989510 0 Left 1083989505 11:66238176-66238198 CCATTCAGTACACTTCCAGATTC 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989501_1083989510 6 Left 1083989501 11:66238170-66238192 CCACCCCCATTCAGTACACTTCC 0: 1
1: 0
2: 2
3: 9
4: 169
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989499_1083989510 8 Left 1083989499 11:66238168-66238190 CCCCACCCCCATTCAGTACACTT 0: 1
1: 0
2: 0
3: 21
4: 239
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989496_1083989510 11 Left 1083989496 11:66238165-66238187 CCCCCCCACCCCCATTCAGTACA 0: 1
1: 0
2: 2
3: 51
4: 519
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989498_1083989510 9 Left 1083989498 11:66238167-66238189 CCCCCACCCCCATTCAGTACACT 0: 1
1: 0
2: 0
3: 20
4: 282
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889
1083989504_1083989510 1 Left 1083989504 11:66238175-66238197 CCCATTCAGTACACTTCCAGATT 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG 0: 1
1: 0
2: 9
3: 96
4: 889

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083989510 Original CRISPR CAGGAAGACCAGAGAGGAGA AGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900956948 1:5892073-5892095 GAGGAAGACCAAGGAGGAGCTGG + Intronic
900959367 1:5909447-5909469 CAGGAAGAACAGTGAGGACGAGG - Intronic
901056144 1:6449368-6449390 GAGGAGGCCCAGAGAGGGGAGGG - Intronic
901057262 1:6454404-6454426 GGGGAAGACAAGAGAGGGGAGGG - Intronic
901137263 1:7005996-7006018 TTGGAAGAACAGAGAGGACAGGG + Intronic
901480353 1:9520739-9520761 CAGGAAGCACAGGGAGGGGAAGG - Intergenic
901565725 1:10113196-10113218 CAGGAGCAACAGAGAGGAGGAGG + Intronic
901622688 1:10601448-10601470 CAGCAAGTCCGGAGAAGAGAAGG - Intronic
901658875 1:10786378-10786400 CAGGCAGGCCAGAGAGGTAAAGG + Intronic
902105552 1:14032966-14032988 CAGTAAGACCAGGGTGCAGAGGG - Intergenic
902404354 1:16174786-16174808 GGGAAAGACCAGAGAGGGGAGGG - Intergenic
902477103 1:16694087-16694109 GGGGAAGACAAGAGAGGGGAGGG + Intergenic
902565338 1:17307831-17307853 CAGGCATATCAGAGAGGAGAAGG - Intergenic
902707968 1:18219472-18219494 CAGGTGGGCCAGTGAGGAGATGG + Intronic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
902805631 1:18859619-18859641 GAGGAAGAACAGGGAGGAGATGG + Exonic
903026100 1:20430786-20430808 AGGGAGCACCAGAGAGGAGAAGG - Intergenic
903181539 1:21607582-21607604 CAGGAAGAGAAGAGAGGAAGAGG - Intronic
903274713 1:22213067-22213089 CAGGAAGACAGCAGATGAGAGGG + Intergenic
903322666 1:22552214-22552236 GGGGAGAACCAGAGAGGAGAGGG + Intergenic
903719392 1:25393265-25393287 CAGGAAGACAAGGGTGGAAATGG - Intronic
903772491 1:25772703-25772725 AAGGGAAGCCAGAGAGGAGAGGG - Intronic
903972737 1:27129640-27129662 GATGAAGCCCAGAGAGGGGACGG + Intronic
904114362 1:28150698-28150720 CAGGAAGGCCACAGAGCAGTAGG + Exonic
904211256 1:28887880-28887902 CAGGGAACCCAGAGATGAGAGGG - Intronic
904615612 1:31747979-31748001 CAGGAAGCCCACACAGGAGCTGG - Intronic
904706044 1:32391647-32391669 CAGGAAGACAGGACAGGAGGAGG + Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
905170398 1:36106537-36106559 CAGGAAGCCGAGGGAGGGGAGGG + Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905502646 1:38451870-38451892 GAGGATGACTAGGGAGGAGAGGG - Intergenic
905887692 1:41500519-41500541 AAGGAAGTCCTGAGAGGAGGCGG + Intergenic
906102359 1:43271708-43271730 CAGAAAGACCAGTGAGGAGGTGG + Intronic
906281385 1:44556543-44556565 CAGGAAGAGCAGACAGGAAAAGG - Intronic
906805813 1:48777703-48777725 GAGAAAGACTATAGAGGAGAGGG - Intronic
906988776 1:50714745-50714767 AAGAAAAACCAGTGAGGAGAAGG - Intronic
907195169 1:52680649-52680671 CAGGAAGACCAATGAGGAGATGG - Intergenic
907303765 1:53502910-53502932 CAGGGAGACAGGAGAGGGGAGGG + Intergenic
907451046 1:54546087-54546109 TAGAAAGCGCAGAGAGGAGAGGG + Intronic
907481361 1:54747659-54747681 CAGGTAGACCAGGCAGGGGAAGG - Intergenic
907650952 1:56294298-56294320 TGGGAAGACCAGTTAGGAGATGG - Intergenic
907705532 1:56829171-56829193 GAGGAAGAGCAGGGAGGAGAAGG - Intergenic
908147214 1:61259358-61259380 ATGGAAGAACAGAGAGGGGAAGG - Intronic
908516441 1:64897454-64897476 CAGGAGGACGAGGGAGGAGGAGG + Intronic
911145481 1:94548295-94548317 GAGGAACAGCAGAGAGGAGGAGG + Intergenic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
911753900 1:101530608-101530630 CAGAAAGAGCTGAGAGGAAAAGG + Intergenic
912432927 1:109639032-109639054 CAGGAGGACCAGCTAGGAGCAGG - Intergenic
912632079 1:111254698-111254720 CATGAGGACCAGAGAAGAGCAGG - Intergenic
912703369 1:111894909-111894931 CAGGAAGAGGAAAGAGGAGAAGG + Intronic
912725286 1:112053761-112053783 CAGGAAGCAGATAGAGGAGATGG + Intergenic
912794878 1:112686936-112686958 CAGGGAGACCAGTTAGAAGAAGG - Intronic
913989411 1:143596636-143596658 CTGGAAGCCCAGACATGAGATGG - Intergenic
915529516 1:156495221-156495243 CACGGAGACCTGAGAGGAGGAGG - Intronic
915651261 1:157312645-157312667 CCTGGAGACCAAAGAGGAGAAGG - Intergenic
915731951 1:158060165-158060187 AAGGAGGAGCAGAGAGGAAAGGG - Intronic
915981225 1:160421024-160421046 CAGGAACAGGATAGAGGAGATGG - Intronic
916103031 1:161409159-161409181 CAGCAAGACCAGATCTGAGACGG + Intergenic
916674292 1:167053383-167053405 CAAGGAGACCAGAGAAGGGAAGG + Exonic
916884056 1:169049809-169049831 CTGGAAGAGCAGACAGGAAAGGG + Intergenic
917178730 1:172268510-172268532 TAGGTACACCAGAGAGGAGGGGG + Intronic
917238164 1:172917144-172917166 CAGGCAAAGGAGAGAGGAGAAGG - Intergenic
917329601 1:173868225-173868247 GAGGAAGAGCAGAGAGGGGAGGG + Intronic
917734546 1:177908500-177908522 CAGGAAGCCCAAAGAAGTGATGG + Intergenic
917754460 1:178085225-178085247 CAGGATAACCAGGGAGGAGCTGG - Intergenic
917972650 1:180218888-180218910 CAGGAATACAAGTGAGGAGATGG - Intergenic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
918127619 1:181598129-181598151 GAGGAGGACGTGAGAGGAGATGG + Intronic
918699832 1:187594422-187594444 CGGGAAGAGGAGAGATGAGAGGG + Intergenic
918745910 1:188199154-188199176 GAGGAAGAGAAGAGAAGAGAAGG + Intergenic
918966930 1:191362868-191362890 CAGAAAGAAAAGAGAAGAGATGG + Intergenic
919000930 1:191830051-191830073 AAGAAAGATCAGAGAGGACAGGG + Intergenic
919288524 1:195598385-195598407 AAGAAAGAAAAGAGAGGAGAGGG - Intergenic
919786966 1:201264314-201264336 CAAGGAGACCAGACAGGGGAGGG - Intergenic
919871631 1:201826265-201826287 CAGTAAGACCCCACAGGAGATGG - Exonic
920302402 1:204997068-204997090 CAGGCAGCCCGGTGAGGAGACGG - Intronic
920555006 1:206898308-206898330 GAGGAAGACCAGAGAAGACCCGG - Intronic
920606522 1:207393959-207393981 TAGCAAGAGCAGGGAGGAGAAGG - Intergenic
920868762 1:209775574-209775596 GAGGGAGATCAGAGAGGAGAGGG - Intronic
920926093 1:210343226-210343248 CAGAAAGAGCAGGGAGGAGGAGG - Intronic
920953912 1:210599910-210599932 AAAGAAGAACAGAGAGGTGAGGG - Intronic
921305689 1:213794354-213794376 GAGAAAGGGCAGAGAGGAGAAGG - Intergenic
921559090 1:216635207-216635229 GAGAAAGAGCAGAGAAGAGAGGG + Intronic
921592031 1:217015251-217015273 AAGAAAGACCAGTGAAGAGATGG - Intronic
921645880 1:217617294-217617316 GAGGAAGTCAAGAGAAGAGAGGG - Intronic
921659254 1:217779562-217779584 AAGGAAGTAAAGAGAGGAGAAGG - Intronic
921685977 1:218089550-218089572 GAGGAATACTAGAGAGGGGAGGG + Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922905740 1:229172337-229172359 CAGGTAGGGCAGAGAGGGGAGGG + Intergenic
922908997 1:229199696-229199718 CAGGCAGGCCAGAGAAGGGAAGG - Intergenic
923190888 1:231619601-231619623 GAGGAAGATGAGACAGGAGAAGG - Intronic
923221898 1:231903013-231903035 GAGGAGGAAGAGAGAGGAGAAGG - Intronic
923252757 1:232192318-232192340 CTGGAAGCACACAGAGGAGATGG + Intergenic
923287757 1:232513433-232513455 CAGAAAGATTAGAGAGGTGAGGG + Intronic
923575713 1:235157219-235157241 AAGGGAGACCAGTAAGGAGATGG + Intronic
924010742 1:239662945-239662967 AAGGAAGAGGAGAAAGGAGAAGG - Intronic
924369812 1:243335792-243335814 GGGGATGACTAGAGAGGAGAGGG - Intronic
924683873 1:246267604-246267626 CAGGCAGACAGGAGAGGAGGAGG - Intronic
924856094 1:247876339-247876361 GAAGAAGACCAGAGAAGAGTTGG - Exonic
924954528 1:248914003-248914025 AAGGAAGAAGGGAGAGGAGATGG + Intronic
1062975928 10:1682680-1682702 TAGCAAGACCAGAGAGCAGAGGG + Intronic
1063008473 10:1997544-1997566 CAGGAAGAACAGTGTGCAGACGG - Intergenic
1063038277 10:2310913-2310935 CGAGAAGACAAGAGAGGAGAAGG + Intergenic
1063492660 10:6479157-6479179 CAGGAAGACCTAGAAGGAGAGGG + Exonic
1063763708 10:9112237-9112259 CAAGCAGATCTGAGAGGAGAGGG - Intergenic
1064142228 10:12799931-12799953 AGGGAATACCAGAGAGGAAAAGG - Intronic
1064313293 10:14231446-14231468 CAGGAAGCTGAGACAGGAGAAGG - Intronic
1065978423 10:30864736-30864758 CAGGAAGAAAAGGAAGGAGATGG - Intronic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1067726575 10:48775206-48775228 GTGGAAGACAAGAGAGCAGAGGG + Intronic
