ID: 1083992874

View in Genome Browser
Species Human (GRCh38)
Location 11:66257737-66257759
Sequence GCTTCACCTTTAAGGCGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992865_1083992874 2 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28
1083992867_1083992874 0 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28
1083992864_1083992874 3 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28
1083992866_1083992874 1 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28
1083992870_1083992874 -9 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28
1083992862_1083992874 22 Left 1083992862 11:66257692-66257714 CCAAGAGAAGCGTGTTTCGCCCC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28
1083992869_1083992874 -3 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992874 Original CRISPR GCTTCACCTTTAAGGCGGCG CGG Intronic
905205738 1:36341967-36341989 CCTTCGCCTTTGAGGCGGGGAGG + Exonic
920311122 1:205048861-205048883 GCCTCACCTTTAGGGAGGCAAGG + Intronic
921944865 1:220879620-220879642 GCCTCGCTTTAAAGGCGGCGCGG - Exonic
1083992874 11:66257737-66257759 GCTTCACCTTTAAGGCGGCGCGG + Intronic
1084026611 11:66454351-66454373 GCTTCACCACAAAGGGGGCGTGG - Intronic
1129377743 15:75144917-75144939 GCCTCACCTTGAAGCTGGCGAGG - Intergenic
1134419285 16:14071203-14071225 GCTTGACCCTTGAGGCGGGGTGG + Intergenic
1137593151 16:49706229-49706251 GCTTCACCTTTGATGGGGAGTGG - Intronic
1139529449 16:67535878-67535900 GCTTCGCCTTCAAGGAGGAGGGG + Intronic
1146298839 17:31672455-31672477 CCATCACCTTTAAGGCTGGGGGG - Intergenic
1157006435 18:43589695-43589717 GCTCCACCTTCAAGCCGGGGAGG - Intergenic
936736540 2:115449736-115449758 GCTTCACCTTTACAGCAGTGTGG - Intronic
939922990 2:148139850-148139872 GCTTGACCTTAAAGGCTGAGAGG - Intronic
947523514 2:230865427-230865449 CCTCCCCCTATAAGGCGGCGAGG - Intronic
1176171513 20:63698407-63698429 GCTTCAGCTGCAAGGCCGCGCGG - Exonic
1185143026 22:49113955-49113977 GCTTCACCTTGAAGGGGCCGTGG - Intergenic
952905437 3:38136858-38136880 GCCTCACCTTGAAGCCGCCGCGG + Exonic
964435273 3:156644514-156644536 GCTTCACCTGAAAGGCGGTCTGG - Intergenic
965813433 3:172614363-172614385 GCCCCACCTTTAAGCCGGGGAGG - Intergenic
971230885 4:24799698-24799720 GCTGCACCTGGCAGGCGGCGTGG - Exonic
979776880 4:124600432-124600454 ACTTCACCTTTAAGGAGGGAAGG + Intergenic
984778480 4:183504549-183504571 GCTTCCCCTTTAAGGGGGGCGGG + Intergenic
1000198016 5:158978479-158978501 CCTTAACCTTTAAGGCAGCAAGG + Intronic
1013459680 6:110363381-110363403 GCTACACCTTTAGGGTGGAGAGG - Intergenic
1026844346 7:73689562-73689584 GCTGCACCTTGAAGGCTGGGAGG + Intronic
1027233335 7:76284131-76284153 GCTTCTCCTTCAAGGCGGTCTGG - Intronic
1047951660 8:129940045-129940067 GCTGCCCCTTTAAGGAGGCCGGG - Intronic
1059200845 9:112414760-112414782 GCTTCACTTTTATGGAGGTGAGG - Intronic
1061843950 9:133376305-133376327 GCGTCCCTTTTAAGGGGGCGGGG + Intergenic
1190415953 X:50180668-50180690 GCTGCAGCTTTAAGGGGGAGGGG + Intergenic