ID: 1083992880

View in Genome Browser
Species Human (GRCh38)
Location 11:66257748-66257770
Sequence AAGGCGGCGCGGGGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 208}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992871_1083992880 -1 Left 1083992871 11:66257726-66257748 CCGAGGTAGCGGCTTCACCTTTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 208
1083992865_1083992880 13 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 208
1083992870_1083992880 2 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 208
1083992864_1083992880 14 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 208
1083992866_1083992880 12 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 208
1083992869_1083992880 8 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 208
1083992867_1083992880 11 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992880 Original CRISPR AAGGCGGCGCGGGGGCTGCT GGG Intronic
900117209 1:1033832-1033854 CAGGCGGGGCCGGGGGTGCTCGG - Intronic
900227362 1:1539579-1539601 AAGGCGGCTCGCGGCCTGCGTGG + Intronic
900342165 1:2194480-2194502 GGGGCGGCGCGGGGGAAGCTCGG + Intronic
900436407 1:2633243-2633265 AAGGGGCCCCAGGGGCTGCTGGG + Intergenic
900614270 1:3557583-3557605 AAGGTGGGGCGGGGTCTGATGGG - Intronic
901373064 1:8817237-8817259 GAGGCCGCGCGGAGGCTGCGGGG + Exonic
901489259 1:9588586-9588608 AAGGCGGCGCGGGGAGGGCGGGG - Intergenic
901739897 1:11335074-11335096 GAGGCGGGGAGGGGGCTGGTGGG - Intergenic
901791338 1:11654964-11654986 GAGGGGGCGCGGGGGGCGCTGGG + Intronic
902375702 1:16029050-16029072 CAGGCGGTGCGGGGGAGGCTGGG + Intronic
902380656 1:16050802-16050824 CAGGCGGTGCGGGGGAGGCTGGG + Intronic
903956526 1:27029883-27029905 AAGGGGGCGTGAGGCCTGCTGGG - Intergenic
904252954 1:29237749-29237771 GAGGCGGCGCCGGGGCTGCGGGG + Intronic
905789849 1:40784098-40784120 GAGGCGGCGCGGGGGGGCCTCGG - Exonic
905847081 1:41242144-41242166 AAGGGGGCGGGCGGGCGGCTCGG + Intronic
906520930 1:46466544-46466566 CCGGCGGCGCGGGGGCGCCTGGG - Intergenic
907118613 1:51990285-51990307 AAGACGGCGCTGGGGCTGGGAGG - Intronic
912414388 1:109498229-109498251 CAGGTGGTGCGGGGGCTGGTGGG + Intronic
920255627 1:204652264-204652286 AAGGCGGCGGGGGGGCGGGGGGG - Intronic
921010170 1:211133678-211133700 AGGGCGGGGCGGGGTCTGATGGG - Intronic
922802737 1:228371683-228371705 GAGGAGGGGCGGGGGGTGCTCGG - Exonic
922803584 1:228374789-228374811 GAGGCTGGGCTGGGGCTGCTGGG + Intronic
922937872 1:229434853-229434875 GAGGAGGCGCGGGGGCTCCCGGG + Intergenic
923630871 1:235649159-235649181 GAGGCGGCGTCTGGGCTGCTGGG + Intronic
1062774822 10:135855-135877 AGGACCGCGCGGGGCCTGCTCGG + Intronic
1063115086 10:3067407-3067429 GAGGGGGCGCGGGCGCGGCTAGG - Intronic
1064354458 10:14604486-14604508 AAGGCGGGGGCGGGGCTGCCAGG - Intronic