1068559233 10:58494533-58494555 CAGGAAGAAGAGAGAGAAGGGGG + Intergenic
1068579560 10:58723647-58723669 CAGGAAGGCTAGAGAGGGCAGGG + Intronic
1068620957 10:59182140-59182162 AAGGAAAACCAGAAAGTAGAAGG - Intronic
1069566275 10:69465376-69465398 CCAGAAGACCACAGTGGAGAAGG - Intronic
1069890954 10:71652219-71652241 CAGGGAGATGAGAGAGGAGCAGG - Intronic
1069912073 10:71765840-71765862 CAAGAGGGCCAGACAGGAGAGGG + Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070665224 10:78337908-78337930 CATGTAGTGCAGAGAGGAGAGGG + Intergenic
1071748358 10:88447160-88447182 CAGGAAAATCAGGCAGGAGAAGG + Intronic
1072258272 10:93641764-93641786 CAAAAAGACCAGGGAGGTGAAGG - Intronic
1072525154 10:96264708-96264730 CAGGGAGACCAGACAAGACAGGG + Intronic
1072570608 10:96654689-96654711 CAGGCAGTCAAGATAGGAGAAGG + Intronic
1072889119 10:99306150-99306172 CCAGAAGAGCAGAGAGGAAATGG + Intergenic
1074008830 10:109456531-109456553 CAGGAATAGAAGAGAGGTGATGG - Intergenic
1074108566 10:110406756-110406778 CAGGAGCTCCAGAGAGGTGAAGG + Intergenic
1074412040 10:113236633-113236655 CAGGTACACCAGAAAGGGGAGGG + Intergenic
1074422983 10:113325720-113325742 CAGAAAGACCTGTGTGGAGAAGG + Intergenic
1074728565 10:116342815-116342837 CAGGAAGAACAGAGAGAAGCAGG - Intronic
1074753367 10:116607670-116607692 AAGGAACACCAGTGAGGAAATGG + Intronic
1074775808 10:116767407-116767429 AAGGCAGAGCAGACAGGAGAGGG + Intergenic
1075040263 10:119102501-119102523 CAGGAAGCCCAGAGAATAGAAGG + Intergenic
1075465089 10:122645112-122645134 CAGGAAGACCCCAGAAGAGATGG - Intergenic
1075688580 10:124380297-124380319 CGGGAGGATCACAGAGGAGATGG - Intergenic
1075688620 10:124380472-124380494 CAGGAGGAGCATGGAGGAGATGG - Intergenic
1075936122 10:126342943-126342965 CAGGACCAGCAGAGAGGAGGAGG - Intronic
1076141324 10:128080648-128080670 CAGGAAGAGCACAGCTGAGACGG - Intronic
1076198517 10:128539420-128539442 CAGGAAAACCTGAGAGGTGGTGG - Intergenic
1076560364 10:131359125-131359147 CAGGAAGAGCAGTGTGGGGAGGG - Intergenic
1076783765 10:132738978-132739000 CAGGAAGACCGTTGAGAAGATGG + Intronic
1077328612 11:1974241-1974263 GACCAAGCCCAGAGAGGAGACGG - Intronic
1077359348 11:2133833-2133855 CAGGAAGAAGAGAGGTGAGAGGG + Intronic
1077497340 11:2892576-2892598 CAGGGGGAGCAGAGAGGAAATGG - Intronic
1077723475 11:4650324-4650346 GAGGAACAGCAGAAAGGAGAGGG + Intronic
1077879052 11:6333509-6333531 CAGGAGGATCAGAGAGGAAGAGG + Intergenic
1078522388 11:12073783-12073805 CAGAAGGATCACAGAGGAGACGG + Intergenic
1078734373 11:14006635-14006657 AGGGAAGAGGAGAGAGGAGAGGG - Intronic
1078886188 11:15502411-15502433 GCTGAAGTCCAGAGAGGAGAAGG - Intergenic
1079112094 11:17610688-17610710 GAGGCAGGCCAGAGAGGAGCTGG - Exonic
1079332215 11:19542907-19542929 CACCAGGACCACAGAGGAGAAGG + Intronic
1079908279 11:26276789-26276811 AATGAAAACCAGAGAGGTGAAGG - Intergenic
1080520966 11:33067648-33067670 CTGGAGGACCAGGGAGGATATGG - Intronic
1080546371 11:33322947-33322969 CAGGAAGGTCAGAGTAGAGAGGG - Intronic
1080680757 11:34473619-34473641 CAAGAAGAAGAGAGAGGAGGAGG - Intergenic
1080921576 11:36714510-36714532 CAGGAAAGCCAGAGAGGAGTGGG - Intergenic
1081076175 11:38676636-38676658 CAGGAAGACCAGGAAGTAGAGGG + Intergenic
1081526844 11:43933437-43933459 AGAGAAGACCAGAGAGGGGAGGG - Intronic
1081663468 11:44902750-44902772 CAGGAAGACCTGAGGAGAGAAGG + Intronic
1082567304 11:54696303-54696325 CAGGACAATCAGACAGGAGAAGG - Intergenic
1083250545 11:61464015-61464037 CAAGAAGAGGAGAGAGGAGAGGG - Intronic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084525347 11:69694444-69694466 CTACAAGACCAAAGAGGAGAGGG - Intergenic
1084816252 11:71648690-71648712 CAGGAGGAGGAGAGAAGAGAAGG + Intergenic
1085056368 11:73406470-73406492 AGGGAAGAGCAGAGAGGACATGG + Exonic
1085285405 11:75356769-75356791 CAGGAAGACCAATTAGGACATGG + Intergenic
1085313550 11:75530198-75530220 GTGGAAGACCAGAGAGCAGGAGG - Intergenic
1085323891 11:75592168-75592190 CAGGAAGACCAGGGAGGAGGTGG - Intronic
1086520781 11:87665684-87665706 CAGGAAGAGCACCGAGGGGATGG + Intergenic
1086616675 11:88830008-88830030 CAGGAAGAAGGGAGAGGAGAAGG + Intronic
1086779784 11:90888595-90888617 CAGGAAGATCACAGAAGACATGG - Intergenic
1086871196 11:92038956-92038978 CAGGAAGAACTGAAAGGAAAAGG + Intergenic
1086998898 11:93392917-93392939 GAGGAAGAGGAGGGAGGAGAAGG - Intronic
1087390076 11:97520469-97520491 AAGGAAGTTCAGAGAGTAGAGGG + Intergenic
1087542691 11:99541482-99541504 CTGGAGGGCCAAAGAGGAGATGG + Intronic
1087761738 11:102110359-102110381 AAGGAAGAGCCGAGAGGAGGCGG + Intergenic
1087892208 11:103548145-103548167 CAGGAAGCCCTGAGAGATGAAGG - Intergenic
1087945315 11:104153100-104153122 CAGGAAGAGCAGATAAGAGAAGG - Intronic
1088597818 11:111452950-111452972 GAGGAGGAACAGAGATGAGAAGG + Intronic
1088902680 11:114130060-114130082 CAGGATGCCCAGGGAGGAGCAGG + Intronic
1089006508 11:115095962-115095984 GAGGAAGACCACAGAGGTAAAGG - Intergenic
1089197151 11:116700840-116700862 CAGGAAAACCAAAGGAGAGAGGG - Intergenic
1089836199 11:121372798-121372820 CAGGAAGTTCAGAGAGGTCAGGG + Intergenic
1089873491 11:121697346-121697368 CTGGCAGAGCAGAGGGGAGAGGG - Intergenic
1089969580 11:122682013-122682035 CAGGGAGAACAGACAGGAGATGG - Intronic
1090131832 11:124150779-124150801 CAGGAAGACGAGAAAGAGGAAGG + Intergenic
1090154339 11:124421803-124421825 CAGGAAGAGCCCAGAAGAGAAGG + Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090965743 11:131596544-131596566 AAGGAAGGCTAGAGAGGGGATGG - Intronic
1091250072 11:134136652-134136674 CAGGAAGACTCCAGAGCAGAGGG - Intronic
1202811591 11_KI270721v1_random:29420-29442 GACCAAGCCCAGAGAGGAGACGG - Intergenic
1091635611 12:2194323-2194345 GAGGAAGAGCACAGAGGAGGAGG - Intronic
1091714522 12:2767556-2767578 CAGGAATGCCACTGAGGAGAGGG + Intergenic
1091815419 12:3434217-3434239 AAGGTAGCCCAGACAGGAGAAGG + Intronic
1091817794 12:3453110-3453132 CAGGTAGGCTGGAGAGGAGAGGG + Intronic
1091865527 12:3832813-3832835 CAGGAAAATCAGACAGGATATGG - Intronic
1091933776 12:4418139-4418161 CAGCAAGGCCAGAGAGGCGTGGG + Intergenic
1092073429 12:5652719-5652741 GAGGAAGACCACAGAGGGAAGGG + Intronic
1092179194 12:6433722-6433744 AAGGAAGAAAAGAAAGGAGAAGG - Intergenic
1092507364 12:9117341-9117363 CAGGAAGACCAGATGGGAGCTGG + Intergenic
1092787150 12:12037314-12037336 CAGGAAGACAAGAGAAAGGAGGG + Intergenic
1093048453 12:14480395-14480417 GAGGAATACCAGAGTAGAGAAGG + Intronic
1093528526 12:20133866-20133888 CAGAAAGAACAGAGAGGGGCAGG + Intergenic
1094003148 12:25718166-25718188 CAGAAAGAACAGAAAGGATATGG - Intergenic
1094086662 12:26600686-26600708 GAGGAAAAGAAGAGAGGAGATGG - Intronic
1094219029 12:27973919-27973941 CAGGAGGCCCAGAGAGGAGGCGG + Intergenic
1095319081 12:40803802-40803824 CAGGAAGGGAGGAGAGGAGAAGG + Intronic
1095483984 12:42665313-42665335 CTGAAAGGACAGAGAGGAGAAGG - Intergenic
1096535688 12:52271231-52271253 AAAGAAGACCAGAGAAGGGAAGG - Intronic
1096704631 12:53411373-53411395 GAGGGATACAAGAGAGGAGATGG + Exonic
1096782799 12:54000689-54000711 CAGCAAGCACAAAGAGGAGAAGG + Exonic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1100206959 12:92360638-92360660 CAGGAAAACCACATAGGAGGAGG - Intergenic
1100376628 12:94022432-94022454 CGGGGAGACCAGTGAGAAGATGG + Intergenic
1100718573 12:97330949-97330971 CGGGGATAACAGAGAGGAGAGGG + Intergenic
1101816303 12:108148607-108148629 GAGGAAGATCAGAGAGGTTAGGG + Intronic
1101865398 12:108516249-108516271 ATGGAAGGCCAGAGAGGGGAAGG + Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102572207 12:113833694-113833716 CAGGACCACCAGAGAGGGGAAGG - Intronic
1102572623 12:113836248-113836270 CAGGAAGAGGACAGGGGAGATGG + Intronic
1102775055 12:115511462-115511484 CAGGAAGACAGGATAGGGGAAGG - Intergenic
1102786017 12:115605526-115605548 AAGGAACAGCAGAGAGGAAAAGG + Intergenic
1103145476 12:118591431-118591453 AATGAAGATCAGAGAGGTGAAGG + Intergenic
1103851926 12:123938921-123938943 AACGAAGACCAGAGAGGAGGTGG - Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1104000032 12:124854528-124854550 CAGGGAGGCCAGTGAGGAGGCGG + Intronic
1104109033 12:125688623-125688645 CAGGAAGACCACACAGGACCAGG + Intergenic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1104602719 12:130163862-130163884 CAGGAAGACCAGCGTGCAGCCGG - Exonic
1104884113 12:132094822-132094844 AAAGAAGAGAAGAGAGGAGAGGG - Intronic
1105928973 13:25034197-25034219 CAGGAGGACCATTGAGGAGGTGG + Intergenic
1106071649 13:26417692-26417714 CAGGGAGAATAGAGAGGATAGGG - Intergenic
1106172304 13:27298392-27298414 AAGGAACATCAGAGAGGTGAGGG + Intergenic
1106232399 13:27830790-27830812 AAGGAGGCCCAAAGAGGAGAAGG + Intergenic
