ID: 1083992881

View in Genome Browser
Species Human (GRCh38)
Location 11:66257752-66257774
Sequence CGGCGCGGGGGCTGCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 773
Summary {0: 1, 1: 1, 2: 20, 3: 126, 4: 625}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992870_1083992881 6 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG 0: 1
1: 1
2: 20
3: 126
4: 625
1083992866_1083992881 16 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG 0: 1
1: 1
2: 20
3: 126
4: 625
1083992865_1083992881 17 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG 0: 1
1: 1
2: 20
3: 126
4: 625
1083992864_1083992881 18 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG 0: 1
1: 1
2: 20
3: 126
4: 625
1083992869_1083992881 12 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG 0: 1
1: 1
2: 20
3: 126
4: 625
1083992871_1083992881 3 Left 1083992871 11:66257726-66257748 CCGAGGTAGCGGCTTCACCTTTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG 0: 1
1: 1
2: 20
3: 126
4: 625
1083992867_1083992881 15 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG 0: 1
1: 1
2: 20
3: 126
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992881 Original CRISPR CGGCGCGGGGGCTGCTGGGA AGG Intronic
900165598 1:1243191-1243213 CGGGGTGGGGGCTGGTGGGGAGG + Intronic
900243297 1:1626825-1626847 CGGCCCAGGGCCTGCGGGGAGGG - Exonic
900314653 1:2050726-2050748 CGGCGCGGGTGAGGCAGGGAGGG + Intronic
900342361 1:2194999-2195021 CGGCCCGGGGGCTGCCCGGACGG - Intronic
900408437 1:2502474-2502496 CGGCCCCGGGCCTGCTGGGATGG + Intronic
900536715 1:3182274-3182296 CGGCGCTCGGGCTGCGGGGAAGG + Intronic
900614841 1:3560834-3560856 CCGCGAGGGGGTTGCTGGGCTGG + Intronic
900988673 1:6087543-6087565 CGGGGCCGTGGCTGCTGGGCCGG - Intronic
901205465 1:7492434-7492456 CAGCCCGGGGGCTGGTGGCAGGG - Intronic
901443641 1:9293610-9293632 CGGCTCCGGGGCGGCGGGGAGGG - Intronic
901791340 1:11654968-11654990 GGGCGCGGGGGGCGCTGGGGAGG + Intronic
901791353 1:11654999-11655021 CTGGGCGGGGGCTGCCGGGAAGG + Intronic
901913248 1:12478100-12478122 GGGCCCAGGGCCTGCTGGGATGG + Intronic
901988057 1:13091670-13091692 CCACCCAGGGGCTGCTGGGAAGG + Intergenic
901988110 1:13091882-13091904 CTGTGCAGGGTCTGCTGGGAGGG + Intergenic
901988252 1:13092479-13092501 CTGTGCAGGGTCTGCTGGGAGGG + Intergenic
901988307 1:13092688-13092710 CTCCGTAGGGGCTGCTGGGAAGG + Intergenic
901993505 1:13134079-13134101 CTCCGTAGGGGCTGCTGGGAAGG - Intergenic
901993560 1:13134288-13134310 CTGTGCAGGGTCTGCTGGGAGGG - Intergenic
901993702 1:13134885-13134907 CTGTGCAGGGTCTGCTGGGAGGG - Intergenic
901993755 1:13135097-13135119 CCACCCAGGGGCTGCTGGGAAGG - Intergenic
902455966 1:16534397-16534419 GGGCGCGGTGGCTGCGGGGCGGG - Intergenic
902496203 1:16873514-16873536 GGGCGCGGTGGCTGCGGGGCGGG + Intronic
902861686 1:19251536-19251558 CGGCGCGGTGCATGCCGGGACGG - Exonic
902861741 1:19251762-19251784 CGGCGCGGGGGACTCTGGGACGG - Exonic
903016800 1:20366718-20366740 GCGCGCGGAGGCTGCCGGGAGGG - Intergenic