1065549899 10:26860348-26860370 GAGGCGGCGCGGCGGCAGCTCGG + Intronic
1067769932 10:49115605-49115627 CACGCGGGGCCGGGGCTGCTGGG + Intergenic
1072555939 10:96513684-96513706 ATGGTGGCGCGGGGCCGGCTGGG + Exonic
1072654444 10:97320201-97320223 CAGGCCGCGCGAGGGCTGCGAGG - Exonic
1075054482 10:119207454-119207476 CTCGCGGCGCGGGGCCTGCTGGG - Intergenic
1075849215 10:125573819-125573841 AAGGCTGAACGGGGGCTGCAGGG - Intergenic
1076289322 10:129332127-129332149 ATGGGGGTGCGGGGGATGCTCGG + Intergenic
1076494874 10:130890476-130890498 AAGGCAGCGCAGCAGCTGCTGGG - Intergenic
1076834372 10:133013754-133013776 CGGGCGGCACGGGGGCTGCGTGG + Intergenic
1076979757 11:198170-198192 AAGGAGCCAAGGGGGCTGCTGGG - Intronic
1077010272 11:376512-376534 CGGGCTGGGCGGGGGCTGCTGGG - Exonic
1079544239 11:21613556-21613578 CAGGAGGCCTGGGGGCTGCTGGG - Intergenic
1083315276 11:61811106-61811128 AAGGCGACACTGGGGCTGGTGGG - Intronic
1083656193 11:64230834-64230856 ATGGCGGCGGGCGGGCAGCTGGG - Exonic
1083750728 11:64759295-64759317 CAGGCGGGGCTGGGGCAGCTGGG - Intronic
1083912928 11:65720538-65720560 AGGCCGGCGCGGGGGCTGCCGGG + Intronic
1083992880 11:66257748-66257770 AAGGCGGCGCGGGGGCTGCTGGG + Intronic
1084070116 11:66728308-66728330 CAGGCGGCGCGGGGGGCGCGCGG + Intronic
1084489686 11:69471646-69471668 CAGGTGGCGCGGTGGCTGCCCGG - Intergenic
1084646739 11:70463461-70463483 GAGGTGGCGCGGGGGTTGTTGGG + Intergenic
1085265646 11:75236447-75236469 AAGGCAGCAGGAGGGCTGCTGGG + Intergenic
1088625420 11:111727132-111727154 GAGGTGGCGAGGGGGCAGCTGGG - Exonic
1088679465 11:112226622-112226644 GGAGGGGCGCGGGGGCTGCTGGG + Intronic
1090048653 11:123358496-123358518 CAGGCGGGGCGGGAGCCGCTGGG - Intergenic
1090366643 11:126211978-126212000 AAGGGGGCGCGGGGGCGGGGAGG - Intronic
1090784111 11:130033275-130033297 CGGGCGGCGCGCGGGCTGCAGGG - Intergenic
1091280319 11:134378056-134378078 CTGACGGGGCGGGGGCTGCTGGG - Intronic
1091280578 11:134379651-134379673 AAGAGGGGGCAGGGGCTGCTGGG - Intronic
1091820774 12:3473787-3473809 AAGGCGGGGCTGGGGCTCATGGG - Intronic
1096193760 12:49635850-49635872 ATTGCGGCGCCGGAGCTGCTTGG - Exonic
1097226071 12:57477471-57477493 ACTGCGGCGCGGGGGCTTCCAGG + Exonic
1097854930 12:64452218-64452240 AAGGCGGCGCGGGGCGCGGTCGG + Intronic
1100391139 12:94147497-94147519 AAAGCAGGGCGGGGGCTGGTTGG + Intergenic
1101606070 12:106248193-106248215 AAGCCGGCGCGGGGGTGGCTGGG + Intronic
1102375543 12:112418787-112418809 ATGGCAGCGCGGGGGCTCCGCGG - Intronic
1103325327 12:120116557-120116579 GAGGCGGCGCGGGCCCTGCCGGG - Intronic
1105411857 13:20177526-20177548 GAGGCGGCGCGGTGGCCGCGGGG - Intergenic
1108668119 13:52652737-52652759 ACGCCGGCGCGGGGCCGGCTGGG - Intronic
1113480289 13:110615561-110615583 GCGACGGCGCGGGGGCAGCTGGG + Intronic
1115197029 14:30812343-30812365 AAGGGGGCGCGGGGGCGCCGGGG + Intergenic
