ID: 1083992865

View in Genome Browser
Species Human (GRCh38)
Location 11:66257712-66257734
Sequence CTACCTCGGTGGCGTCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992865_1083992872 -6 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992872 11:66257729-66257751 AGGTAGCGGCTTCACCTTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1083992865_1083992879 12 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992879 11:66257747-66257769 TAAGGCGGCGCGGGGGCTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 178
1083992865_1083992873 -3 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992873 11:66257732-66257754 TAGCGGCTTCACCTTTAAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 54
1083992865_1083992881 17 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG 0: 1
1: 1
2: 20
3: 126
4: 625
1083992865_1083992875 3 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992875 11:66257738-66257760 CTTCACCTTTAAGGCGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1083992865_1083992882 21 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769
1083992865_1083992884 25 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513
1083992865_1083992885 29 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349
1083992865_1083992876 4 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37
1083992865_1083992877 5 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1083992865_1083992883 24 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374
1083992865_1083992874 2 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28
1083992865_1083992880 13 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992865 Original CRISPR CTACCTCGGTGGCGTCGGAG GGG (reversed) Intronic
902746355 1:18477114-18477136 CTAACTTGGTGGCATCTGAGAGG + Intergenic
904688180 1:32275304-32275326 CCACCTCCGTGGCGCAGGAGCGG + Exonic
909052875 1:70788437-70788459 CTACCTTGGTGGAGTCTTAGTGG + Intergenic
912736171 1:112151372-112151394 CTAACTGGGTGGGGTGGGAGTGG + Intergenic
912831240 1:112955960-112955982 CTGCCCTGGTGGGGTCGGAGGGG - Exonic
1063559453 10:7112828-7112850 CTGCCTTGGTGGGGTGGGAGAGG + Intergenic
1065916570 10:30358431-30358453 CTGCCTAGGTGCCGTGGGAGAGG + Intronic
1076031635 10:127164065-127164087 CAACCTGGGTGGCGTCCCAGGGG + Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077200647 11:1305837-1305859 CCACCGCGGTGCCGTCAGAGAGG - Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1101320136 12:103666126-103666148 CTCCCACGGTGGAGTCGGTGTGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1121753734 14:96383299-96383321 CTACCTGGGAGGCTTAGGAGGGG + Intronic
1129210413 15:74064890-74064912 CTGCCTGGGTGCCGTGGGAGAGG + Intergenic
1129403601 15:75300483-75300505 CTGCCTGGGTGCCGTGGGAGAGG - Intergenic
1130485471 15:84396045-84396067 CTGCCTGGGTGCCGTGGGAGAGG - Intergenic
1133028506 16:2998779-2998801 CCTCCTGGGTGGCGTCGGTGAGG + Intergenic
1139775925 16:69317010-69317032 GTATCTCGGAGGCGTGGGAGGGG + Intronic
1146774156 17:35597082-35597104 CTGCCTCAGTGGCCCCGGAGCGG - Intronic
1150003460 17:61455920-61455942 CTACCTCAGTGCTGTCTGAGGGG + Intronic
1150438733 17:65174279-65174301 CTGCCTCGGTGACTTCGGTGTGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1157413726 18:47485187-47485209 CTGCCTTGGTGGGGTGGGAGGGG - Intergenic
1162931742 19:13961026-13961048 CTACCTCCGTGGCCTGGGACCGG + Exonic
1166130863 19:40744786-40744808 CTCCCTCGCTGGCCTGGGAGAGG - Intronic
1168536819 19:57177729-57177751 CTACCTCAGTGGCCTGGGAGGGG - Intergenic
934987579 2:98899110-98899132 CTGCCTTGGTGGGGTGGGAGGGG - Intronic
941570001 2:167158958-167158980 CTACCTCTGGGGGGTAGGAGGGG + Intronic
1174346772 20:49936274-49936296 CTAGCTCGCTTGCGTCAGAGGGG + Intergenic
950050706 3:9986872-9986894 GCACCTCAGTGGCGTCAGAGCGG + Exonic
950056152 3:10026401-10026423 GCGCCTCGGTGGCGTCAGAGCGG + Exonic
966982660 3:185152791-185152813 CGGCCTCGCCGGCGTCGGAGCGG - Exonic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
969311286 4:6354220-6354242 CCTCCTCGGTGGGGTGGGAGAGG - Intronic
1018910072 6:168096699-168096721 CTTCCTAGGTGGCATCAGAGCGG + Intergenic
1034215223 7:149400480-149400502 GTACCTCGGTGGGGAAGGAGAGG - Intergenic
1036789513 8:11708705-11708727 CTACAGCAGTGGCGGCGGAGCGG + Exonic
1061662801 9:132141505-132141527 CTACCTGGCTGGGGTGGGAGGGG - Intergenic
1062189812 9:135242229-135242251 CTGCCTGGGTGGCCTTGGAGGGG - Intergenic
1192213307 X:69141300-69141322 CAACCTCAGTGGCATCAGAGTGG - Intergenic
1194401800 X:93446605-93446627 CTTCCTGGGTGGCCTCTGAGTGG + Intergenic