903034494 1:20485481-20485503 CGGCCCGCGGGCTGCTGCGGCGG + Exonic
903141958 1:21344561-21344583 CTGGGGGGGGGCTGTTGGGAGGG - Intronic
904045279 1:27604636-27604658 TGGCGGGAGGGCTGCTGGGGCGG + Intergenic
904641960 1:31937953-31937975 CGGCGCGGGGGCCGCCCGGGAGG + Intronic
904672903 1:32179643-32179665 CGGCGCGGAGCTTGCTGGGAAGG - Intergenic
904770948 1:32881153-32881175 CGGGGCAGGGGTTGCTGGGCTGG + Intergenic
904775076 1:32901407-32901429 CGGCCCGGGGGGTGACGGGAAGG - Intronic
904801028 1:33093068-33093090 GGGCGCAGGGGCTGCAGGAATGG + Intronic
905124561 1:35707866-35707888 CGGGGCGGGGGCCGCGGGGGAGG + Intergenic
905755855 1:40508690-40508712 CGCCGCGAGGGCCTCTGGGAAGG + Intergenic
905879775 1:41455945-41455967 CTGCCCTGGGGCTCCTGGGACGG - Intergenic
906252247 1:44319587-44319609 GGCAGCAGGGGCTGCTGGGAGGG - Intronic
906520929 1:46466540-46466562 CGGCGCGGGGGCGCCTGGGAAGG - Intergenic
906522338 1:46474913-46474935 AGGCCTGGGGGCTGCTGGGGTGG + Intergenic
906529097 1:46512943-46512965 AGCCGCGGAGGCTGCAGGGAGGG - Exonic
907274178 1:53308017-53308039 CTCCGCCAGGGCTGCTGGGAAGG - Intronic
907551966 1:55312272-55312294 AGGGGCAGGGGCTTCTGGGAGGG - Intergenic
907671389 1:56477674-56477696 CGGGGCGGCGGCTGCCGGGAGGG - Intergenic
908261058 1:62339485-62339507 CAGCCCCAGGGCTGCTGGGAAGG + Intergenic
908700850 1:66898301-66898323 AGGCGTTGGGGCTACTGGGATGG + Intronic
912414390 1:109498233-109498255 TGGTGCGGGGGCTGGTGGGCGGG + Intronic
912951837 1:114125585-114125607 TGGCGTGGGGGCTGGAGGGAGGG + Intronic
913996004 1:143652374-143652396 GGGCGCGGTGGCTGCGGGGCGGG - Intergenic
914492550 1:148161319-148161341 GGGCGCGGTGGCTGCGGGGCGGG - Intergenic
915145370 1:153793501-153793523 TGGTGCTGGGGCTGCTGGGCTGG + Intergenic
916694628 1:167222006-167222028 CGGAGGGGGGGCAGCGGGGAGGG - Intronic
920416167 1:205800533-205800555 GGGGGCTGGGGGTGCTGGGAGGG + Intronic
921168687 1:212526348-212526370 TGGCTCTGAGGCTGCTGGGAGGG - Intergenic
922619705 1:226982156-226982178 GGGCGCGGGGGCTGCTGCCCCGG + Intronic
922763529 1:228146438-228146460 GGGCGGGGGTGCTGTTGGGAAGG - Intronic
924732428 1:246724305-246724327 CGGCGCGCTGGCTGCGGCGACGG + Exonic
1063636445 10:7787630-7787652 GGGCCCGGGGGCTGCGGGGAGGG + Intronic
1063661561 10:8037707-8037729 CGGGGCCGGGGCCGCGGGGAAGG + Intergenic
1063905507 10:10776706-10776728 GGGAGCTGGGGCTGCTGGGCTGG - Intergenic
1064230960 10:13528985-13529007 CGGCGGGCGGGCTGCGGGGAGGG + Intergenic
1064243352 10:13650172-13650194 GGGAGGTGGGGCTGCTGGGAGGG + Intronic
1065293930 10:24257333-24257355 CGGCGTGGGGGGTGGAGGGAGGG + Intronic
1066429217 10:35336455-35336477 CGGGGCGGGGGCTGCGGCGAGGG + Intronic
1067936771 10:50619533-50619555 GGGCCTGGGGGGTGCTGGGAGGG + Intronic
1069920504 10:71812896-71812918 GGGCGCGGAGCCTGCAGGGAAGG - Intronic
1070257606 10:74825434-74825456 CGGCGCGGGGGGAGCGGGGCTGG + Intergenic
1071334191 10:84588359-84588381 CTGAGTGGGGGCTGCAGGGAAGG - Intergenic
1072757561 10:98030841-98030863 CGGCGCGGCGGCCACTGGGGTGG + Intergenic
1074130362 10:110568099-110568121 CGGCGGGCGGGCCGCTGGGAGGG + Intronic