1115769623 14:36656199-36656221 GAGTCGGCACGGGGGCTGGTGGG + Intergenic
1117302282 14:54441372-54441394 AAGGCGGCGCAGGGCCCTCTGGG + Exonic
1120785781 14:88534225-88534247 AAGGGGGGGCGGGGGGCGCTTGG + Intronic
1123030720 14:105449879-105449901 ATGGCGGCCCGGCGGCTCCTTGG - Intronic
1126334410 15:47570640-47570662 GAGGCTGCGCCGGGCCTGCTGGG - Intronic
1128149767 15:65355579-65355601 AAGGCGGCGCGCGGCCCGGTCGG - Intronic
1128153226 15:65376592-65376614 AGGGGGGCGCGGGGGGCGCTGGG - Intronic
1128583028 15:68821522-68821544 GAAGGGGCGCGCGGGCTGCTGGG - Intronic
1129411157 15:75351021-75351043 GAGGTGGGGTGGGGGCTGCTAGG + Intronic
1130613355 15:85380905-85380927 GAGGAGGGGCGGGGGCTGCGGGG + Intronic
1131763199 15:95646493-95646515 ATGGCGGCGGGGGGGCGGGTGGG + Intergenic
1132512647 16:352194-352216 CTGGCGGCGCGGTGGCCGCTTGG - Intronic
1132987857 16:2777313-2777335 GACGCGGCGCGGGGCATGCTGGG - Intergenic
1133055043 16:3141675-3141697 AATGAGGCTCGGGGGCTTCTGGG - Exonic
1138590406 16:57996446-57996468 TAGGCTGCGCGAGGCCTGCTGGG + Exonic
1138665367 16:58562526-58562548 AAAGCGGCGGGGGGGCGGCCAGG + Intronic
1142111221 16:88332711-88332733 ATGGGGGAGGGGGGGCTGCTGGG + Intergenic
1142992358 17:3739899-3739921 AAGGCGGAGCCTGGGCTGATCGG - Intronic
1143057507 17:4173316-4173338 CAGGCGCCGCGGGGCCTACTCGG + Intronic
1143201349 17:5115843-5115865 AAGGCGGCGCGGGGTGCGCCCGG - Intronic
1143579523 17:7817496-7817518 GTGAAGGCGCGGGGGCTGCTGGG + Intronic
1144782330 17:17814354-17814376 AAGGCTGCCCGGGCCCTGCTGGG - Exonic
1145031318 17:19507366-19507388 ATGGCGGCGCGGGGGACGCGGGG - Intronic
1145214717 17:21042894-21042916 AGCGCGGCGTGGGGGCTGCTCGG + Exonic
1145250479 17:21294402-21294424 GAGGCGGAGCAGGGGCTGCAAGG + Intronic
1146339499 17:32007323-32007345 GAGGTGGCGCGGCGGCCGCTAGG - Intergenic
1146722968 17:35136324-35136346 AAGGAAGAGCGGGGGCTGATTGG - Intronic
1148178181 17:45585229-45585251 GAGGTGGCGCAGCGGCTGCTTGG + Intergenic
1148648113 17:49230708-49230730 AAGGGGACGCGGCGGCTGCCCGG - Exonic
1148863664 17:50617765-50617787 AGGGCTGGGCTGGGGCTGCTGGG - Intronic
1150211284 17:63442952-63442974 AAGGCGGAGCAGGGGAGGCTGGG + Intronic
1150408078 17:64919519-64919541 GAGGTGGCGCGGCGGCCGCTAGG + Intergenic
1150747123 17:67825406-67825428 GAAGCGGCGCGGCGGCCGCTAGG - Intergenic
1150791797 17:68205413-68205435 GAGGCGGCGCGGCAGCCGCTAGG - Intergenic
1152212503 17:79009834-79009856 CGGACGGCGCGAGGGCTGCTGGG + Intronic
1152509274 17:80774270-80774292 CAGACGGCGCGGGAGCTGCACGG + Intronic
1153851844 18:9102567-9102589 GAGGGCGCGCGGGGGCTGCTGGG - Intergenic
1153886864 18:9475295-9475317 AAGGGGGCGCGGTGCCTCCTGGG + Intronic
1155497603 18:26458179-26458201 CAGGCGGCGGGCTGGCTGCTGGG - Intronic
1156088835 18:33440865-33440887 AAGGCGGAGCGGGGGCGGCCTGG - Intronic