1106395890 13:29380566-29380588 AAGGAACACACGAGAGGAGATGG + Intronic
1106618309 13:31350702-31350724 AAGGAAGGACAGAGAGAAGATGG - Intergenic
1107889422 13:44901326-44901348 GAGGAAGAAAAGAGAGGAGAAGG + Intergenic
1108038795 13:46320473-46320495 GAGGAAGACAAGAAAGAAGAGGG + Intergenic
1108068899 13:46607161-46607183 CAGCTAGATCACAGAGGAGATGG + Intronic
1108142511 13:47439351-47439373 AATGAAGAAGAGAGAGGAGACGG + Intergenic
1109205619 13:59479699-59479721 TGGGAAGGCCAGAGAGTAGAGGG + Intergenic
1109391100 13:61694851-61694873 CAGGAGGAAGAGAGAGGAGGGGG - Intergenic
1109596343 13:64559556-64559578 CTTGAAAGCCAGAGAGGAGAGGG + Intergenic
1110465148 13:75791958-75791980 AAGGAAGAGAAGAGGGGAGAGGG - Intronic
1111973806 13:94944935-94944957 CAGGGAGACCACAGAAGAGCTGG - Intergenic
1112158775 13:96847171-96847193 AAGGAAGAGCAGAGAGGAGGAGG + Intergenic
1112952778 13:105021867-105021889 AAGGAAGACCAAAGAGGAAATGG + Intergenic
1113265084 13:108607910-108607932 CAGGAACAAGAGAGAAGAGAGGG - Intronic
1113334501 13:109365169-109365191 CAAGCTGAACAGAGAGGAGACGG - Intergenic
1113488840 13:110676520-110676542 CAGGAAGATCTGGGAGGAGCTGG + Intronic
1114224719 14:20727005-20727027 CAGAAAGACCAGGGATTAGAAGG + Intergenic
1114981976 14:28176542-28176564 GAGGCAGACAAGAGAAGAGAGGG - Intergenic
1115089731 14:29559354-29559376 CAGGAAGATCATAGAGAGGAGGG + Intergenic
1115165530 14:30444819-30444841 ACAGAAGACCAGAGAGCAGAAGG + Intergenic
1115694189 14:35878717-35878739 AAGGAAGACCGGAGTGCAGATGG - Intronic
1115965033 14:38878351-38878373 CAAGAAGAGTAGAGAAGAGAGGG - Intergenic
1117291040 14:54333016-54333038 CAGGAAGAGCAAAGAGCAGCAGG + Intergenic
1117955966 14:61123849-61123871 AAGGAAGACCATAGGGGAGGGGG - Intergenic
1118344697 14:64929332-64929354 CTTGAAGAGCAAAGAGGAGATGG - Intronic
1118613973 14:67562696-67562718 CAGGAAGGCCAGAGGGGTGGAGG - Exonic
1118744893 14:68766681-68766703 CAGGACCACAAGAGAGGAGGGGG + Intergenic
1119091536 14:71786264-71786286 CAGGAAAAGCAGGGAAGAGAGGG + Intergenic
1119210561 14:72828569-72828591 CAGGTAGAAAAGAGAGGAAAGGG + Intronic
1119400759 14:74360608-74360630 CAGGAAACCCAGACAGAAGAAGG - Intergenic
1119650819 14:76381542-76381564 CAGGAACACGAGAGAAGAAATGG - Intronic
1119906041 14:78302924-78302946 CAGAAAGACCAATTAGGAGAGGG - Intronic
1120044629 14:79792039-79792061 TATGAAGACCTGAGATGAGAAGG + Intronic
1120063924 14:80017739-80017761 CAGGAATTCCAGAGAAGAAAAGG - Intergenic
1120599719 14:86487103-86487125 AAGGAGGAGAAGAGAGGAGAAGG + Intergenic
1120715991 14:87841151-87841173 TAGGAATTCCAGAGAGGAGCTGG - Intronic
1120965286 14:90161839-90161861 GAGGAAGAGAAGAGAGGTGAGGG + Intronic
1120975022 14:90240834-90240856 AAGGAAGTTCAGAGAGAAGAGGG - Intergenic
1121209830 14:92199898-92199920 CAAGAAGAGCAGAGAGGAGAGGG + Intergenic
1121399681 14:93662653-93662675 CAGGTAGGCCAGAGTGAAGACGG - Exonic
1121609576 14:95268010-95268032 CAGGAAGGAGAGAGGGGAGAGGG + Intronic
1121803773 14:96797146-96797168 CTAGAAGACCAGGGAGCAGAAGG + Intergenic
1121837477 14:97105157-97105179 CATCAAGGCCAGAGAGGGGATGG - Intergenic
1121885224 14:97536650-97536672 GAGGAGGAGCAGCGAGGAGAAGG - Intergenic
1122089080 14:99326265-99326287 CAGGCAGAGGAGAGAGGAGAGGG - Intergenic
1122278700 14:100609061-100609083 CAGCAGGACCAGCGAGGACATGG - Intergenic
1122632746 14:103114473-103114495 CAGGAAGACTAGAGATAAGAAGG - Intergenic
1122863593 14:104593602-104593624 CAGGAAGGCCAGCGTGGTGATGG + Exonic
1122941785 14:104984766-104984788 TGGGAAGGCCAGGGAGGAGATGG + Intergenic
1123074783 14:105662674-105662696 CGTGAGGACCAGGGAGGAGACGG + Intergenic
1123095219 14:105763959-105763981 CGTGAGGACCAGGGAGGAGACGG + Intergenic
1124642397 15:31404057-31404079 CAGGGAGTTCGGAGAGGAGAGGG - Intronic
1125104519 15:35954806-35954828 CAGGACAATCTGAGAGGAGAAGG - Intergenic
1125212569 15:37234294-37234316 CAGGAACAAGAGAGAGGAGGTGG - Intergenic
1125334532 15:38614459-38614481 CTGGAAGCCCATAGAGGGGAAGG - Intergenic
1125360084 15:38856095-38856117 CAGGAAGCCATGAGGGGAGATGG - Intergenic
1125394143 15:39228314-39228336 CAGGAAGAGAACAGTGGAGAAGG + Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125561176 15:40634851-40634873 CAGCAAGACCTGGGAGGAAAGGG - Intronic
1125763443 15:42115643-42115665 GAGGAAGACCACAGAGGTAAAGG + Intergenic
1125933135 15:43614105-43614127 GAGGAACTCCAGAGAGGAAATGG - Intronic
1125946233 15:43713567-43713589 GAGGAACTCCAGAGAGGAAATGG - Intergenic
1126645762 15:50873488-50873510 AAGGAAGTTCAGAGAGTAGAGGG + Intergenic
1126883122 15:53120591-53120613 CAGGAAGAACAGAGCAGGGAGGG - Intergenic
1126974054 15:54154185-54154207 CAGGAAGAATACAGAGGAGGTGG - Intronic
1127388437 15:58486190-58486212 CAGGCAGATAAGAGAGGAGGAGG - Intronic
1127706537 15:61552723-61552745 GAGGAAGACCAGGAAGGAGTTGG + Intergenic
1128234886 15:66060509-66060531 CAGGTACTGCAGAGAGGAGAAGG - Intronic
1128258777 15:66217351-66217373 CAGGAAGATGAGTGTGGAGATGG + Intronic
1128358275 15:66943457-66943479 TAGGATGGTCAGAGAGGAGAGGG + Intergenic
1128535944 15:68490574-68490596 CAGGAAGAGGAGGGAGGAGCGGG - Intergenic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128764075 15:70240362-70240384 CAGGAAGAACAGGGAGAAGTGGG - Intergenic
1129166857 15:73783392-73783414 CAGGAAGGCCACAGTGGAGATGG - Intergenic
1129394831 15:75238023-75238045 CAGGAAGAACAGGGAAGAAAGGG + Intergenic
1129547374 15:76410865-76410887 CAAGAAGACAAGAGATGTGAAGG - Intronic
1130046015 15:80445564-80445586 CATGAAGCCCTGAGAGGAGGTGG + Intronic
1130225998 15:82058833-82058855 AAGGAAGAGGAGGGAGGAGAGGG - Intergenic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130624912 15:85504274-85504296 CTGGGAGAGGAGAGAGGAGAGGG + Intronic
1130628816 15:85544158-85544180 CAGGCAGACGAGAGAGAAAATGG - Intronic
1131002258 15:88948504-88948526 GAGGAATACCAGAGAGAAAAAGG - Intergenic
1131158321 15:90088567-90088589 CAGGTAGGCCAGGGTGGAGAGGG - Exonic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131588070 15:93717539-93717561 CTGGAAGCCCAGGGAGAAGAGGG + Intergenic
1131897750 15:97052308-97052330 CAGGAATACCTGAGAGGGAAGGG - Intergenic
1132114109 15:99123505-99123527 CGGGAAGACCAGGGAACAGAAGG - Intronic
1132389422 15:101427620-101427642 CAGCAGGACCAGAGGAGAGAGGG + Intronic
1132400890 15:101504542-101504564 CAGGAAGAGCAAAGGCGAGAAGG + Intronic
1132656722 16:1044561-1044583 CTGGGAGCCCAGGGAGGAGAGGG + Intergenic
1133047377 16:3096310-3096332 CAGGAAGGGCAGAAAGCAGAGGG - Intronic
1133088843 16:3387669-3387691 CAAGAAGACCAGATAGGCTATGG - Intronic
1133174072 16:4000587-4000609 CAGTAAGAACAGACAGCAGATGG + Intronic
1135046917 16:19163495-19163517 CAGGGAGGCCAGTGAGGAGATGG - Intronic
1135681980 16:24465253-24465275 CAGGAAGAAGAGAGAGAAGGGGG + Intergenic
1135942797 16:26837211-26837233 CAGAAAGAACTGAGACGAGATGG + Intergenic
1136232404 16:28894410-28894432 CAGGAAGAGCAGGCAGCAGAGGG - Intronic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1136778646 16:32884391-32884413 TAGGAGGCCCAGAGAGGAGAAGG - Intergenic
1136891974 16:33977123-33977145 TAGGAGGCCCAGAGAGGAGAAGG + Intergenic
1137004093 16:35256012-35256034 CAGGAACAGCAGCAAGGAGAGGG - Intergenic
1137027024 16:35486572-35486594 CAGGGACAGCAGGGAGGAGAGGG - Intergenic
1137256474 16:46779039-46779061 CAGGAAGAGCAGACAAGTGAAGG - Intronic
1137265164 16:46862855-46862877 CAGCAAGAAGAGAGAGGAGGAGG + Intergenic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137509880 16:49089930-49089952 GAGGAAGAGCAGAGAGGAGATGG - Intergenic
1137642332 16:50043635-50043657 GAGGAAGAGAAGAGAAGAGAAGG - Intergenic
1137842036 16:51649733-51649755 CATGAATTCCAGAGAGGAAAGGG - Intergenic
1138633632 16:58319394-58319416 CAGGGAGACCAGTGAGGGGCAGG - Intronic
1138871042 16:60886392-60886414 GAGGAAGATAAGAGAGGAAAAGG - Intergenic
1138891715 16:61150673-61150695 CAAGGAGAGCAGAGAGGAGCAGG - Intergenic
1138973838 16:62179440-62179462 CAGGATGATGAGAGAGGAAAAGG + Intergenic
1139102943 16:63790059-63790081 TGGGAAGATTAGAGAGGAGAGGG + Intergenic
1139579677 16:67865013-67865035 CAGGAAGGCCAGTGAGGGGTGGG + Intronic
1139674970 16:68517402-68517424 TGGGTAGGCCAGAGAGGAGAAGG + Intergenic
1139706941 16:68747307-68747329 CAGAAAGAGGAGGGAGGAGAGGG + Intronic
1139946327 16:70644899-70644921 GAGGAAGAGGAGGGAGGAGAAGG + Intronic
1139965648 16:70743980-70744002 CAGGCAGCCCAGGCAGGAGACGG - Intronic
1140181996 16:72729392-72729414 TCGGAAGAACAGAGAGGAGCTGG + Intergenic
1141065444 16:80910114-80910136 GAGGAAGACAGGAGAGCAGAAGG + Intergenic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1141862759 16:86729234-86729256 CAGGAAGATCAGACAGGAGAAGG - Intergenic
1142023767 16:87801344-87801366 TCGGAAGACCAGGGAGGAGATGG - Intergenic