1074437469 10:113446219-113446241 TAGCTCGGGGGCTGGTGGGAAGG + Intergenic
1075054307 10:119206840-119206862 CGGCGCGGGGTCTACGCGGACGG - Intergenic
1075673877 10:124282494-124282516 TGGCGCGGGGGATCCTGCGAGGG - Intergenic
1075949025 10:126461488-126461510 TGGCGAGGGTGCTGCTGGGGAGG + Exonic
1076116964 10:127907445-127907467 CGCCGCGGGGGCGGCGGGGCCGG - Intronic
1076187077 10:128458410-128458432 AGGGGCAGGGGATGCTGGGAAGG + Intergenic
1076494873 10:130890472-130890494 CAGCGCAGCAGCTGCTGGGATGG - Intergenic
1076792677 10:132785511-132785533 CCGCGCGGGGGGTGCGGGGCGGG - Intronic
1077010270 11:376508-376530 CTGGGCGGGGGCTGCTGGGGCGG - Exonic
1077075960 11:702280-702302 CAGGGCGGGCACTGCTGGGAGGG + Intronic
1077121460 11:910842-910864 CGGCGCGCGGGCGCCTGGGGCGG - Intronic
1077186101 11:1236086-1236108 GGGCGTGGGGGCTGCAGGGCTGG + Intronic
1077338891 11:2017332-2017354 CGTGGCGGGGGCTGCTGGTGTGG - Intergenic
1077352033 11:2097516-2097538 CGCTGCGGGGGAGGCTGGGAGGG + Intergenic
1077385792 11:2269008-2269030 CGGTGCGGGGGGTGGTGGGTGGG + Exonic
1078245893 11:9573394-9573416 CGGGGCTGGGCCTTCTGGGAGGG - Intergenic
1080551269 11:33375949-33375971 CTGCGCGGGAGCCGCCGGGAGGG + Intergenic
1081867499 11:46367582-46367604 GTGGGCGGGGGCTGATGGGAGGG + Intronic
1082706297 11:56497491-56497513 GGGCGGGGTGGCTGCTGGGCGGG - Intergenic
1083579091 11:63813541-63813563 CGGCGGGCGGGCGGCGGGGAGGG + Exonic
1083669335 11:64291591-64291613 CGGCGAGGGCGCTGCACGGAGGG + Intronic
1083727190 11:64634711-64634733 GGGTAAGGGGGCTGCTGGGAGGG + Intronic
1083730634 11:64650671-64650693 GGGCGGGGGTGATGCTGGGAAGG + Intronic
1083750726 11:64759291-64759313 CGGGGCTGGGGCAGCTGGGGCGG - Intronic
1083882072 11:65553732-65553754 CGGCCCAGGGGCTTCTGGGTGGG + Exonic
1083960451 11:66012288-66012310 CGGCGGGCGGGGTGCTGGGAGGG + Intronic
1083992881 11:66257752-66257774 CGGCGCGGGGGCTGCTGGGAAGG + Intronic
1084295751 11:68212925-68212947 CGGCGCGGGGCCTGCAGTGGTGG - Intronic
1086334130 11:85782399-85782421 GGGTGGGGGGGCTGCTGTGAAGG + Intronic
1089379225 11:118015692-118015714 CAGCGCGGGTACTGCTGGGAGGG - Intergenic
1089729459 11:120511524-120511546 AGGCGCGGGGGCGGCGGGGGCGG - Intergenic
1090048651 11:123358492-123358514 CGGGGCGGGAGCCGCTGGGGCGG - Intergenic
1090402276 11:126456556-126456578 CAGGGCGGGGGCTGCTCTGAGGG - Intronic
1202821875 11_KI270721v1_random:72514-72536 CGTGGCGGGGGCTGCTGGTGTGG - Intergenic
1091582072 12:1796277-1796299 GGCCGCTGGGACTGCTGGGAAGG - Intronic
1091801719 12:3328741-3328763 CGGGCCGAGGGCTGCTGTGAGGG - Intergenic
1092880700 12:12885684-12885706 GGGCGGGGGGGCGGCAGGGAGGG + Intergenic
1093825735 12:23685732-23685754 CCTCCAGGGGGCTGCTGGGATGG - Intronic
1094375524 12:29784122-29784144 CTGCCCGGGAGCTGCGGGGAAGG + Intronic
1094819123 12:34211227-34211249 CGGGGCAGAGGCTGCTGGGAAGG + Intergenic
1094819195 12:34211504-34211526 CGGCGCAGAGGCTGCCGGGAAGG + Intergenic
1094819251 12:34211708-34211730 CAGCGCAGGCGCTGCCGGGAAGG + Intergenic