1157384252 18:47248137-47248159 CGGGCGGCGCGGGGACTGGTGGG - Intronic
1160156866 18:76441331-76441353 CAGGCGGAGCCAGGGCTGCTGGG + Exonic
1160538289 18:79606994-79607016 ACGGCGCCGCGGGGGGTGCCCGG + Intergenic
1160538405 18:79607438-79607460 AGGAGGGCGCTGGGGCTGCTGGG + Intergenic
1160739000 19:677342-677364 CAGGCGGTGGGGGGGCTGCCAGG + Intronic
1160972672 19:1776355-1776377 AAGGCGCCGCTGGGGCCGCCCGG + Exonic
1161016809 19:1987372-1987394 AAGACGGCGGGGGGGCCGCCGGG - Intronic
1161327711 19:3671495-3671517 CAGGCGGCTCGGGCCCTGCTGGG + Intronic
1162369668 19:10271166-10271188 AGCGCGGGCCGGGGGCTGCTGGG - Exonic
1162410438 19:10502437-10502459 AAGGAGGCCCGGGGGCTCCGAGG - Intronic
1162736560 19:12750251-12750273 ATGGGGGCGAGGGGGCAGCTGGG - Intergenic
1163111125 19:15161401-15161423 AAGGCGGGGCTGGGGCCGCAGGG - Exonic
1163484368 19:17577291-17577313 GAGGCGGGGCGGGGGCTGGAGGG + Intronic
1163544501 19:17933095-17933117 GGCGCGGGGCGGGGGCTGCTTGG + Intronic
1165080261 19:33302618-33302640 GCGGCGGCGCGGCGCCTGCTGGG + Intergenic
1165204509 19:34172420-34172442 GCGGCGGCGCGGGGCATGCTGGG - Intergenic
1165696829 19:37907150-37907172 AATGGCGCGCGGGGGCTGCCGGG - Intergenic
1166781755 19:45346786-45346808 AGGGCGAGGCGGGGGGTGCTGGG + Intronic
1167320665 19:48795634-48795656 AAGGCGGCGCAGAGGCTTCCGGG + Intronic
1167501357 19:49850664-49850686 CAGGCCGCGCGGGGCCCGCTGGG + Intergenic
1167618514 19:50548949-50548971 GAGGCGGCGATGGGGCTGCCTGG - Intronic
1168258443 19:55179700-55179722 AGGGCGGGTCGGGGGCTGCCCGG + Intronic
1168301649 19:55408058-55408080 AAGGCGACGCGGCCGCTGATTGG + Intergenic
1168636776 19:58002823-58002845 AGCGCGCCGCGGGGTCTGCTGGG + Exonic
925413961 2:3656636-3656658 AGGGCGATGCTGGGGCTGCTGGG - Intergenic
927606712 2:24491993-24492015 AAGTCGGCGCGGGCGCCCCTCGG + Exonic
928206812 2:29290357-29290379 GAGGAGGCGCAGGAGCTGCTGGG + Intronic
928313749 2:30231178-30231200 AGGAGGGCGCGGGGGCCGCTCGG - Intergenic
931487236 2:62705762-62705784 AAGGCGGGGGAGGGGGTGCTGGG + Intronic
932776200 2:74529776-74529798 AAGGGGCCGCGGGGTATGCTGGG - Exonic
938034974 2:128027952-128027974 AAGGCGGCGCGGCGGCCACTGGG - Intronic
941905051 2:170712214-170712236 CAGACAGCGCGGGGGCTGCGGGG - Intergenic
942279351 2:174344265-174344287 AAGGCGGCTCCGGGGCAGCTCGG + Intergenic
942463966 2:176188996-176189018 ACGGCCGCGCGGGGGCGGCCGGG - Exonic
942578580 2:177392675-177392697 AAGTCGCCGCGGTGGCTGCCGGG + Exonic
947623382 2:231604738-231604760 ACGGCGGGGCCGGGCCTGCTGGG - Intergenic
1172484659 20:35291099-35291121 AAGGAGGAGAGGAGGCTGCTGGG - Intronic
1173384607 20:42575865-42575887 CAGGCGGGGAGGGAGCTGCTGGG - Intronic
1173934297 20:46847758-46847780 AAGGCAGGGCGGGTGGTGCTGGG - Intergenic
1174367366 20:50064662-50064684 AAGGAGGCCCAGGGGCTGCAGGG + Intergenic