1142153807 16:88524203-88524225 CAGGAAGGCCAGGGTGGGGAGGG + Intronic
1142175547 16:88643427-88643449 CAAGAAGCCCAGCGAGGAGGAGG - Exonic
1203081062 16_KI270728v1_random:1146485-1146507 TAGGAGGCCCAGAGAGGAGAAGG - Intergenic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143069356 17:4277484-4277506 TAGGAAGAATAGAGAGGAAAAGG - Intronic
1143136487 17:4715267-4715289 AAGCAAGACCACAGAGGAGGAGG + Intronic
1143173567 17:4944078-4944100 AACGAAGACGGGAGAGGAGATGG + Intronic
1143275886 17:5710369-5710391 GAGGAGGAACAGAGAGGAGGAGG - Intergenic
1143661091 17:8325053-8325075 CAGGAAGAACACAGAAGGGAGGG - Intergenic
1143729911 17:8875596-8875618 CAGGGAGGCCAGGGAGGAGCAGG - Intergenic
1143863895 17:9910269-9910291 CAGGAGCTCCAGAGATGAGAGGG + Intergenic
1144020447 17:11236442-11236464 CTGGAAGACCAGAGATGGGAAGG + Intergenic
1144400567 17:14895112-14895134 CAGGAACTCCAGAGGGTAGAGGG + Intergenic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144879752 17:18425240-18425262 CTAGAAGACCAGAGGGGAGGAGG + Intergenic
1145411584 17:22670512-22670534 CAGGAATATCAGAGAGCAAAAGG + Intergenic
1146305266 17:31725549-31725571 CACCAGGACCAGAGAGGAGAAGG + Intergenic
1146662839 17:34676036-34676058 GAGGGAGACCAGAGAGGAAGAGG + Intergenic
1147011288 17:37450769-37450791 CAGGCAGAACAGAAATGAGAAGG - Intronic
1147358229 17:39914212-39914234 GAGGAAGACCACAGAGGTAAAGG - Intronic
1147504196 17:40999000-40999022 GAGGAAGAAGAGAGAAGAGAAGG + Intergenic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147582522 17:41635340-41635362 CAGGAAGGCCACAGAGGAGCAGG + Intergenic
1147861900 17:43528675-43528697 CGGGAAGGCCAAAGAGAAGAGGG + Exonic
1147896697 17:43756029-43756051 CAGGAAGAAGAGAGAGGTTAAGG - Intronic
1148258344 17:46156452-46156474 TAGGAAGACCTGAGAAGAGATGG - Intronic
1148521048 17:48275273-48275295 CAGGGAGATCAGAGAGAATAAGG - Intronic
1149082419 17:52674994-52675016 CAACAAGACCAAAGAGGTGAAGG + Intergenic
1149268615 17:54953666-54953688 CAGGAAGCCCAGGAAGAAGATGG - Intronic
1149639927 17:58195925-58195947 AAGGAAGGAGAGAGAGGAGAGGG - Intronic
1149955819 17:61048497-61048519 CAGTAAGACCAAAGAAGAGCGGG + Intronic
1150449675 17:65256414-65256436 TAGGGAGCCCAGAGAGGAGGAGG - Intergenic
1150478372 17:65490856-65490878 CAGGAAGAGAGAAGAGGAGAGGG - Intergenic
1151046322 17:70923747-70923769 ATGGAAGACCTGAGATGAGATGG - Intergenic
1151276347 17:73037463-73037485 CGGGCAGGCCACAGAGGAGAAGG + Intronic
1151430163 17:74056830-74056852 CAGGAACAAGAGAGAGGAGAGGG - Intergenic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1152233314 17:79125659-79125681 CTGGAGGGCCTGAGAGGAGAGGG - Intronic
1152588513 17:81199748-81199770 GAGGAAGGCCCGGGAGGAGAAGG - Exonic
1153555699 18:6311018-6311040 CAGGAGGCCCAGGGAGGAGTTGG - Intronic
1153586063 18:6621894-6621916 CAGGAAGACAGAGGAGGAGATGG - Intergenic
1153612599 18:6901562-6901584 CAGGAAGACCACAGAGATAAAGG - Intronic
1154387507 18:13908362-13908384 CAGGAAGGGTAGAGGGGAGAGGG + Intronic
1155031646 18:21990221-21990243 CTGGAAGCTCAGAGAAGAGACGG - Intergenic
1155140205 18:23037902-23037924 CAGGCAGCCAAGTGAGGAGATGG - Intergenic
1155386359 18:25282290-25282312 GAGGAGGGCCAGAGAGGAGTAGG + Intronic
1155676365 18:28434168-28434190 GAGGAAGACCACAGAGGTGAAGG + Intergenic
1156016578 18:32553436-32553458 CAGGAAGACCAGTTAGAAGGCGG - Intergenic
1156151725 18:34251070-34251092 CAGGAAGAAGAGAGAGAATAGGG + Intergenic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156582036 18:38388573-38388595 CAGGAAAATCTGAAAGGAGAAGG - Intergenic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1156876404 18:42019001-42019023 CATGAAGAACAGAGTGGAAATGG - Intronic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1157806211 18:50659541-50659563 GAGGCAAACCAGAGATGAGATGG - Intronic
1158287505 18:55900525-55900547 CAGGCAGACCAGAGTTGATATGG - Intergenic
1158445603 18:57518003-57518025 CAGGAAGGCCAGGGAGCCGATGG + Intergenic
1158483795 18:57846509-57846531 CATTCAGAGCAGAGAGGAGAGGG + Intergenic
1159117522 18:64132723-64132745 TGGGAAGAGCAGAGAAGAGAAGG + Intergenic
1159165665 18:64695996-64696018 GAGGAAGAACACAGAGGTGAAGG + Intergenic
1159300048 18:66552045-66552067 CAGGACTACTAGAGAGGGGAAGG + Intronic
1159755751 18:72361636-72361658 CAGGAACACCAAAGGAGAGAAGG - Intergenic
1159776437 18:72608337-72608359 AAGGAAGAACAGAGCGGGGAGGG - Intronic
1160117554 18:76095588-76095610 GAGGACTACCAGAGAGGGGAGGG + Intergenic
1160448717 18:78947282-78947304 GAGGAAGAGAAGAGAGGAGGAGG + Intergenic
1161250466 19:3277103-3277125 AAGAAAGACCAGAGTGGAGTCGG - Intronic
1161576277 19:5056196-5056218 GAGGAAGACCACAGGGGCGAAGG + Intronic
1161592185 19:5133860-5133882 CTAGAAGAACAGAGGGGAGAGGG - Intronic
1162014641 19:7838448-7838470 GAGGAAGACCACAGGGGTGAAGG + Intronic
1162026965 19:7899946-7899968 CAGGAAGACCTGCAAGGAGAAGG - Exonic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1163034707 19:14563968-14563990 TAGGAAGACCTGAGAGTAGAGGG - Exonic
1163247320 19:16104771-16104793 CAGGAAGCCCAGTTAGGAAAAGG + Intergenic
1163453988 19:17395232-17395254 CAGGAAGAGGAGGGAGGAGGGGG - Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163722374 19:18904468-18904490 CAGGAAGCCCTGAGGGGAGGAGG + Intronic
1165058116 19:33191719-33191741 CAGGACATGCAGAGAGGAGACGG - Intronic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165498579 19:36169370-36169392 CACGGAGAACAGAGAAGAGATGG - Intergenic
1165604493 19:37089469-37089491 CAGGTAGACAAGACAGGAGTTGG + Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1165772203 19:38386312-38386334 CAGGAAGCCGAGGGAGGTGATGG - Exonic
1166051857 19:40265352-40265374 CTGCAAGACAAGAGAGGAGCTGG + Intronic
1166665966 19:44680621-44680643 CTGGGAGACCAGTGAGGAGCTGG - Intronic
1166993786 19:46709322-46709344 CAGGAAGAACTGGGAAGAGAAGG + Intronic
1166998672 19:46732208-46732230 CAGGCGGACCAGTTAGGAGATGG - Intronic
1167357129 19:49010954-49010976 CAGGGAAGCCAGAGAGGAGGCGG - Intronic
1167360183 19:49025916-49025938 CAGGAAGACCAGAGGGGGCCCGG + Intronic
1167360902 19:49029865-49029887 CAGGAAGACCAGAGGGGGCCCGG - Intronic
1167362750 19:49038932-49038954 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167363385 19:49042256-49042278 CAGGAAGACCAGAGGGGGCCCGG - Intergenic
1167365108 19:49050671-49050693 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167373747 19:49100400-49100422 CAGCAAGAGAAGGGAGGAGATGG - Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG + Intronic
1167793110 19:51692719-51692741 CAGGAGGACCAGGGATGAGGGGG - Intergenic
1168689791 19:58369362-58369384 CTGGAAGAGCAGAGAAGAAATGG + Intronic
1202711119 1_KI270714v1_random:19913-19935 GGGGAAGACAAGAGAGGGGAGGG + Intergenic
925117555 2:1393208-1393230 GAGGAAGAGAGGAGAGGAGAGGG + Intronic
925232054 2:2242080-2242102 GAGGAAAAACAGAGAGGAAAAGG + Intronic
925267503 2:2576492-2576514 AATGAAGAACAGAGAGGAGGTGG + Intergenic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
925519026 2:4720318-4720340 CAGGAAGGGCAGGCAGGAGAGGG + Intergenic
925557273 2:5145051-5145073 GAGGAAGCCCACAGAGGCGAGGG + Intergenic
925732087 2:6926466-6926488 CAGGAAGAGCAGGTAAGAGAGGG - Intronic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
926253313 2:11168702-11168724 CAGGGAGACCTGTGAGGAGAGGG - Intronic
926333988 2:11849610-11849632 ACAGAAGCCCAGAGAGGAGAAGG - Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926894463 2:17669561-17669583 CAGGAAAACCAGGAAAGAGAGGG + Intronic
927630202 2:24766625-24766647 CAGGAAGAGAACAGAGGAGTGGG + Intronic
927630212 2:24766684-24766706 CAAGAAGAGAAGAGAGGAGCGGG + Intronic
927929411 2:27034506-27034528 CAGGAACACCAGGGAGGAGATGG + Intronic
929075731 2:38077267-38077289 CAGGAAGACCACAGAGCCGCCGG - Intronic
929123735 2:38504185-38504207 CAGGAAGACAACTGAGGACAAGG + Intergenic
929552211 2:42901685-42901707 GAGGAAGATCAGAGAGGTGCTGG - Intergenic
929574110 2:43041541-43041563 CTTGAAGTTCAGAGAGGAGAAGG + Intergenic
929584301 2:43104160-43104182 CAGCAAGACCACAGAGGTAAGGG + Intergenic
929671676 2:43880874-43880896 CAGGACGTCCATACAGGAGAAGG - Intergenic
929824056 2:45296254-45296276 CATCAAGACAAGAGAGGAGAGGG - Intergenic
929949421 2:46395045-46395067 CAGGATGACCAGAGGGGAACTGG + Intergenic
930417797 2:51110936-51110958 AAAGAAGACCAGAGAGAGGAAGG - Intergenic
930582378 2:53228011-53228033 CAGGAAGTAAAAAGAGGAGATGG + Intergenic
931589942 2:63871780-63871802 CAGGATGGCCAGAGAAAAGAGGG - Intronic
931869523 2:66443869-66443891 AGGGAAGACAGGAGAGGAGAGGG - Intronic
931955329 2:67418182-67418204 CAGGAAGAAAAGAGAGCAAAGGG + Intergenic
932579103 2:72982081-72982103 CAGGAGGAACAGAGTGGAGCTGG + Intronic
