ID: 1083992877

View in Genome Browser
Species Human (GRCh38)
Location 11:66257740-66257762
Sequence TCACCTTTAAGGCGGCGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992865_1083992877 5 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1083992867_1083992877 3 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1083992869_1083992877 0 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1083992870_1083992877 -6 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1083992871_1083992877 -9 Left 1083992871 11:66257726-66257748 CCGAGGTAGCGGCTTCACCTTTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1083992862_1083992877 25 Left 1083992862 11:66257692-66257714 CCAAGAGAAGCGTGTTTCGCCCC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1083992866_1083992877 4 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25
1083992864_1083992877 6 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992877 Original CRISPR TCACCTTTAAGGCGGCGCGG GGG Intronic
904030509 1:27530759-27530781 ACAGTTTTAAGGCGGGGCGGGGG - Intergenic
912125742 1:106535717-106535739 TCACCTCTAAGGCAAGGCGGAGG - Intergenic
1070620797 10:78009215-78009237 TCATCTTTTTGGCGGCGGGGGGG - Intronic
1082942636 11:58724412-58724434 TCACCTTTAAGGATGCTGGGAGG + Exonic
1083992877 11:66257740-66257762 TCACCTTTAAGGCGGCGCGGGGG + Intronic
1106028573 13:25977734-25977756 TCACCTTTAAAACGGTGCTGTGG + Intronic
1114100162 14:19372904-19372926 TCTCCCTGCAGGCGGCGCGGTGG + Intergenic
1139547415 16:67656209-67656231 TCACCTGCAAGGCGGAGCTGGGG - Exonic
1153892682 18:9532871-9532893 TCACCTTTAAGGCAGATCAGTGG - Intronic
1154173783 18:12068451-12068473 ACACCTGTCAGGCGGCGCCGCGG + Intergenic
1163158171 19:15450013-15450035 TCCCCATCATGGCGGCGCGGCGG - Intergenic
1163631388 19:18419597-18419619 ACACCTGTCAGGCGGCGCCGCGG - Exonic
1166380600 19:42353359-42353381 TCACCTTTGAAGCGGCTGGGTGG + Intronic
1168712677 19:58510968-58510990 TCACCTTTGAGGTTGCGAGGCGG + Intronic
931272447 2:60714960-60714982 TAACAGTTCAGGCGGCGCGGAGG + Intergenic
946692181 2:222318621-222318643 CCAGCTTTCAGGCGGGGCGGTGG + Intergenic
947523510 2:230865424-230865446 CCCCCTATAAGGCGGCGAGGGGG - Intronic
947552571 2:231057082-231057104 TCAGCTAAAAGCCGGCGCGGCGG - Intronic
1175361462 20:58414496-58414518 TCACCTCTCAGACGGGGCGGTGG + Intronic
962498330 3:135965485-135965507 TCTCCTGTATGGCGGCGCCGCGG - Intergenic
993900319 5:93580236-93580258 TCCCCTCCAAGGAGGCGCGGCGG + Intergenic
1001514580 5:172346352-172346374 TCACCCTTAAGGGGGTGCTGGGG + Intronic
1001652904 5:173328122-173328144 CCACCTTTGACCCGGCGCGGGGG - Exonic
1017787628 6:157769571-157769593 TCACCTGTAAGGAGGCTCAGGGG + Intronic
1029648538 7:101874325-101874347 TCACCTTTAAGGATGCGGTGAGG - Intronic
1040458027 8:47619882-47619904 CCACCTTAAAGGCAGCACGGTGG - Intronic