1175368502 20:58471234-58471256 AAGGAGCCCTGGGGGCTGCTTGG + Intronic
1176139623 20:63539278-63539300 GAGGCAGCGCGGGGGCTTCCTGG - Intergenic
1176178113 20:63738069-63738091 AGGGCGGGGCGGGGGCGGCCGGG + Intronic
1179726607 21:43344619-43344641 AAGCCTGCGTGGGGGCTCCTGGG + Intergenic
1179976885 21:44873450-44873472 AAGGGGGCGGGGCGGCTGGTGGG - Intronic
1180093062 21:45542447-45542469 AAGGCGGCGCGGCGGGCGCGCGG + Exonic
1180180701 21:46117576-46117598 AATGCTGGGCTGGGGCTGCTGGG - Intronic
1181796133 22:25312371-25312393 AAGGAGGCCAGGGGGCTGCAGGG + Intergenic
1181836679 22:25615981-25616003 AAGGAGGCCAGGGGGCTGCAGGG + Intronic
1182335529 22:29581033-29581055 GTGACGGCGCGGCGGCTGCTGGG - Exonic
1184087301 22:42272604-42272626 AGGGCGGGGAGGGGGCTGCATGG - Intronic
1185246917 22:49777618-49777640 CAGGCGGGGCGGGCGGTGCTGGG + Intronic
1185280368 22:49967271-49967293 AAGGCTGGACGGGGGCCGCTGGG - Intergenic
1185394203 22:50578453-50578475 AGGGCGGGGCGGGGGTGGCTAGG - Exonic
950509828 3:13419693-13419715 GAGGGGGCGCCGGGGCAGCTGGG - Intronic
950759197 3:15206006-15206028 AAGGCGGTGTGTGGGCAGCTCGG + Intergenic
953765477 3:45737353-45737375 AAGGGAGTGCGGGGGCTGCAAGG + Intronic
954886856 3:53882241-53882263 AAGGCGGGGGTGGGGCTGCCCGG + Intergenic
956706967 3:72007496-72007518 AAGGCGGGGTGGGGGCTTCCAGG - Intergenic
962588143 3:136862501-136862523 GAGGGGGCGCGGAGGCTGCTCGG + Intronic
962793962 3:138834956-138834978 AGGGCGGGGCGGGGGCTGCTGGG - Intergenic
966735064 3:183181315-183181337 ATGGGGGCGGGGGGGCAGCTGGG + Intronic
968126441 3:196163866-196163888 AGGCCGGCCCGGGGGCTGCAGGG - Intergenic
968199379 3:196739737-196739759 AGGCCCGCGCGGGGGCCGCTGGG - Intergenic
968285288 3:197505065-197505087 CAGGCGGTGCTGGGACTGCTTGG - Intergenic
968850508 4:3074667-3074689 AAGGCGCCGTGGGGGCTGCCGGG + Exonic
968949608 4:3683730-3683752 GAGGCGCCGCTGGGGCTGTTGGG - Intergenic
969585533 4:8089335-8089357 AAAGTGGCCCGGTGGCTGCTGGG - Intronic
971405943 4:26320903-26320925 AAGGGAGCGCGGGGGCTGGGTGG + Intronic
973292335 4:48483280-48483302 AGGGCGGGGCGGGGCCTGCGGGG + Intergenic
974672119 4:65045693-65045715 AAGAAGGCGAGGGGGCTGATTGG + Intergenic
985795780 5:1961409-1961431 AAGGCGATGCGGGGGCTGGTGGG + Intergenic
992663605 5:78984894-78984916 AAGGCGGGGCGGGGGCGGCGCGG + Intronic
999823275 5:155249860-155249882 CAGGCAGCGCAGGTGCTGCTGGG - Intergenic
1001279899 5:170379168-170379190 ATGGCGGTGCTGGAGCTGCTCGG + Intronic
1002281069 5:178130583-178130605 AGGGCGGCGCGGGGGCCGTGAGG - Intergenic
1002281208 5:178131028-178131050 AAGCCGGGGCCGGGGCTGCGGGG + Exonic
1002898192 6:1391016-1391038 GAGGCGGCGGGGTTGCTGCTGGG - Exonic
1002927250 6:1611578-1611600 GCGGCGGCGCGGGGGCCGCGGGG + Exonic
1004694297 6:18019765-18019787 ACGGCGGCGGGGGGGAGGCTCGG + Intergenic
1006535605 6:34696642-34696664 CCGGCGGCGCGGCGGCGGCTTGG - Exonic