933633310 2:84680679-84680701 CAGGGAGACCAGAATGGAAATGG + Intronic
933828409 2:86185591-86185613 CAGGAAGCCCAAAATGGAGAAGG + Intronic
934772047 2:96913405-96913427 CAGGGAGTCCACAGTGGAGAAGG + Intronic
934776290 2:96939701-96939723 CTGGCTGACCACAGAGGAGATGG + Intronic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935111777 2:100100855-100100877 AAGGAAGACCAGGGAGTGGAGGG + Intronic
935137212 2:100318060-100318082 CTGGAAGAAGAGAGAGGGGAAGG - Intronic
935529135 2:104211472-104211494 AAGGAGGAAGAGAGAGGAGAGGG + Intergenic
935591047 2:104845439-104845461 GAAGAGGACAAGAGAGGAGATGG - Intergenic
935789302 2:106576272-106576294 CGGTAAGAACAGAGAGGAGAAGG + Intergenic
936123188 2:109764313-109764335 AAGGAAGACCAGGGAGTGGAGGG - Intergenic
936221494 2:110607156-110607178 AAGGAAGACCAGGGAGTGGAGGG + Intergenic
936664674 2:114580618-114580640 CAGAAAGACCAGGCAGGAGCTGG - Intronic
936984912 2:118300010-118300032 CAGGAAAAACTGAAAGGAGAGGG + Intergenic
937509805 2:122582951-122582973 AAGGAGGACCAGGGAGGGGAGGG + Intergenic
937822492 2:126326537-126326559 CCGGAAGTCCTGTGAGGAGAAGG - Intergenic
939548308 2:143581503-143581525 AAGGAAAACCAGAGGAGAGAAGG - Intronic
939644497 2:144680319-144680341 AAAGAAGACAAGAGAGGACAGGG + Intergenic
940005574 2:149006812-149006834 CAGGGAGGCTAGAGAGGGGAGGG + Intronic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
940811401 2:158246756-158246778 CAGGGAGACCAGAGAAGAAAAGG + Intronic
941148852 2:161888778-161888800 CAGGACAACCAGGGAAGAGAAGG - Intronic
942412480 2:175725358-175725380 CAGGAAAACCACAGGGGAAAGGG + Intergenic
942535692 2:176960867-176960889 CAGGAAGCCCAGGAAGGAGAAGG + Intergenic
942579865 2:177406510-177406532 CAGGAAGACATAAGAGGACATGG + Intronic
942804234 2:179910917-179910939 AAGCAAGGCCAGAGAGGACAGGG - Intergenic
942923643 2:181407246-181407268 CACGAAGCCAAGAGAAGAGATGG - Intergenic
943076947 2:183207296-183207318 GAGGAAGATCAAAGAGAAGAGGG - Intergenic
943148320 2:184074999-184075021 AAGGAAGAGAAGAGAGGGGAGGG - Intergenic
943674074 2:190699313-190699335 CAGGAAAATAAAAGAGGAGATGG + Intergenic
944364276 2:198898260-198898282 AAGGAAGAAAAGAGAGAAGAAGG + Intergenic
944531684 2:200673819-200673841 CAGGAAACCCAGACAGGAAAAGG - Intronic
944831636 2:203538830-203538852 CAAGAAGACCAGACTGGAGCAGG + Intergenic
945398292 2:209348626-209348648 AAGGAAGACAAAAGAGGAGAGGG - Intergenic
945481894 2:210354753-210354775 CAGGACGATCAGGCAGGAGAAGG + Intergenic
945523887 2:210864415-210864437 CAGGAAGGTCAGAGTAGAGAAGG + Intergenic
945617604 2:212092442-212092464 CAAGAAAACCAGATAGGACAAGG + Intronic
946063864 2:216969214-216969236 CAGAAAGACCAGTAAAGAGATGG + Intergenic
946193014 2:218017327-218017349 CAGGCAGACCACAGATGAGGAGG + Intergenic
946245756 2:218386485-218386507 TAGGAAGAGCATACAGGAGATGG - Intronic
947290034 2:228562826-228562848 CAGGAAAATCAGAGATGGGAGGG - Intergenic
947319344 2:228898701-228898723 GAAGAAGCACAGAGAGGAGAGGG - Intronic
947489243 2:230579514-230579536 CCGGAAGACAAGAGAGAAGCTGG - Intergenic
947827902 2:233118616-233118638 CAGGCAGTGCAGACAGGAGATGG - Intronic
947833384 2:233158022-233158044 AAGGAAGAAGAGAGAGGGGAAGG + Intronic
948289454 2:236814256-236814278 AAGAAAGACTAAAGAGGAGAAGG - Intergenic
948676877 2:239602024-239602046 CAGGAAGGCCAGAGGGTAAATGG - Intergenic
948742426 2:240056668-240056690 CAGGAAGAGCAGAGAGGAGGAGG + Intergenic
948920430 2:241063745-241063767 CTGGAAGATCAGAGAGGAGGTGG + Intronic
948967501 2:241394807-241394829 AAGTAAGACCACAGATGAGAGGG - Intronic
949028952 2:241779575-241779597 TAGGAAGACAAAATAGGAGAAGG + Intronic
1168781327 20:493337-493359 CAGTGAGACCAGTTAGGAGAAGG - Intronic
1169146232 20:3254407-3254429 CAGGAGGATGAAAGAGGAGAGGG - Intronic
1169352306 20:4878913-4878935 CAAAAAGATCAGAGAGGAGAGGG - Intronic
1169450448 20:5706330-5706352 AAGGCAGACCACAGAGGAGAGGG - Intergenic
1169552955 20:6719952-6719974 CAGGAATCCGAGAGAAGAGAAGG + Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170014792 20:11768497-11768519 CAGGAACAGGAGAGAGAAGAGGG + Intergenic
1170280323 20:14639220-14639242 CAGGAAAAAAAGAAAGGAGAGGG - Intronic
1170510049 20:17067182-17067204 CAGGAAGTCAAGGGAGGAGCAGG + Intergenic
1170743955 20:19081732-19081754 CAGGAATACTAAAGAGGCGAGGG - Intergenic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171105743 20:22430764-22430786 CAGAAAGACAAGAGAGAAGTAGG + Intergenic
1171235074 20:23518155-23518177 CACAAAGACCAAAGAGGAAAGGG - Intergenic
1171403712 20:24895561-24895583 CAGGAAGAAGAGAGAGCAGGAGG + Intergenic
1171460188 20:25293705-25293727 AAGCAAGACCAGACAGGACAAGG - Intronic
1171480970 20:25455367-25455389 CAGGTAGACCTGAGATGAGCAGG - Intronic
1171753227 20:29076155-29076177 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171789027 20:29501405-29501427 CAGGACTACTAGAGGGGAGAAGG + Intergenic
1171858501 20:30373093-30373115 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171947405 20:31390486-31390508 CTGGCAGACCTGAGAGGAGGAGG + Intronic
1172224836 20:33298467-33298489 AAGGGCGACCAGAGAGGAGAAGG + Intronic
1172731558 20:37093180-37093202 CAGGTAGACTAGAGAGGGGTAGG + Intronic
1172802499 20:37586309-37586331 CACGAAGACCAGAAAGCAGTGGG + Intergenic
1173426073 20:42944551-42944573 TAGGAAGACCAGTGAGGCCAGGG - Intronic
1173662926 20:44746335-44746357 CAGGGAGACGAGGGAGGCGAAGG - Intronic
1174028798 20:47603718-47603740 GAGGACGGTCAGAGAGGAGATGG - Intronic
1174090201 20:48040542-48040564 CTGGGAAATCAGAGAGGAGACGG + Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174303761 20:49600699-49600721 CAGGAAGCTCTGAGAGCAGAGGG - Intergenic
1174508992 20:51036901-51036923 CAGCAAGATCAGAGAGAGGAAGG - Intergenic
1174600351 20:51719255-51719277 CAACAAGAGCAGAGAGGACAAGG + Intronic
1175051056 20:56156012-56156034 CAGGAAGATCAGCCAGGGGATGG - Intergenic
1175365718 20:58454373-58454395 CAGTCAGTCCAGAGAGGAGCAGG - Intergenic
1175531207 20:59675039-59675061 AAGGAGGAACAGGGAGGAGAAGG - Intronic
1175633977 20:60565271-60565293 CAGGAAGACAAGGGCGGGGAGGG + Intergenic
1175709469 20:61207537-61207559 CAGGAAGAGGAAAGTGGAGATGG + Intergenic
1175852660 20:62102079-62102101 CGGGAGGACCACAGAGGACACGG - Intergenic
1175901778 20:62362778-62362800 GAGGAAGACCAGGGTGGAGAGGG + Intronic
1176249733 20:64114826-64114848 CAGGAGGTCCAGGGAGGAGTTGG - Intergenic
1178243126 21:30925530-30925552 CTGGAATACCAGGGAGTAGAGGG + Intergenic
1178782988 21:35623870-35623892 CAGGATGACCACAGTGGAGGGGG - Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179646988 21:42782113-42782135 AAGGGAGAGGAGAGAGGAGAGGG - Intergenic
1179781723 21:43705260-43705282 TGGGACCACCAGAGAGGAGAGGG + Intergenic
1179877782 21:44279947-44279969 CAGCATGACCAGACTGGAGAGGG + Intergenic
1180618262 22:17143035-17143057 CCTGAGGGCCAGAGAGGAGACGG + Intronic
1180733581 22:18000406-18000428 CAGGAAGACCAGCCAAGATACGG + Intronic
1180962864 22:19770178-19770200 CAGGAGGACGAGAGACCAGAAGG + Intronic
1181533924 22:23532160-23532182 AAGGAAAAGGAGAGAGGAGAGGG + Intergenic
1181615296 22:24050069-24050091 AAGGAAGACCAGAGGGCAAAAGG - Intronic
1181669493 22:24419548-24419570 CAGGAAGAGCACTGAGGAGTCGG + Intronic
1182110398 22:27718981-27719003 CAGGAAGAACAGAGAGGCATGGG + Intergenic
1182141845 22:27966431-27966453 GACAAAGACCAGAGAGGAGAAGG + Intergenic
1182542976 22:31055259-31055281 AAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1182747665 22:32617881-32617903 CAGAAACAGCATAGAGGAGAAGG - Intronic
1182974161 22:34606904-34606926 CAGGGAGACTAGAGAGATGATGG - Intergenic
1183214740 22:36472300-36472322 CAGGCAGAGGAGAGAGGACATGG + Intronic
1183294781 22:37023047-37023069 CAGGAAAGATAGAGAGGAGAGGG + Exonic
1183599570 22:38832164-38832186 CAGGAAGGCCATGGAGGAGGTGG + Intronic
1183680616 22:39326909-39326931 CAGGAGGGCAAGAGAGGAGTTGG + Intergenic
1183718332 22:39547399-39547421 GAGAAAGACAGGAGAGGAGAGGG - Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184034656 22:41912749-41912771 CCTGAAGCCCAGAAAGGAGAAGG + Intronic
1185056114 22:48579134-48579156 CTGGAAGACCAGAGTGGCCAGGG - Intronic
1185181194 22:49364421-49364443 CAGGAAGGGGAGGGAGGAGAGGG - Intergenic
1185181210 22:49364475-49364497 CAGGAAGGGCAGGGAGGAGAGGG - Intergenic
1185181225 22:49364529-49364551 CAGGAAGGGGAGGGAGGAGAGGG - Intergenic
949698711 3:6730337-6730359 CAGGAGGAAGAGAGAGGGGAGGG + Intergenic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
950036981 3:9893233-9893255 CAGAAAAACCAAAGAGGAAACGG - Exonic
950118162 3:10464535-10464557 CAGGCAGAGAAGAGAGGAGAGGG - Intronic
950128482 3:10526175-10526197 GAGGCAGAGGAGAGAGGAGAAGG - Intronic
