ID: 1083992873

View in Genome Browser
Species Human (GRCh38)
Location 11:66257732-66257754
Sequence TAGCGGCTTCACCTTTAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992869_1083992873 -8 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992873 11:66257732-66257754 TAGCGGCTTCACCTTTAAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 54
1083992862_1083992873 17 Left 1083992862 11:66257692-66257714 CCAAGAGAAGCGTGTTTCGCCCC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1083992873 11:66257732-66257754 TAGCGGCTTCACCTTTAAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 54
1083992865_1083992873 -3 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992873 11:66257732-66257754 TAGCGGCTTCACCTTTAAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 54
1083992867_1083992873 -5 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992873 11:66257732-66257754 TAGCGGCTTCACCTTTAAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 54
1083992866_1083992873 -4 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992873 11:66257732-66257754 TAGCGGCTTCACCTTTAAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 54
1083992864_1083992873 -2 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992873 11:66257732-66257754 TAGCGGCTTCACCTTTAAGGCGG 0: 1
1: 0
2: 1
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992873 Original CRISPR TAGCGGCTTCACCTTTAAGG CGG Intronic
903348312 1:22702117-22702139 TAGCTGATTCACATTTAAAGAGG - Intergenic
904106449 1:28088847-28088869 TACAGCCTTCACTTTTAAGGAGG + Intergenic
905775146 1:40663534-40663556 TAGCAGCTGGCCCTTTAAGGAGG - Intronic
907703740 1:56814997-56815019 GAGAGGCTTCACCTCTAAGATGG - Intronic
909644450 1:77900870-77900892 TTGCTGCTGCCCCTTTAAGGTGG + Intronic
909644505 1:77901622-77901644 TTGTGGCTGCCCCTTTAAGGTGG + Intronic
916332210 1:163629437-163629459 TAGCTACTCCACCTTTAAAGAGG - Intergenic
1063196241 10:3746597-3746619 TAGCGTCTTCATGTTTAAGGTGG - Intergenic
1071232694 10:83607124-83607146 TAGCTTCTTCACCTATAAAGTGG + Intergenic
1073502063 10:103948938-103948960 TAGCTTCTTCACCTCTAAAGTGG - Intergenic
1079593653 11:22213710-22213732 TAATGGATTCACCTATAAGGAGG - Intronic
1083992873 11:66257732-66257754 TAGCGGCTTCACCTTTAAGGCGG + Intronic
1085705004 11:78779027-78779049 TGGCTGCTTCACCTGTAGGGAGG - Intronic
1087100237 11:94356808-94356830 TAGCTACTTCACCTTCAAGAAGG + Intergenic
1088857493 11:113769674-113769696 TAGTGGCTTCACGTTTGAGTTGG + Intronic
1107974157 13:45673450-45673472 GAGCGGTGGCACCTTTAAGGTGG - Intergenic
1125191408 15:36998130-36998152 TATGGGATCCACCTTTAAGGAGG - Intronic
1128314564 15:66652540-66652562 TTGGGGGTTGACCTTTAAGGAGG + Intronic
1129734003 15:77949583-77949605 TAGAGGCTTCAACTGGAAGGAGG + Intergenic
1129841579 15:78746409-78746431 TAGAGGCTTCAACTGGAAGGAGG - Intergenic
1134415401 16:14039167-14039189 TAGTGGATCCACCTTTCAGGTGG + Intergenic
1135067474 16:19322701-19322723 TAAAGCCTTCTCCTTTAAGGGGG - Intergenic
1135462295 16:22655264-22655286 TAGAGACATTACCTTTAAGGAGG + Intergenic
1138095233 16:54206200-54206222 TAGCCTCTTCTCCTTTAAGTGGG + Intergenic
1142350616 16:89577661-89577683 CAGCGGCTTCAGCTGTCAGGAGG + Exonic
1144754165 17:17669384-17669406 TATCTGCTTCTCCTTTAACGGGG - Intergenic
1159885124 18:73896414-73896436 TAGCCTCTTCACCTTTCAGCTGG - Intergenic
1160285623 18:77540196-77540218 CAAGGGCTTCACCTTGAAGGAGG - Intergenic
925775651 2:7332928-7332950 CAGTGACTTCACCTTTTAGGAGG + Intergenic
939428885 2:142076633-142076655 TAGCTGCTTCTTCTTTAAAGTGG + Intronic
948227275 2:236320930-236320952 TGGCGGCCTCACCTTCCAGGAGG + Intergenic
1178661423 21:34510603-34510625 TAGAGGCTGAAGCTTTAAGGAGG - Intergenic
1178661723 21:34512103-34512125 CAGCGGCTCAGCCTTTAAGGAGG + Intergenic
951401091 3:22232004-22232026 TAGTGGCTTCTCCTTTTGGGGGG - Intronic
952712122 3:36442365-36442387 AAGTCACTTCACCTTTAAGGTGG - Intronic
956674034 3:71718073-71718095 TAAAGTCTTCCCCTTTAAGGTGG - Intronic
960354423 3:116633567-116633589 TAGATACTTCACCCTTAAGGAGG + Intronic
965053352 3:163680947-163680969 TAGAGACTTTACCCTTAAGGAGG + Intergenic
970238369 4:13981808-13981830 CAGCAGCTTTCCCTTTAAGGAGG - Intergenic
975680976 4:76875753-76875775 TAGATGCTCCACCCTTAAGGTGG - Intergenic
976163316 4:82227326-82227348 AAGCTGCTTCACCTGCAAGGAGG + Intergenic
976163321 4:82227382-82227404 AAGCTGCTTCACCTGTGAGGAGG + Intergenic
979776878 4:124600427-124600449 TAGATACTTCACCTTTAAGGAGG + Intergenic
982919926 4:161260308-161260330 ATGCGGCTTCATTTTTAAGGAGG - Intergenic
1003992520 6:11499907-11499929 AAGGGGCTTGACCTTCAAGGAGG - Intergenic
1008628850 6:53345004-53345026 TAGCTGCTTCACCTTTAAGAAGG - Intronic
1022438141 7:30409742-30409764 AAGTGGCTTCAGCTTTAAAGTGG - Intronic
1037039557 8:14213907-14213929 TAGCTACTTTACCCTTAAGGTGG + Intronic
1037464501 8:19146828-19146850 CTGGGGCTTCACATTTAAGGAGG + Intergenic
1039584089 8:38691101-38691123 AAGAGCCTTCACCTTCAAGGAGG - Intergenic
1053257136 9:36627215-36627237 TTTCCACTTCACCTTTAAGGTGG - Intronic
1059399051 9:114057359-114057381 TGGCGGCTTCACCTCTTAAGGGG - Intergenic
1060051611 9:120382428-120382450 TTCCAGCCTCACCTTTAAGGTGG - Intergenic
1187071403 X:15892391-15892413 TAGCGGCTTCCACTTTTAGGGGG + Intergenic
1187293883 X:17980709-17980731 TGGTAGCTTCACCTTTAAAGAGG + Intergenic
1190474570 X:50813937-50813959 CTGGGGCTTCACCCTTAAGGGGG - Exonic
1192508605 X:71707897-71707919 TAGCGGCTTCTGCTTCTAGGAGG + Intergenic
1192518092 X:71773656-71773678 TAGCGGCTTCTGCTTCTAGGAGG - Intergenic
1196160355 X:112475978-112476000 TAGAGGCTTGACCTTTAATTAGG + Intergenic