1094828386 12:34288803-34288825 CCACGCAAGGGCTGCTGGGAAGG - Intergenic
1094828762 12:34290304-34290326 CCTCGCAGGGGCTGCTGGGAAGG + Intergenic
1094828949 12:34291096-34291118 CCACGCAGGGGCTGCTGGGAAGG + Intergenic
1094829001 12:34291307-34291329 CTGTGCAGGGGCTGCTGGAAAGG + Intergenic
1094829095 12:34291713-34291735 CCACGCAAGGGCTGCTGGGAAGG + Intergenic
1094829401 12:34293072-34293094 CCACGCAGGGACTGCTGGGAAGG + Intergenic
1094829445 12:34293265-34293287 CCACGCAGGGGCTGCTGGGAAGG + Intergenic
1094829571 12:34293878-34293900 CCGCGCAGGGGCTGTTGGGAAGG + Intergenic
1094829662 12:34294284-34294306 CCACGCAGGGGCTGCTGGGAAGG + Intergenic
1094829709 12:34294495-34294517 CTGTGCTGGGGCTGCTGGGAAGG + Intergenic
1094829757 12:34294708-34294730 CTGCGCAGGTTCTGCTGGGAAGG + Intergenic
1094829812 12:34294919-34294941 CCACGCAGGGCCTGCTGGGAAGG + Intergenic
1094830158 12:34296480-34296502 CCGTGCAAGGGCTGCTGGGAAGG - Intergenic
1094830319 12:34297252-34297274 CCAGGCAGGGGCTGCTGGGAAGG - Intergenic
1094830647 12:34298656-34298678 CCACGCAGGGGCTGCTGGGAAGG - Intergenic
1094830888 12:34299743-34299765 CCACACTGGGGCTGCTGGGATGG - Intergenic
1094830929 12:34299933-34299955 CCACGCAGGGGCTGCTGGGAAGG - Intergenic
1094831019 12:34300337-34300359 CTGCGCAGGGGCTGCTGGGAAGG - Intergenic
1094831064 12:34300543-34300565 CCGCGCAGAGGCTACTGGGAAGG - Intergenic
1094831161 12:34300965-34300987 CTGCACAGGGACTGCTGGGAAGG - Intergenic
1094831209 12:34301137-34301159 CCCCGTAGGGGCTGCTGGGAAGG - Intergenic
1094831266 12:34301347-34301369 CTGCGCAGGGGCTGCTAGGGAGG - Intergenic
1094831602 12:34302794-34302816 CTGCGCAGTGTCTGCTGGGAAGG - Intergenic
1094831687 12:34303224-34303246 CCGTGCAGGGACTGCTGGGAAGG - Intergenic
1094831930 12:34304281-34304303 CACCGCAGGGGCTGTTGGGAAGG - Intergenic
1094832308 12:34305992-34306014 CACCACAGGGGCTGCTGGGAAGG - Intergenic
1094832358 12:34306201-34306223 CCGCGCAGGGGCTGCTGGGAAGG - Intergenic
1094832406 12:34306411-34306433 CGGCGAAGAGGCTGCTGGGAAGG - Intergenic
1094832452 12:34306620-34306642 CCGCGCAGGGGCTGCTGGGAAGG - Intergenic
1094832506 12:34306831-34306853 ATGCGCAGGGGATGCTGGGATGG - Intergenic
1094832687 12:34307674-34307696 CCACGGAGGGGCTGCTGGGAAGG - Intergenic
1094832828 12:34308291-34308313 CCGCACAGGGACTGCTGGGAAGG - Intergenic
1094832885 12:34308504-34308526 CAGCACAGGGGCTACTGGGAAGG - Intergenic
1094832939 12:34308714-34308736 CCGCGCAGGGTCTGCTGGGAAGG - Intergenic
1094833083 12:34309344-34309366 CAGTGCAGGGGATGCTGGGAAGG - Intergenic
1094833136 12:34309553-34309575 TGGCGAAGGGGCTGCTGGGAAGG - Intergenic
1094833426 12:34311206-34311228 TGGCGCAGGGGCTGCTGGGAAGG + Intergenic
1094833661 12:34312262-34312284 CCGTGCAGGGACTGCTGGGAAGG + Intergenic
1094834146 12:34314376-34314398 CTGCACAGGGGCTGCTGTGAAGG + Intergenic
1094834248 12:34314798-34314820 CCACGCAGGGGCTGCTGGGATGG + Intergenic
1094834290 12:34315008-34315030 CTGAGCATGGGCTGCTGGGAAGG + Intergenic
1094834709 12:34316879-34316901 CTGAGCAGGGGCTGCTGGGAAGG + Intergenic
