ID: 1083992872

View in Genome Browser
Species Human (GRCh38)
Location 11:66257729-66257751
Sequence AGGTAGCGGCTTCACCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992866_1083992872 -7 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992872 11:66257729-66257751 AGGTAGCGGCTTCACCTTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1083992862_1083992872 14 Left 1083992862 11:66257692-66257714 CCAAGAGAAGCGTGTTTCGCCCC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1083992872 11:66257729-66257751 AGGTAGCGGCTTCACCTTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1083992867_1083992872 -8 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992872 11:66257729-66257751 AGGTAGCGGCTTCACCTTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1083992864_1083992872 -5 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992872 11:66257729-66257751 AGGTAGCGGCTTCACCTTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 47
1083992865_1083992872 -6 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992872 11:66257729-66257751 AGGTAGCGGCTTCACCTTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992872 Original CRISPR AGGTAGCGGCTTCACCTTTA AGG Intronic
903607818 1:24587853-24587875 AGGTAGCAGATTTACCTTTGTGG + Intronic
907645866 1:56242789-56242811 TGGTAGCTGCTTTACCTTTCTGG + Intergenic
915216617 1:154344680-154344702 AGGCAACGGCTTCACCTATCAGG + Exonic
1067685103 10:48462028-48462050 AGGAAGAGTCTTCACCTTTCAGG - Intronic
1075340323 10:121642497-121642519 AGGTAAGCTCTTCACCTTTAAGG - Intergenic
1081869809 11:46378222-46378244 AGGGAGAGGCCTCACCTTGAGGG - Exonic
1083992872 11:66257729-66257751 AGGTAGCGGCTTCACCTTTAAGG + Intronic
1102935445 12:116892641-116892663 AGGTCTCTGCTTCACCATTATGG + Intergenic
1110588560 13:77225414-77225436 AGGTAGCGGCTGGAACTTTAGGG - Exonic
1117746783 14:58877828-58877850 AGGTATTGGCATCTCCTTTAAGG + Intergenic
1130977897 15:88791297-88791319 AGCAAGCTGCTTCACCTTTCTGG + Intergenic
1136121358 16:28137312-28137334 AGGAAGTGGCTTCACCCCTAAGG - Intronic
1141294839 16:82758023-82758045 AGGTAATGGCTTTACCTTTCAGG + Intronic
1143639980 17:8190189-8190211 AGGCAGTGGCTGCGCCTTTAAGG + Exonic
1151027483 17:70695710-70695732 GGGTATCGGCTTCAACTTAAAGG - Intergenic
1151983902 17:77529702-77529724 AGGTACTGGCTTTATCTTTAAGG - Intergenic
1158737941 18:60105047-60105069 AGGTAGCAGCATCACCTGAAGGG - Intergenic
1159183493 18:64941917-64941939 CAGTAGCAGCTTCACCTATATGG + Intergenic
1160590235 18:79940532-79940554 TGTCAGCGGCGTCACCTTTAAGG - Intronic
928076632 2:28271166-28271188 AGGCAGCTGCTTCACATATATGG + Intronic
935099881 2:99983525-99983547 AGGCAGCGACTTGACCTTCAAGG + Intronic
937036312 2:118785580-118785602 AGAGAGAGGCTTCAACTTTATGG - Intergenic
1175214386 20:57383630-57383652 AGGTTGTGGCTGCACCTTTGAGG + Intergenic
1177559975 21:22738170-22738192 AGGTTGCAGCTTCAGTTTTAGGG - Intergenic
1178661424 21:34510606-34510628 AGGTAGAGGCTGAAGCTTTAAGG - Intergenic
1179078288 21:38144369-38144391 AGGTAGCAGCTTTACTTTCAGGG - Intronic
1183649066 22:39144085-39144107 AGGTAGAGGCCTCAGCTCTAGGG - Intronic
953268734 3:41418813-41418835 AGGGAGGGGCTTCACCTGTGTGG - Intronic
963560070 3:146854045-146854067 AGGAAGCTGCTTCACCCTTCAGG - Intergenic
974049860 4:56930732-56930754 AGGTGGCGGCTCCACCTGAACGG - Exonic
976288450 4:83392855-83392877 AGGAAGCGGCTTCTCCTCTAGGG - Intergenic
984755637 4:183323548-183323570 GGGGAGTGGCTCCACCTTTAGGG - Intergenic
985490546 5:176027-176049 AGGTGGTGGCTTCACCTGGAGGG - Intronic
989345441 5:40424464-40424486 AGGCAACAGCTTCACCTTCAAGG + Intergenic
993701710 5:91126564-91126586 AGGTACCGGCTTTACCTTCCTGG - Intronic
995270980 5:110219682-110219704 AGCTGGGGGCTTCACTTTTAGGG + Intergenic
1006876246 6:37299641-37299663 GGGAAGCAGCTTCTCCTTTAGGG + Intronic
1007093796 6:39200942-39200964 AGGTGGGGGCTTCCCCTTTACGG + Intronic
1013290324 6:108713736-108713758 ACGTAGCTGCTTCCCCTTTCAGG + Intergenic
1015614750 6:135063181-135063203 AGGTAGCTGCTTCAATTCTATGG + Intronic
1017518009 6:155174940-155174962 AGGTGGGGCCTGCACCTTTAAGG + Intronic
1018608973 6:165627897-165627919 AGTAAGTGGCTTCAGCTTTATGG - Intronic
1026059321 7:67011937-67011959 AGGTAGTATCTTCACCTTTGTGG + Intronic
1026718773 7:72813102-72813124 AGGTAGTATCTTCACCTTTGTGG - Intronic
1042572778 8:70184810-70184832 AGGCCGCTGCTTCACCTTAATGG + Intronic
1048793902 8:138130646-138130668 TGGTAGCAGCTTCTCCTTTCTGG - Exonic
1057077736 9:92147748-92147770 AGGTAGCTGCTGCAGCTTTCAGG + Intergenic
1057533946 9:95879693-95879715 AGTTAGTGGCTTTACTTTTAAGG + Intronic
1057757959 9:97852583-97852605 AGGTAGCCGCTTTCCCTTTTTGG - Intergenic
1195139407 X:101943920-101943942 AGGTACCGGTTCCAGCTTTATGG + Intergenic
1196799684 X:119531388-119531410 AGGAAGCTACTTCACCTCTAGGG - Intergenic