950132799 3:10558836-10558858 AAGGAAGACAGGAGAGGGGAGGG + Intronic
950211391 3:11126281-11126303 CAGGGACTCCAGAGAGGATATGG + Intergenic
950442205 3:13016580-13016602 CAGGAGGAGCACAGAGGAGGAGG - Intronic
950566058 3:13770400-13770422 TATGCAGACCAGAGGGGAGAAGG + Intergenic
950725987 3:14917370-14917392 CAGGGAGACCCCAGGGGAGAAGG + Intronic
950860423 3:16142918-16142940 CAGGAAAAACAGAAAGGAAATGG + Intergenic
952055489 3:29439952-29439974 CAGGAAGACCAGACGGAAGTCGG + Intronic
952221251 3:31326429-31326451 CAGGAGGAAGAGAGAGCAGAGGG + Intergenic
952519596 3:34143316-34143338 CAGGAAGAACAAGGGGGAGAAGG - Intergenic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952762399 3:36926161-36926183 CAGGAAGACAGGAAAGAAGAAGG - Intronic
952820890 3:37484606-37484628 CATGAGGTCCAGAGAGGTGATGG + Intronic
952838825 3:37627370-37627392 CAGCAGCCCCAGAGAGGAGACGG - Intronic
952932946 3:38374290-38374312 CAGGAGGCCCTAAGAGGAGAAGG - Intronic
953024898 3:39139155-39139177 CCTGGAGACCAGACAGGAGAGGG - Intergenic
953167837 3:40481483-40481505 GAGGAAGACCAGAAAGAAGCTGG + Intronic
953578425 3:44131682-44131704 CAGGAAGCCATGAGTGGAGAAGG - Intergenic
953592215 3:44269358-44269380 GAGGAAGAGGAGGGAGGAGAAGG - Intronic
953607342 3:44420453-44420475 CAGGAACACTAGAGAGGAGTGGG - Intergenic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954425060 3:50438816-50438838 GAGGAAAAGGAGAGAGGAGAGGG + Intronic
954508721 3:51102663-51102685 AAGGAAGCCCTGAGACGAGATGG + Intronic
954757846 3:52851508-52851530 CAGGAAAACCAGTGAAAAGAGGG + Intronic
955393369 3:58537068-58537090 CTGGGAGACCCCAGAGGAGAGGG - Intronic
955769661 3:62374524-62374546 AAGGATTATCAGAGAGGAGAGGG + Intergenic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
957603190 3:82365425-82365447 CAGGAAAAGCAAAGAAGAGAAGG + Intergenic
957891480 3:86364493-86364515 CAGGAAGAGCAGAGGGGTCAAGG + Intergenic
958100935 3:89009258-89009280 CAGGAAGGAAAGAAAGGAGAGGG - Intergenic
958666174 3:97140323-97140345 CAGAAAGCCCAGAGAGCATATGG + Intronic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960066468 3:113378990-113379012 CAGGCAGGTCAAAGAGGAGAAGG - Intronic
960551955 3:118985828-118985850 CAGGAAGACAAGGGAGAAGGAGG - Intronic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
961491754 3:127261275-127261297 CAGCAAGAGCAGGGAGGAGCAGG - Intergenic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
961976543 3:131030913-131030935 CAGGAGGAACAGAAAGCAGAAGG + Intronic
962021303 3:131504589-131504611 CAGGAAGAACAGAGAGGAAGTGG + Intergenic
962031975 3:131610664-131610686 AATTAGGACCAGAGAGGAGAAGG - Intronic
962249223 3:133824948-133824970 CAGGAAAACCAGGATGGAGAAGG - Exonic
962344541 3:134609759-134609781 CACTCAGACCTGAGAGGAGAAGG + Intronic
963293921 3:143524056-143524078 AAGGAAGACCAGAATGTAGAAGG + Intronic
963485044 3:145924947-145924969 CAGGAAGACAGGGGAGGGGAGGG + Intergenic
963485188 3:145927009-145927031 AAGGGAGACCTGAGAGTAGATGG + Intergenic
963623646 3:147643832-147643854 AAGGCATACCAGGGAGGAGAGGG + Intergenic
963689579 3:148481697-148481719 CCGGAAGTACAGAGAGGAGCTGG + Intergenic
964411778 3:156405299-156405321 CAGGAAGACTGGAGAGCAGGAGG - Intronic
964852371 3:161108671-161108693 CAGGCATCTCAGAGAGGAGAGGG - Intronic
965793526 3:172413803-172413825 CAGAAAGACAAGGCAGGAGACGG + Intergenic
966595304 3:181720169-181720191 CAGGAAGGCCAGAAAGGACCGGG - Intergenic
966732013 3:183159270-183159292 CAGGCAGACAAAGGAGGAGATGG + Intronic
967071070 3:185962696-185962718 CAGGAAGACCTGTTAGGAGGTGG + Intergenic
967493476 3:190119119-190119141 AAGGAAGAGAGGAGAGGAGAGGG + Intronic
967815818 3:193797356-193797378 CAGCAAGAATGGAGAGGAGATGG + Intergenic
967864840 3:194181471-194181493 CAGGAAGACAAGTTAGGAGGCGG + Intergenic
967906746 3:194507787-194507809 GAGGAAGAGCAGCGAGGAGAGGG - Intergenic
968147921 3:196315048-196315070 CAGAAAGACCAGAAAGTACAGGG - Intronic
968381737 4:102261-102283 TATGAAGATCAGAGAAGAGATGG - Intergenic
968624735 4:1622021-1622043 GAGGAAGGCGAGAGAGCAGATGG - Intronic
969318253 4:6395058-6395080 CAGGAAATCCAGAGAGGAGGCGG - Intronic
969511265 4:7619351-7619373 CAGTAAGTCCAGGGAGCAGAGGG + Intronic
969646915 4:8435984-8436006 CAGCAAGACCAGATCTGAGAGGG - Intronic
970575520 4:17423208-17423230 CAGGAGGAACAGAGAGCAAAGGG + Intergenic
971665491 4:29478526-29478548 AAGGAAGAAAGGAGAGGAGAGGG + Intergenic
973101061 4:46271784-46271806 CAGGAAGAAAAGTGAGGAGAGGG - Intronic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
973554746 4:52071871-52071893 GAGGAAGGGAAGAGAGGAGAGGG - Intronic
974022710 4:56705987-56706009 GAGGAAGGCCAGGGAGGATAGGG - Intergenic
974627597 4:64444290-64444312 AAGGAAGTTCAGAGAGCAGAGGG + Intergenic
975237252 4:72013732-72013754 CAGGAAGACTAGAGGGTAGAAGG + Intergenic
975250452 4:72172848-72172870 AAGGAAGTTCAGAGAGCAGAGGG - Intergenic
975446038 4:74466695-74466717 CAGGAAGAACCGAGAGTGGAAGG - Intergenic
976197584 4:82548171-82548193 GAGGACTACCAGAGAGGGGAGGG + Intronic
976211508 4:82676245-82676267 CAGGCAGTCCAGGGAGGACATGG - Intronic
976454896 4:85234832-85234854 CAGGAAGATTAGAGAGGACAAGG - Intergenic
976682544 4:87773218-87773240 CAGGACAATCAGACAGGAGAAGG + Intergenic
976827814 4:89280189-89280211 TAGGAAGACTAGAGAGGAGGTGG - Intronic
976860859 4:89664476-89664498 GAGGAAGTCCAGAAAGGTGATGG + Intergenic
978099213 4:104816320-104816342 CAGGAAGAACAGAGATGAGAGGG + Intergenic
978479866 4:109176793-109176815 GAGGAGGAACATAGAGGAGAAGG + Intronic
978903609 4:113980924-113980946 AAGGAAGAACAGAGACCAGAAGG - Intergenic
980440118 4:132831704-132831726 AAAGAAGACTACAGAGGAGAAGG - Intergenic
980590063 4:134874573-134874595 TAGGAAGAAAAGAGAAGAGATGG - Intergenic
981281416 4:142964140-142964162 AAGAAAGATCATAGAGGAGATGG + Intergenic
982271914 4:153599195-153599217 CAGGAGCACGAGAGGGGAGAAGG + Intronic
982495673 4:156088898-156088920 AAGGAACAAGAGAGAGGAGAAGG - Intergenic
982501047 4:156155166-156155188 CAGAAACACCAGAGGGCAGAAGG + Intergenic
983107620 4:163708806-163708828 AATGAAGAAAAGAGAGGAGATGG + Intronic
983132556 4:164039575-164039597 CAGGAAGAACTGTGAAGAGAAGG + Intronic
983406403 4:167336260-167336282 AAGGGAGACCAGTGAGTAGAAGG - Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984381967 4:179005788-179005810 CAGGAAGAAAAGAGAAGGGAAGG + Intergenic
984596650 4:181676527-181676549 GGGGACTACCAGAGAGGAGAGGG - Intergenic
984873489 4:184347779-184347801 CAGGAAGATCCCAGAAGAGATGG - Intergenic
985032216 4:185800661-185800683 CAGGAAGAAAAGAGGAGAGAGGG - Intronic
985117289 4:186604870-186604892 GAGGAAGAGCAGAGAGGAGGAGG + Intronic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
985428573 4:189855679-189855701 CAGGAGGAACAGAGGGGAAATGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
986127788 5:4899423-4899445 CAGAAGGACCAGGGAGCAGATGG - Intergenic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
988065509 5:26225896-26225918 CTGGAAACCCAGAGAGGAGCTGG - Intergenic
988977708 5:36531190-36531212 TAGTAAGGCCAGAGAGGATATGG + Intergenic
989181008 5:38577170-38577192 CAGGATGAGAAGAAAGGAGAGGG - Intronic
989704604 5:44313833-44313855 TAGGAAGACCTAGGAGGAGAAGG + Intronic
989838749 5:46031826-46031848 CAGGGAAATCAGACAGGAGAAGG + Intergenic
990013047 5:51023415-51023437 CAGGAAGGCCAGAAGGGAGAAGG - Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
990681521 5:58249896-58249918 CAGGAAGAAGGAAGAGGAGAAGG + Intergenic
990966387 5:61453010-61453032 CAGGAATACCACAGAAGTGATGG + Intronic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
991319599 5:65356522-65356544 CAAGAGGACCAGAGAGCAGCTGG + Intronic
991939156 5:71833420-71833442 CAGAAAAAGAAGAGAGGAGAGGG - Intergenic
992131408 5:73696326-73696348 CACGAAGAACTGAGAGCAGAAGG - Intronic
992171276 5:74104301-74104323 CAGGAAACCAAGAGAGCAGATGG - Intergenic
992353432 5:75954541-75954563 CAGGACGATCAGGCAGGAGAAGG + Intergenic
992734380 5:79704253-79704275 CAGGAATCCCAGAGTGTAGAAGG + Intronic
993481389 5:88429263-88429285 CAGAAAGAACAGAAAGGAGTAGG - Intergenic
993858072 5:93099945-93099967 CAGGAAGGAAAGAGGGGAGAGGG + Intergenic
994167714 5:96625509-96625531 CTGGAAGCACAGAGAGGATAGGG - Intronic
994474619 5:100250822-100250844 CAGGAGGAAGAGAGAGGAGTGGG - Intergenic
995078225 5:108013480-108013502 ATGGGAGAACAGAGAGGAGAAGG - Intronic
995796794 5:115949752-115949774 AAGGAAAACCAGATAGAAGAAGG + Intergenic
996443559 5:123518274-123518296 CAGGAAGTCCAGGTTGGAGAAGG + Intronic
996990376 5:129623351-129623373 TAGGAAGAGGCGAGAGGAGATGG - Intronic
997195561 5:131977010-131977032 AAGGAAGACGGGAGAGGATAAGG - Intronic
997459688 5:134043477-134043499 CAGAATAACCAGAGAGGAGGAGG - Intergenic
