ID: 1083992876

View in Genome Browser
Species Human (GRCh38)
Location 11:66257739-66257761
Sequence TTCACCTTTAAGGCGGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 37}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992870_1083992876 -7 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37
1083992864_1083992876 5 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37
1083992866_1083992876 3 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37
1083992865_1083992876 4 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37
1083992862_1083992876 24 Left 1083992862 11:66257692-66257714 CCAAGAGAAGCGTGTTTCGCCCC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37
1083992869_1083992876 -1 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37
1083992867_1083992876 2 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37
1083992871_1083992876 -10 Left 1083992871 11:66257726-66257748 CCGAGGTAGCGGCTTCACCTTTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG 0: 1
1: 0
2: 1
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992876 Original CRISPR TTCACCTTTAAGGCGGCGCG GGG Intronic
907140201 1:52179342-52179364 GTCACATTTAAGGCCGGGCGTGG + Intronic
910962898 1:92781138-92781160 TTCACTTTTTAGGCCGGGCGTGG - Intronic
916814252 1:168336553-168336575 TTAACCTTTAAGGCTGGGCTCGG - Intergenic
1082836677 11:57656114-57656136 ATCACATTTAAGGCAGGGCGTGG - Intronic
1083992876 11:66257739-66257761 TTCACCTTTAAGGCGGCGCGGGG + Intronic
1097045717 12:56186638-56186660 TTCAGCTTTGAGGCCGGGCGTGG - Intronic
1100572797 12:95858805-95858827 TGCGCCTTGCAGGCGGCGCGCGG - Intergenic
1129906301 15:79190026-79190048 TTCCCCTTGAAGGCAGCGAGAGG + Intergenic
1142501606 17:336269-336291 TCCACCTGTCAGGCGGCGCTGGG + Intronic
1144880486 17:18428169-18428191 TTCTCCTTTAAGGCTGAGCCTGG + Intergenic
1145151749 17:20516218-20516240 TTCTCCTTTAAGGCTGAGCCTGG - Intergenic
1146163118 17:30570499-30570521 TTCTCCTTTAAGGCTGAGCCTGG - Intergenic
1152808062 17:82366856-82366878 TTCACATTTCAGGCCGGGCGCGG - Intergenic
1165879656 19:39032880-39032902 ATCACCTTTAAGGTCGGGCGTGG + Intergenic
1168691685 19:58381178-58381200 TACACCTAAAAGGCGGGGCGTGG + Intergenic
926102201 2:10125413-10125435 GTCAGCTTTAGGGTGGCGCGCGG + Intronic
931389531 2:61829126-61829148 TTCACCTTTGAGGCGGGGGCCGG - Intronic
943925965 2:193780217-193780239 TTCCCCTTTAAGGCCGGGCGCGG - Intergenic
947523512 2:230865425-230865447 TCCCCCTATAAGGCGGCGAGGGG - Intronic
968696980 4:2035648-2035670 TTCACCCTTTAGGCCGGGCGCGG - Intronic
968848815 4:3063667-3063689 TTCACCTCCAAGCCGGAGCGTGG - Intergenic
977818472 4:101443471-101443493 GACACCTTTAAGGCCGGGCGCGG - Intronic
987664939 5:20924834-20924856 GTTACCTTTAAGGCCGGGCGAGG - Intergenic
988757747 5:34277330-34277352 GTTACCTTTAAGGCCGGGCGTGG + Intergenic
990761780 5:59137814-59137836 TTCCCCCTTAAGGCTGGGCGTGG - Intronic
995505930 5:112860772-112860794 TTCACCTTTTAGGCCGGGTGCGG - Intronic
997550098 5:134745145-134745167 TTCACCTTTGAGGCGGGGCGCGG + Intronic
1003633312 6:7808208-7808230 TTAACATTTAAGGCCGGGCGCGG - Intronic
1024259601 7:47563901-47563923 TTAACATTTAAGGCCGGGCGCGG + Intronic
1028902185 7:96113852-96113874 TACACCTTTGAGGCCGGGCGCGG - Intergenic
1036388450 8:8303454-8303476 TTCACCTTCAAGGCTGGGTGAGG + Intergenic
1038832547 8:31077530-31077552 TTCATCTTTCAGGCTGGGCGCGG - Intronic
1045201406 8:99985742-99985764 TTCTCCTTTAAGGCTGCCCTTGG - Intronic
1048002046 8:130386552-130386574 TTCACCAGTAAAGCGACGCGTGG - Intronic
1050512845 9:6413118-6413140 TTCCTCTTTAAGGCGGAGCCCGG + Intergenic
1053251002 9:36573795-36573817 TTCCCCTTTTAGGCCGGGCGTGG - Intronic
1055895918 9:81175518-81175540 TTCACCTTTAAGCTGGGGTGAGG + Intergenic
1060287299 9:122265061-122265083 TTGACCTTTAAGGCTGAGGGCGG + Intronic
1061731670 9:132619499-132619521 TTCACCTTTAAGGCTGACAGAGG + Intronic
1198887895 X:141359370-141359392 TTCACCTTTCAGGCCGGGCACGG - Intergenic