1094834852 12:34317513-34317535 CTGCACAGGGGCTGCTGGGAAGG + Intergenic
1094834952 12:34317933-34317955 CTGCGCAGGGGCTGCTTGGATGG + Intergenic
1094834995 12:34318143-34318165 CTACGCAGAGGCTGCTGGGAAGG + Intergenic
1094835150 12:34318773-34318795 CCGAGCTGGGGCTGCTGGGAAGG + Intergenic
1094835311 12:34319415-34319437 CCGTGCAGGGGCTGCTGGGAAGG + Intergenic
1094835753 12:34321279-34321301 CCACGCAGGGGCTGCTAGGAAGG + Intergenic
1094835997 12:34322351-34322373 CCCCGCAGGGGCTGCTGGGAAGG + Intergenic
1094836051 12:34322560-34322582 CTGCGCAGGGGCTGCTGGGAGGG + Intergenic
1094836097 12:34322770-34322792 CCAAGCAGGGGCTGCTGGGAAGG + Intergenic
1094836283 12:34323616-34323638 CCACGCAGGGGCTGATGGGAAGG + Intergenic
1094836377 12:34324038-34324060 CAACACAGGGGCTGCTGGGAAGG + Intergenic
1094836427 12:34324245-34324267 CCACGCACGGGCTGCTGGGAAGG + Intergenic
1094836516 12:34324640-34324662 CTGCGCAGTGGCTGCTGGGAAGG + Intergenic
1094836612 12:34325066-34325088 CCGTGCAGGGGCTGCTGGGAAGG + Intergenic
1094836755 12:34325697-34325719 CGATGCAGGGGCTGCTGGGAAGG + Intergenic
1094836846 12:34326119-34326141 CTGCCCAGTGGCTGCTGGGAAGG + Intergenic
1094836907 12:34326331-34326353 CTGCGCAGGTGCTGCTGGGAAGG + Intergenic
1094836981 12:34326644-34326666 CCGCGCAGGGGATGCTGGGAGGG + Intergenic
1094837025 12:34326856-34326878 CAGCGCAGGGGCTGCTGGGAAGG + Intergenic
1094837151 12:34327464-34327486 CAGCGCAGGGGCTGCTGGTAAGG + Intergenic
1094837244 12:34327887-34327909 CTGCGTAGGGGCTGCTGGGAAGG + Intergenic
1094837582 12:34329343-34329365 CCGCGCAGTGGCTGCTGGGAAGG + Intergenic
1094837632 12:34329553-34329575 CCACGCAGGGGCTGCTGGTAAGG + Intergenic
1094837769 12:34330174-34330196 CCACGCAGGGGCTGGTGGGAAGG + Intergenic
1094837865 12:34330597-34330619 CAGCGCAGGGGCTGCTGAGAAGG + Intergenic
1094837910 12:34330811-34330833 CCGCGCAGGGGCTGCTGGGAAGG + Intergenic
1094839983 12:34338854-34338876 TGGCGTGGGGGCTGCGGGGAAGG - Intergenic
1095096498 12:38152191-38152213 CAGCGCAGAGGCTGCTGGGATGG - Intergenic
1095096594 12:38152583-38152605 CGGCGCAGAGGCTGCTGGGAAGG - Intergenic
1095096690 12:38152976-38152998 TGGCGCAGGGGCTGCTGGAAAGG - Intergenic
1095096743 12:38153179-38153201 CGGTGGAGGGGCTGCTGGGAAGG - Intergenic
1095096833 12:38153589-38153611 CGGCGCAGGGTCTGCCGGGAAGG - Intergenic
1095096882 12:38153785-38153807 CGGCGCAGGGACTGCCAGGAAGG - Intergenic
1095097224 12:38155197-38155219 AGGCGCAGCGGCTGCCGGGAAGG - Intergenic
1095097319 12:38155604-38155626 CGGCGCAGGGGCTGCAGGGAAGG - Intergenic
1095097381 12:38155811-38155833 AGGCGCAGGGGCTGCCAGGAAGG - Intergenic
1095097446 12:38156026-38156048 CGGCGCAGGGGCTGCCGGGAAGG - Intergenic
1095097632 12:38156811-38156833 CAGCGCAGGGGCTGTCGGGAAGG - Intergenic
1095097780 12:38157425-38157447 TGGCGCAGGGGCTGCCGGGAAGG - Intergenic
1095097942 12:38158015-38158037 TGACGCAGGGGCTGCTGGGAAGG - Intergenic
1095098242 12:38159208-38159230 AGGCTCAGGGGCTGCCGGGAAGG - Intergenic
1095098647 12:38160791-38160813 TGCCGCAGGGGCTGCCGGGAAGG + Intergenic