997981807 5:138472330-138472352 GAGGAAGGACAGAGAGGAGTAGG + Intergenic
998399726 5:141842436-141842458 CAGTCAGACCACACAGGAGAGGG - Intergenic
998661673 5:144245750-144245772 CAGGATGAAGAGAGAGGAGGGGG - Intronic
998996934 5:147876282-147876304 CAGGAAGGACAGTGATGAGAAGG + Intronic
999081879 5:148852251-148852273 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999082092 5:148854331-148854353 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999106660 5:149077313-149077335 CAGGAAAATCAGGCAGGAGAAGG + Intergenic
999261552 5:150241741-150241763 GAGGAAGAAAAGAGAGGGGAGGG - Intronic
999283069 5:150377451-150377473 CTGGAAGAGCTGAGAGAAGATGG + Intronic
999383168 5:151136019-151136041 AAGGAGGCCCAGAGAGGAGCGGG + Intronic
999637695 5:153639959-153639981 AATGCAGCCCAGAGAGGAGAAGG + Intronic
999652396 5:153780216-153780238 AAGGAAGACCAGGAAAGAGACGG + Intronic
999663097 5:153885988-153886010 AAGGAAGACCAGGGATGTGATGG + Intergenic
1000094412 5:157958557-157958579 CTGTAAGATCAGAGAGGACAAGG - Intergenic
1000153908 5:158531741-158531763 AAGAAAGAGGAGAGAGGAGAGGG + Intergenic
1000575791 5:162973654-162973676 CAGGACAACCAGGCAGGAGAAGG + Intergenic
1000587527 5:163118835-163118857 CAGGATGATCAGGTAGGAGAAGG - Intergenic
1001632013 5:173182461-173182483 TAGGAAGACCAGAGATTTGATGG - Intergenic
1001835109 5:174825085-174825107 CAGGGAGACCAGCAAGGAGGTGG - Intergenic
1002409029 5:179059754-179059776 CAGGAAGGCCAGAAAGGAAGGGG + Intergenic
1002931199 6:1636552-1636574 CAGGACGGCCAGAGAGGTGTTGG - Intronic
1002994320 6:2268584-2268606 CAGCAAGACCAGGCAGGTGATGG + Intergenic
1003018879 6:2492714-2492736 AAGGAAGACAAGAGCGCAGAGGG + Intergenic
1003091716 6:3109426-3109448 AAGGAAGATCAGAGACAAGAGGG + Intronic
1003135327 6:3430714-3430736 CAGGAAGACCAGAAGGGATGAGG + Intronic
1003263539 6:4546749-4546771 CTTGAAGACCACAGGGGAGAGGG - Intergenic
1003307798 6:4945344-4945366 AAGGAATACAAGAGAGGAGGAGG + Intronic
1003559684 6:7170399-7170421 CAGGAGCAGCAGAGAGGTGAGGG + Intronic
1003611028 6:7615135-7615157 CAGGAAAAGCAATGAGGAGATGG - Intergenic
1004020237 6:11770436-11770458 CAGGAAAGGGAGAGAGGAGAGGG + Intronic
1004079308 6:12375513-12375535 AAGGAAGAACAGGGAGGAGCAGG - Intergenic
1004079579 6:12378427-12378449 CAGGCAAACCAGAGAGGAACTGG + Intergenic
1004240627 6:13917990-13918012 GAGGAAGAACAGAGAGGACTTGG - Intergenic
1004748980 6:18541207-18541229 CAGGAGGAGGAGGGAGGAGAGGG + Intergenic
1005005991 6:21288172-21288194 TAATAAGACCAAAGAGGAGAAGG - Intergenic
1005496657 6:26393382-26393404 CAGGACCACCAGAAGGGAGAGGG + Exonic
1005505957 6:26468964-26468986 CAGGACCACCAGAGAGGAGAGGG + Exonic
1005893928 6:30162454-30162476 CAGGAAGAGCAGAGATTGGATGG + Intergenic
1005911885 6:30317741-30317763 CAAGAATATCAGAGAGGAAATGG - Intergenic
1006425340 6:33959791-33959813 CAGGAATACCAGACAGGAGCTGG - Intergenic
1006503507 6:34473326-34473348 TAGGAACACGAGAGAGGACATGG + Intronic
1007250168 6:40489955-40489977 CAGAAAGGCCAGAGAGGTCAAGG - Intronic
1007286306 6:40750000-40750022 AAGAGAGACCAGAGATGAGAAGG - Intergenic
1007627275 6:43253668-43253690 CAGGAAGCCCACAGAGTGGATGG - Exonic
1007762078 6:44139082-44139104 GAGGAAGGCAAGAGAGGAGGAGG - Intronic
1008464734 6:51817760-51817782 CAGGAAGCACAAAGATGAGAAGG + Intronic
1008472888 6:51903555-51903577 CAGGAAGACCAGAACTGAGAGGG - Intronic
1008490530 6:52082352-52082374 TAGGAAGACCAGACAGGATGAGG - Intronic
1008496139 6:52136304-52136326 CCTGAGGAACAGAGAGGAGAGGG + Intergenic
1008582880 6:52922299-52922321 CAGCAAGACCAGACCTGAGAGGG - Intergenic
1008914776 6:56775143-56775165 CAGGAAGAACAGAAAGAACAAGG + Intronic
1009284434 6:61798021-61798043 CAGGCTGACTTGAGAGGAGAAGG - Intronic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1010362998 6:75016451-75016473 CAGGAAAATCAGGCAGGAGAAGG + Intergenic
1010678225 6:78768720-78768742 CAGGAGGAAGAGAGAGGAGTGGG - Intergenic
1010869935 6:81024857-81024879 CAGGAAGAGCAGCTAGGAGGGGG + Intergenic
1010887756 6:81264282-81264304 TAGGAAGAAAAGAGAGAAGAAGG + Intergenic
1011175749 6:84558808-84558830 AGGGAAGACTAGAGAGGACAAGG - Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012144852 6:95668602-95668624 CAGGAACAGCAGTGAGAAGAAGG - Intergenic
1012401014 6:98843086-98843108 CAGGAAGACTGGAGAGGAAAGGG + Intergenic
1012471649 6:99579234-99579256 GAGGAAGACCACAGAGGTAAAGG - Intergenic
1013272627 6:108558348-108558370 AAGGAAGGAGAGAGAGGAGAGGG - Intergenic
1013341133 6:109217200-109217222 CAGGGAGAATAGAGAAGAGAAGG - Intergenic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1013667305 6:112361928-112361950 TCGGAAGAACAGAGAGGAGCTGG - Intergenic
1014724006 6:124954268-124954290 AAGGAAGGAGAGAGAGGAGAAGG - Intergenic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015058424 6:128932589-128932611 TAGGAAGGCCAGACATGAGAGGG + Intronic
1015626364 6:135183158-135183180 CAGGTAGCCCAGAGGGGAGGCGG + Intronic
1015791581 6:136969096-136969118 GAGGATGACCAGAGCAGAGAGGG + Intergenic
1015920793 6:138264654-138264676 CAGGGAGTCTAGAGAGGGGAGGG - Intronic
1016091675 6:139986665-139986687 AAGCAAAACCACAGAGGAGAGGG + Intergenic
1016895291 6:149045497-149045519 CACAAAGAACAGAGAGGACATGG + Intronic
1017191460 6:151658355-151658377 CAGGAATACCAGAGGGGAAAAGG - Intronic
1017270947 6:152504474-152504496 CAGGAAGGGTAGGGAGGAGAGGG + Intronic
1017752026 6:157496922-157496944 CAGGAAAAGCAGAGAGGAAGAGG - Intronic
1017876566 6:158529733-158529755 CAGGGAGAGCAGGGAAGAGATGG - Intergenic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1018444558 6:163843295-163843317 AAGCAAGACCAAAGAAGAGAAGG - Intergenic
1018473718 6:164120085-164120107 CAGGACCACCATAGGGGAGAGGG + Intergenic
1018589936 6:165408735-165408757 CTGGAAGGCCAGGGAGAAGAGGG + Intronic
1018812828 6:167309715-167309737 CAGGAAGACAAGAAAGGACGTGG - Intronic
1019313444 7:373914-373936 AAAGAAGAGAAGAGAGGAGAAGG + Intergenic
1019519480 7:1454310-1454332 GAGGAAGACCCCAGCGGAGATGG + Intronic
1019567642 7:1692439-1692461 CAGGCAGAGTAGAGAGGAGTGGG + Intronic
1019572965 7:1721871-1721893 ACTGAAGACCAGAGAGGGGAAGG - Intronic
1019816366 7:3204045-3204067 CAGGAGGAGGAGAGAGGAGGAGG + Intergenic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1019964055 7:4484571-4484593 GAGGAAGAAGAGAGTGGAGAGGG + Intergenic
1020345364 7:7156439-7156461 CAGGAAACTCAGAGACGAGATGG - Intergenic
1020695294 7:11406455-11406477 CAGGAGGCCCAGTGTGGAGAAGG - Exonic
1020730351 7:11871396-11871418 CAGGAAGACCACAGAGGTCAAGG + Intergenic
1021018418 7:15564873-15564895 CAGGAGGACGAGACAGAAGAGGG - Intergenic
1021519811 7:21527748-21527770 CAGGAAGAATAGAGAGCAGGGGG - Intergenic
1022468886 7:30669615-30669637 CAAGAAGACTAGAGAGCAGATGG - Intronic
1022473334 7:30694869-30694891 AAGGAGGAGCAGGGAGGAGAGGG + Intronic
1023119192 7:36892381-36892403 CAGGAAGAGCACAGAGGAGTTGG - Intronic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1024197206 7:47071083-47071105 CAGGGAAACAAGAGAGGAGAGGG + Intergenic
1024661735 7:51501856-51501878 TAGGCAGAGGAGAGAGGAGAAGG + Intergenic
1025033483 7:55575610-55575632 CTGGAAGAGCAGTGAGGAGATGG + Intergenic
1025146158 7:56506175-56506197 CAGGAAGTACAAAGAGGACAGGG - Intergenic
1025233906 7:57220790-57220812 CTGGAGAACCAGAGAGGAGCCGG + Intergenic
1025294234 7:57762917-57762939 CAGGAATATCAGAGAGCAAAAGG + Intergenic
1025869600 7:65418883-65418905 CAGGAAAATCAGGCAGGAGAAGG + Intergenic
1026349676 7:69504699-69504721 AAGGAAGAGGAGAGAAGAGAAGG + Intergenic
1026670625 7:72387574-72387596 GAGGAAGATCACAGAGGGGAAGG - Intronic
1026913713 7:74107314-74107336 CAGGAGGCCAAGGGAGGAGAGGG - Intronic
1027916794 7:84334761-84334783 GAGGAAAACAAGAGAGAAGATGG - Intronic
1029616152 7:101659067-101659089 AAGGAAGACAAGAAAAGAGAGGG - Intergenic
1029647468 7:101867268-101867290 CAGAAAGATCAGAGAAGGGAAGG + Intronic
1030538780 7:110803245-110803267 CAGATAGACCAAAGAAGAGAGGG + Intronic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1033602001 7:142895002-142895024 CAGGCAGACCAAAGTGCAGAAGG + Intergenic
1033898640 7:146108243-146108265 CAGGGAGGAGAGAGAGGAGATGG - Intergenic
1035021261 7:155802202-155802224 CATAAAGACAACAGAGGAGATGG + Exonic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035662596 8:1359248-1359270 CAGGGAGGGCAGCGAGGAGAAGG - Intergenic
1036120027 8:6006216-6006238 CAGGAGGAAGAGAGAGGAGGGGG + Intergenic
1036191102 8:6671163-6671185 TAGGAAGAAAAGAGAGCAGAGGG + Intergenic
1036521363 8:9494493-9494515 CAGTAAGAGCAGAAAGTAGATGG - Intergenic
1036582318 8:10086846-10086868 CAGGCAGAGGAGAGAAGAGAGGG + Intronic
1036616292 8:10390241-10390263 CAGGCAGCCCTGAGAGGAGGGGG + Intronic