1007429957 6:41770959-41770981 ATGGCGGCCCGGGTGCTGGTGGG + Exonic
1007673417 6:43575688-43575710 CAGGCGGCGCCGGAGCTGCTGGG + Intronic
1010703167 6:79077291-79077313 AGGCCGGCGCGGGGTCTGCGGGG - Intronic
1017025612 6:150178099-150178121 AAGGCCTCGCGGAGGCTGCATGG - Intronic
1019118492 6:169784720-169784742 AAGGCGCCCCGGGGGCTGCTGGG - Intergenic
1019171922 6:170137544-170137566 AAGGCTGCGAGAGGGCAGCTCGG - Intergenic
1019414357 7:920510-920532 AGGGCGGCACGGGGGGTGCAAGG - Intronic
1019500928 7:1364408-1364430 AGGGAGGCGTGGGGGCGGCTGGG + Intergenic
1020210560 7:6154894-6154916 GCGCCTGCGCGGGGGCTGCTGGG - Exonic
1022508744 7:30922265-30922287 AAGGGAGGGCGGGGGCTGGTGGG + Intronic
1024182221 7:46908014-46908036 AAGTCAGCGCGGGGGCTGCAGGG + Intergenic
1025144168 7:56490596-56490618 AAAGAGGAGCTGGGGCTGCTGGG + Intergenic
1025296190 7:57776720-57776742 ATGGCGGAGCGGCGGCTGCGGGG - Intergenic
1026851447 7:73726049-73726071 GAGGAGGCCCAGGGGCTGCTGGG + Intergenic
1027432704 7:78131089-78131111 AAGCTGGCTCGGGGACTGCTGGG + Intronic
1029611437 7:101628650-101628672 GAGGCCGAGCTGGGGCTGCTGGG - Intronic
1031629951 7:124033329-124033351 GAGGCGGCGCCGGGGCTGTGAGG + Intergenic
1034254015 7:149714749-149714771 AAGGCGCCGCGGCGCCGGCTCGG - Intergenic
1034393056 7:150800847-150800869 AAGGAGGCCCGGGGGCCGCCGGG - Exonic
1035276815 7:157752867-157752889 AAGGCGGCGTGGCTGCTGCGAGG - Intronic
1035464154 7:159064161-159064183 AAGGAGGCGATGCGGCTGCTGGG + Intronic
1038816688 8:30912113-30912135 AGGGCGGCGCGGGGGTAGCTGGG - Intergenic
1039454949 8:37699923-37699945 GCGGCAGCGCGGGGGCTGCGGGG + Exonic
1040039154 8:42897955-42897977 AAGGCAGCGCGGGGTCCGCCCGG - Intronic
1040481468 8:47831478-47831500 AATGCGGCGGGAGGGCAGCTGGG - Intronic
1049247963 8:141572722-141572744 AAGGGGGCTCTGAGGCTGCTCGG + Intergenic
1049379336 8:142304265-142304287 AAGGAGGCGTTGGGGTTGCTGGG - Intronic
1049658886 8:143810907-143810929 GAGGCTGGGTGGGGGCTGCTGGG + Exonic
1049867861 8:144950611-144950633 GGGGCGGGGCGGGGGCAGCTCGG - Intronic
1056799517 9:89681436-89681458 GAGGGGGGGCGGCGGCTGCTGGG - Intergenic
1057772796 9:97983248-97983270 GACGCGGCGCGGCAGCTGCTCGG - Intergenic
1058436458 9:104968321-104968343 GGGGCGGCGCGGGGTCTGCTGGG + Intergenic
1059283023 9:113150922-113150944 GAGGCGGCGCGCGGGCGCCTGGG - Exonic
1061149079 9:128818775-128818797 CGGGCGGCGCCGGGACTGCTGGG + Exonic
1061392595 9:130326119-130326141 GAGGCGGGGAGAGGGCTGCTGGG - Intronic
1062588936 9:137264293-137264315 AAGAGGGCGCGGGAGCTGCAGGG + Exonic
1185736498 X:2500493-2500515 GCGGCTGCACGGGGGCTGCTTGG + Intronic
1185908953 X:3964985-3965007 AAGGCGGCTGGGGCGCAGCTTGG - Intergenic
1191253117 X:58268617-58268639 GGTGCGGCGCAGGGGCTGCTGGG + Intergenic
1200248983 X:154542187-154542209 AAGGGGAGGCGGGGGCCGCTGGG + Intronic