1095687238 12:45050483-45050505 GGGCGCGGGCGCGGCTGGGGAGG + Intronic
1096134417 12:49187909-49187931 GGGCGGGGGGGCGGCGGGGAAGG + Intronic
1096517580 12:52165625-52165647 AGGGGAGGAGGCTGCTGGGAAGG - Intergenic
1096532463 12:52250333-52250355 CGGCGTGGGGGCCGATGGGGAGG + Intronic
1096717432 12:53499711-53499733 CTGAGCGGGGGATGCTGCGATGG + Intronic
1097267655 12:57755316-57755338 CGGCCCGGGGGCGGCGGGGTGGG - Exonic
1097439798 12:59595966-59595988 CGGCCCGGGGGGTGGTGGGGGGG - Intergenic
1102014358 12:109637922-109637944 AGGCTTGGGGGCTGCTGGGAGGG + Intergenic
1102930205 12:116856333-116856355 CGTGGCAGGGGCGGCTGGGAGGG - Exonic
1103277204 12:119722418-119722440 TGGCTCTGGGCCTGCTGGGATGG - Intronic
1103484687 12:121274484-121274506 CGGCCCGGTTGCTGCTGGGCTGG + Exonic
1103715180 12:122940941-122940963 GGGAGTGGGGGCTGCTGAGAAGG - Exonic
1103946689 12:124531249-124531271 CAGGGAGGGGGCTGCAGGGATGG + Intronic
1104692692 12:130838923-130838945 TGGGGCGGGGGCTGCGGGCAGGG - Intronic
1104893808 12:132152340-132152362 CAGCCCAGGGCCTGCTGGGACGG + Exonic
1104929271 12:132329555-132329577 CGGCGCGGTGGCTGCGGGGCGGG - Intergenic
1105277246 13:18943431-18943453 CTGCGCAGGGGCTTCCGGGAAGG + Intergenic
1105277314 13:18943642-18943664 CCACGCAGGGGCTGCAGGGAAGG + Intergenic
1105277486 13:18944290-18944312 CGGCGCAGGGGCAGCCGGGAAGG + Intergenic
1105950042 13:25222051-25222073 TGGAGCTGGGGCTGCTAGGAGGG + Intergenic
1106447664 13:29850645-29850667 GGGGGCGGCGGCTGCTGCGAGGG - Exonic
1108640490 13:52378528-52378550 CAGCGCGGGAGCTTCTCGGATGG - Exonic
1110318515 13:74135314-74135336 GGGCCCGGGGGCGGCGGGGAAGG + Intergenic
1110711824 13:78658808-78658830 CGGCCCGTGGTCTGCCGGGAGGG - Intronic
1111396219 13:87672411-87672433 GGGAGGGGGAGCTGCTGGGAGGG - Intergenic
1112993130 13:105538530-105538552 CGGCAGGGGGGTTGCTGTGAGGG - Intergenic
1113753694 13:112793776-112793798 GGGCGCCTGGGCTGCTGGCAGGG + Intronic
1114074952 14:19157030-19157052 CAGCGAAGGGGCTGATGGGAAGG - Intergenic
1114075013 14:19157253-19157275 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1114075064 14:19157450-19157472 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1114075113 14:19157700-19157722 CAGCGCAGGGGTTGATGGGAAGG - Intergenic
1114075373 14:19158746-19158768 TAGCGCAGGGGCTGCTGGGAAGG - Intergenic
1114075482 14:19159167-19159189 CAGCGCAGGGGCTGCTGAGAAGG - Intergenic
1114086786 14:19240812-19240834 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
1114086897 14:19241234-19241256 TAGCGCAGGGGCTGCTGGGAAGG + Intergenic
1114087156 14:19242282-19242304 CAGCGCAGGGGTTGATGGGAAGG + Intergenic
1114087205 14:19242527-19242549 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1114087255 14:19242723-19242745 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1114087315 14:19242948-19242970 CAGCGAAGGGGCTGATGGGAAGG + Intergenic
1114461231 14:22887172-22887194 CGGGGCGGGTTCTGCTGGGTCGG + Exonic
1115652759 14:35414882-35414904 TGGGGCAGGGGCTGCTGGGTGGG + Intergenic