1038064429 8:23948598-23948620 CGGGAGTACCAGAAAGGAGAAGG - Intergenic
1038158406 8:25013115-25013137 CAGGGCAATCAGAGAGGAGAAGG + Intergenic
1038309012 8:26431047-26431069 CAGGAAGACAGGAAAGTAGAAGG - Intronic
1038659672 8:29486319-29486341 GATGCAGACCAGAGTGGAGAAGG + Intergenic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039671202 8:39601070-39601092 CAGGAGGAAGAGAGAGGAGGAGG + Intronic
1039792296 8:40885707-40885729 CAGGAATAGCAGCGAGGACAGGG - Intronic
1040719301 8:50297793-50297815 AAGCAAAACCAGAGAGAAGAGGG + Intronic
1040775077 8:51033098-51033120 CAAGAAAACAAGAGAAGAGAGGG - Intergenic
1041044601 8:53878811-53878833 AGGGAAGACCAGAGAAGGGAGGG + Intronic
1041182474 8:55263086-55263108 CAGGAAGCCCAGTGGAGAGAGGG - Intronic
1041963566 8:63648388-63648410 CAGGAAGACAAGAGAAGGGGAGG - Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1042896170 8:73670540-73670562 CAGGCATACCTGAGAGGAAAAGG + Intronic
1043770575 8:84194249-84194271 CAGGATGACAAGTGAGGAGGTGG + Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044108437 8:88240444-88240466 CAGCAAGGACAGAGTGGAGAGGG + Intronic
1044189463 8:89297660-89297682 CAGGAACAAGAGAGGGGAGAAGG + Intergenic
1044693565 8:94901318-94901340 CAGGGAGACTGGATAGGAGATGG + Intronic
1045191562 8:99889264-99889286 CTGGGAGAGCAAAGAGGAGATGG - Intronic
1045209880 8:100086074-100086096 CAGGTAGACAAGGGAGAAGAGGG + Intronic
1046577333 8:116047261-116047283 TAAGAGGACCAGAGAGTAGAGGG + Intergenic
1046612888 8:116445254-116445276 CAGGAGGAGGAGAGAGGAGGGGG + Intergenic
1047517844 8:125570374-125570396 CAGGATGACCAGACAATAGAAGG + Intergenic
1048041159 8:130729910-130729932 GAGGCAGACCAAAGAGGAAAAGG + Intergenic
1048355881 8:133653788-133653810 AAGGAAAACCAGAGAGGGAAGGG + Intergenic
1048531580 8:135254850-135254872 CAGAAGCAGCAGAGAGGAGAAGG + Intergenic
1048842752 8:138579675-138579697 GATGAAGCCCAGAGAAGAGAAGG - Intergenic
1049513692 8:143042715-143042737 CAGGTAGCCCAGAGAGCTGAGGG + Intronic
1049715008 8:144085668-144085690 CAGGAAGCCCAGTGAGAAGTTGG - Exonic
1049839434 8:144761632-144761654 CAGGAGGAAGAGAGAAGAGAGGG - Intergenic
1049990054 9:981934-981956 CAGGAAGAGCAGAGAGGGAGTGG - Intronic
1050259649 9:3828061-3828083 CAGGAAAACCAGAGAGAAAAAGG + Exonic
1051047751 9:12895506-12895528 CATGGAGACAAGAGAGTAGAAGG + Intergenic
1052013764 9:23441982-23442004 CATGAAGACAAGAGCAGAGATGG + Intergenic
1052104749 9:24499289-24499311 GAAGGACACCAGAGAGGAGAAGG + Intergenic
1052364315 9:27595186-27595208 CAGGACGACTAGATGGGAGAGGG + Intergenic
1052409429 9:28104136-28104158 CAAGAAGGACAGAGAGGAGTAGG - Intronic
1052464415 9:28812178-28812200 CAGGAACTAAAGAGAGGAGAAGG + Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053010671 9:34631042-34631064 CTGGAAGACTGGAGAGCAGAGGG + Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053238839 9:36479515-36479537 CCAGAAGACCAGGGAGCAGAAGG + Intronic
1053278555 9:36801472-36801494 CAGGAAGAGCAAAGAGAAGATGG + Intergenic
1053313081 9:37031716-37031738 AAGGAAGACATTAGAGGAGAAGG + Intronic
1053466980 9:38315895-38315917 ACGGAAGTCCAGAGAGGAGTAGG - Intergenic
1053517038 9:38739366-38739388 CTGGAAGCTCTGAGAGGAGATGG + Intergenic
1053657231 9:40230030-40230052 AAGGAAGAGCACTGAGGAGAAGG - Intronic
1054095272 9:60894903-60894925 CAGGAACATGGGAGAGGAGATGG + Intergenic
1054527363 9:66146196-66146218 AAGGAAGAGCACTGAGGAGAAGG + Intronic
1054729371 9:68685304-68685326 GATGAAGATCAGAGAGAAGAGGG - Intergenic
1055084167 9:72297266-72297288 CAGGAAAAACTGAGAGGAGGAGG - Intergenic
1055554335 9:77460007-77460029 CAGGGAGACCAAAGCAGAGAGGG - Intronic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056098229 9:83275665-83275687 TAGGTAAATCAGAGAGGAGATGG - Intronic
1056446675 9:86673238-86673260 CAGGAAACCCAGAGCTGAGATGG + Intergenic
1056807379 9:89739452-89739474 CAGAAAAACCAGAGAGGAAGTGG + Intergenic
1057112492 9:92486585-92486607 CAGGAAGAGCTGTGAGGAGAGGG - Intronic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057355222 9:94326381-94326403 AAGGAAGACTGAAGAGGAGATGG - Intronic
1057652530 9:96931253-96931275 AAGGAAGACTGAAGAGGAGATGG + Intronic
1057758908 9:97857343-97857365 AATGACGACCCGAGAGGAGAAGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1057952992 9:99384975-99384997 CAGAAAGACCACTGGGGAGATGG + Intergenic
1058006999 9:99927138-99927160 AGAGAATACCAGAGAGGAGAAGG - Intronic
1058378794 9:104356209-104356231 GAGGAATACAAGAGAGGAGCGGG + Intergenic
1059012476 9:110477098-110477120 CTGGAATACAAGAGAGAAGAGGG - Intronic
1059327975 9:113516142-113516164 CAGGGAGACCAGAGAGGCACAGG - Intronic
1059901313 9:118929206-118929228 AAGAAAGAACAGAGAGTAGAGGG - Intergenic
1060229190 9:121814454-121814476 AGGGAAGCCCAGAGAGGGGAGGG - Intergenic
1060291517 9:122307237-122307259 CCGGAAGCCCAGGGAGGAGGTGG + Intronic
1060413891 9:123417469-123417491 CAGGAGGCCCAGAGAGGTTAAGG + Intronic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1061255396 9:129452185-129452207 CAGGAAGGGCAGAGAGAAGGCGG + Intergenic
1061332548 9:129905086-129905108 CATGAAGTCAAGAGACGAGACGG - Intronic
1061750448 9:132773336-132773358 CAGGAAGGCTGGAGAGGACAGGG - Intronic
1062283165 9:135760873-135760895 GGGGAAGACCAAAGAGGAGCGGG - Intronic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1185648018 X:1628812-1628834 AAAGAAGACGGGAGAGGAGAAGG - Intronic
1186172280 X:6890072-6890094 CAGGAAGACAAGAGAAAATATGG + Intergenic
1186363750 X:8870410-8870432 AAGGAAGAGAAGAGGGGAGAAGG + Intergenic
1186581307 X:10822032-10822054 GTGGAAGACCAGAGAGGTCAGGG - Intronic
1186623512 X:11266618-11266640 CATGAAGAGCAGAGAGAAAAGGG + Intronic
1186689708 X:11962329-11962351 CAGGAAGAGCAGAAGGGAAAAGG + Intergenic
1186994787 X:15108494-15108516 CAGGAAGACCTGAGGAGAGGGGG - Intergenic
1187168533 X:16827915-16827937 CTGGAAGAGGAGAGAAGAGAAGG + Intronic
1187501302 X:19841213-19841235 CAGGAAGGACAGTGAGCAGAGGG - Intronic
1187670916 X:21665144-21665166 CTGAAAGACCAGAGGGGTGAAGG - Intergenic
1187777269 X:22775380-22775402 CTGCAAGACTAGAGTGGAGAGGG - Intergenic
1188092056 X:25976627-25976649 CAGGAAGAGCAGTGTGGTGAGGG + Intergenic
1188385099 X:29546788-29546810 CAGGAATATGGGAGAGGAGAAGG - Intronic
1188976864 X:36686158-36686180 CAGACAGAGCAGAGTGGAGATGG - Intergenic
1189069797 X:37851235-37851257 CAGGAAGAAGAGAGAGAGGAGGG - Intronic
1189110513 X:38285812-38285834 CAGGAGGAACAGAGAAGAGGAGG - Exonic
1190569922 X:51770457-51770479 CAGGAAGCACATATAGGAGATGG + Intergenic
1191841838 X:65518868-65518890 CAGCTAGGCCAGAGAAGAGAGGG - Intronic
1191859723 X:65656479-65656501 CAGCTAGGCCAGAGAAGAGAGGG - Intronic
1191920551 X:66252219-66252241 AAGGAAGACTGAAGAGGAGAAGG + Intronic
1192040476 X:67615382-67615404 CAGAAATAACAGAGAGCAGAAGG + Intronic
1192279977 X:69674845-69674867 CATGAAGCCAAGAGAGTAGAAGG - Intronic
1192352140 X:70365236-70365258 CAGGGAAATCAGACAGGAGAAGG - Intronic
1193486581 X:82091339-82091361 CAGGAAAACCATATAGGAGCTGG - Intergenic
1194023213 X:88720076-88720098 GAGGACTACCAGACAGGAGAGGG - Intergenic
1194340065 X:92696505-92696527 CAGGGAGACAGGAAAGGAGAAGG - Intergenic
1195146464 X:102022234-102022256 CAGGAAGAAGAGAGTGAAGAGGG - Intergenic
1195681112 X:107547343-107547365 GAGGAAGAGAAGAGAGGGGAGGG - Intronic
1195777867 X:108427577-108427599 CATGAGGACAAGACAGGAGATGG + Intronic
1196245631 X:113396094-113396116 GAAGAAGATCAGAGAGGAGAAGG - Intergenic
1197536738 X:127698495-127698517 AAGGAAGACTAGAGAGGTGGGGG - Intergenic
1197906080 X:131427276-131427298 CAGGAGGAGGAGAGAGGAGGAGG - Intergenic
1198746469 X:139896252-139896274 GAGGAAGACCAGGGAGGTGAAGG - Intronic
1198763916 X:140062031-140062053 CAGGAAGACCAGACAAGAAAAGG + Intergenic
1199171665 X:144740704-144740726 AAGGAAGTTCAGAGAGCAGAGGG - Intergenic
1199587845 X:149435234-149435256 CAGGAAGATCAAAGAGTAGGAGG - Intergenic
1199700643 X:150373148-150373170 CAGGAAGAGCAGGCAGGAGGAGG - Intronic
1199778578 X:151037568-151037590 CAGGAAGCCCAGTGGGCAGAAGG + Intergenic
1199912316 X:152299990-152300012 GGGGAATACCAGAGTGGAGATGG + Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200088591 X:153623957-153623979 CAGGAGAGACAGAGAGGAGAAGG + Intergenic
1200101178 X:153689658-153689680 TAGGAGGCCCAGAGAGGAGAAGG + Intronic
1200224283 X:154408728-154408750 AAGGGAAACCAGAGACGAGAGGG - Intronic
1200239711 X:154487059-154487081 CAGCCAGACCAGAAAGGAGGAGG - Intergenic
1200775248 Y:7164691-7164713 GAGGAAGATGAGAAAGGAGAAGG - Intergenic
1200866265 Y:8047002-8047024 GAAGAAGGCCAGACAGGAGAGGG - Intergenic
1201770648 Y:17614354-17614376 CAGAAAGACCAGGGCAGAGAGGG - Intergenic
1201830907 Y:18291632-18291654 CAGAAAGACCAGGGCAGAGAGGG + Intergenic