1117302304 14:54441477-54441499 GGGCGCCGGGGCGGCTGGGCTGG - Intergenic
1118289392 14:64505327-64505349 CGGCTCGGCGGCGGGTGGGAGGG + Intronic
1118854703 14:69611843-69611865 CGGCCCGGGGGCGGCGGGGCCGG + Intronic
1119781701 14:77280275-77280297 GGGCGAGGGGCCTCCTGGGATGG - Intronic
1119848222 14:77846668-77846690 CAGAGTGGGGGCTGGTGGGAAGG + Intronic
1121431917 14:93893750-93893772 CGGTGCGGCGGCCGCAGGGAAGG + Intergenic
1121465292 14:94111804-94111826 GGGCGAGGAGGCGGCTGGGAAGG + Intronic
1121949661 14:98160341-98160363 GGGCGGGGGGGTTGCGGGGAGGG + Intergenic
1122880414 14:104688272-104688294 CGGGGCTGGGGCTGCTGGGCAGG + Intergenic
1122885182 14:104707625-104707647 GGGCGGGGGTGCTGTTGGGAGGG - Exonic
1122967226 14:105137031-105137053 CGGCGCGGGGGTTGGGGGAAGGG - Intergenic
1123048109 14:105528145-105528167 GGGCGTGGGGGCTGCCGGGCAGG + Intronic
1123114784 14:105889778-105889800 CAGCGTGTGGGCTGCAGGGAGGG + Intergenic
1202899272 14_GL000194v1_random:26253-26275 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1202899327 14_GL000194v1_random:26483-26505 CAGCACAGGGGCTGATGGGAAGG + Intergenic
1202899418 14_GL000194v1_random:26905-26927 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
1202899473 14_GL000194v1_random:27119-27141 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1202899526 14_GL000194v1_random:27335-27357 CAGCACAGGGGCTGATGGGAAGG + Intergenic
1202899638 14_GL000194v1_random:27757-27779 CAGCGAAGGGGCTGATGGGATGG + Intergenic
1125698841 15:41661797-41661819 CGGCGTGACGGCTGCTGGGAAGG + Intronic
1128153224 15:65376588-65376610 GGGCGCGGGGGGCGCTGGGCGGG - Intronic
1128740712 15:70082091-70082113 CTGCTGGGAGGCTGCTGGGAAGG - Intronic
1129110616 15:73335063-73335085 CAGCACGGGGGCTTCTGGTAAGG - Intronic
1129680902 15:77657792-77657814 CGCCGCGGGGGCTTGAGGGAGGG + Intronic
1130650424 15:85759461-85759483 GGCCGCGGGGACTGCAGGGAGGG - Exonic
1131200047 15:90388414-90388436 CGGCGCGGGGGCTTCGGGCTGGG + Intronic
1132588150 16:715128-715150 CGGCGCTGGGGCTGCGCGGCAGG + Exonic
1132625515 16:889706-889728 CGGCTCGGGGGTTGCAGGCAGGG + Intronic
1132741411 16:1414921-1414943 CGGGCCGGGGGCTGCAGGGCAGG - Intergenic
1133019992 16:2963161-2963183 CGGTGTGGGGGCTGCAGGGCGGG + Intergenic
1133036435 16:3036545-3036567 CGGCCTGGGGGCGGCTGGGCTGG - Intronic
1133055042 16:3141671-3141693 AGGCTCGGGGGCTTCTGGGAAGG - Exonic
1133304870 16:4802521-4802543 CGGAGCGGGCGGTGCTGGTAAGG - Exonic
1134429272 16:14186587-14186609 CAGCGCGGGGGAAGCTGGAATGG + Intronic
1134567864 16:15266660-15266682 CGGGGCTGGGGCTGAGGGGAGGG - Intergenic
1134734571 16:16489693-16489715 CGGGGCTGGGGCTGAGGGGAGGG + Intergenic
1134932895 16:18222213-18222235 CGGGGCTGGGGCTGAGGGGAGGG - Intergenic
1135003917 16:18801589-18801611 CGTCGCGGGGGCCGTCGGGAAGG - Exonic
1136269729 16:29141547-29141569 CGGTGCTGGGGCTCCTGGGTGGG + Intergenic
1137033134 16:35543707-35543729 GGGCGCGGGGGGCGCTGGGGAGG - Intergenic
1137056498 16:35748785-35748807 TGGCGCCCGGGCTGCTGGGACGG - Intergenic
1137614516 16:49838781-49838803 CGGCGGGGGGCCGGCTGGGAAGG - Intronic
1138340264 16:56284619-56284641 CTGCTGGGGGGCAGCTGGGAGGG - Intronic
1138454933 16:57115759-57115781 CAGGGAGGGGGCTGCTGGCAGGG - Intronic
1138584800 16:57962776-57962798 GGGCTGAGGGGCTGCTGGGATGG - Intronic
1139643600 16:68311103-68311125 AGGCGCTGGGTATGCTGGGAAGG + Intronic
1139785088 16:69385992-69386014 CCGCCCGCGGGCTTCTGGGAGGG + Intronic
1140710015 16:77668973-77668995 AGGGGAGTGGGCTGCTGGGAAGG - Intergenic
1140808009 16:78551648-78551670 CGGGGCGGGGGCAGGTGGGGCGG - Intronic
1141132159 16:81444399-81444421 CGGCCCGGGGGCGGCGGGGGTGG + Intergenic
1141343111 16:83221657-83221679 CGGTGGGGGGGCGGTTGGGATGG + Intronic
1141429514 16:83964436-83964458 GGGCATGGGGGCTTCTGGGAGGG - Intronic
1141526771 16:84617111-84617133 AGGCTAGGGGGCTGCTTGGAAGG - Intronic
1141639531 16:85333332-85333354 GGCCTCTGGGGCTGCTGGGAGGG - Intergenic
1141722153 16:85762412-85762434 CGGGGAAGGGGCTGCAGGGAAGG + Intergenic
1141761584 16:86032334-86032356 GGTGGTGGGGGCTGCTGGGAGGG - Intergenic
1141957688 16:87383551-87383573 CAGCGCGGGGGCGGCGGCGAGGG + Exonic
1142073353 16:88103477-88103499 CGGTGCTGGGGCTCCTGGGTGGG + Intronic
1142267887 16:89072917-89072939 CGGGGCGGAGGCTGCGGTGAGGG - Intergenic
1142359212 16:89618952-89618974 GGGCAGGGGGGCTGCAGGGAGGG - Intronic
1142359324 16:89619196-89619218 GGGCAGGGGGGCTGCAGGGAGGG - Intronic
1142412863 16:89924962-89924984 CAGCCCTGGGGCTCCTGGGAGGG + Intronic
1142417036 16:89948820-89948842 CGGCGCGGGGCCGGCGGGGTCGG + Intronic
1142808691 17:2385318-2385340 CGGCGAGGGGGCCGGGGGGAGGG - Exonic
1142851791 17:2707982-2708004 CAGAGCCGGGGCTGCTGGGAAGG - Intronic
1142855029 17:2724466-2724488 CGGTCCGGGGGCTCCTGGGGAGG + Intergenic
1143206099 17:5140049-5140071 TGGGGCTGGGGGTGCTGGGATGG - Intronic
1143514710 17:7413941-7413963 TGGAGCTGGAGCTGCTGGGAGGG - Intronic
1143750146 17:9021809-9021831 CGGCGCGCGGGCTCCCCGGAGGG + Intronic
1144728535 17:17513753-17513775 GGGAGCGGGCGCTGGTGGGAAGG + Intronic
1144907725 17:18650201-18650223 CGGAGCGGGGCCTGCTGAGCGGG + Intronic
1145056390 17:19706542-19706564 TGGGGAGGGGGCTTCTGGGATGG + Intronic
1145250481 17:21294406-21294428 CGGAGCAGGGGCTGCAAGGAGGG + Intronic
1145317263 17:21742476-21742498 CGCCCCCGGGGCTGCTGTGAGGG + Intergenic
1145762197 17:27431499-27431521 CAGGGCTGGGGGTGCTGGGAAGG - Intergenic
1146055281 17:29577820-29577842 AGGCGTGGGGGCAGCTAGGAAGG - Intronic
1146854825 17:36253748-36253770 TGGGGCTGGGGGTGCTGGGAGGG + Intronic
1146865795 17:36334628-36334650 TGGGGCTGGGGGTGCTGGGAGGG - Exonic
1146870725 17:36377640-36377662 TGGGGCTGGGGGTGCTGGGAGGG + Exonic
1146878083 17:36428721-36428743 TGGGGCTGGGGGTGCTGGGAGGG + Exonic
1146882024 17:36449825-36449847 TGGGGCTGGGGGTGCTGGGAGGG + Intergenic
1146940241 17:36839392-36839414 AGGAGCGGGGTCTGGTGGGAGGG - Intergenic
1147068665 17:37935240-37935262 TGGGGCTGGGGGTGCTGGGAGGG - Exonic
1147073608 17:37978264-37978286 TGGGGCTGGGGGTGCTGGGAGGG + Intergenic
1147080188 17:38014777-38014799 TGGGGCTGGGGGTGCTGGGAGGG - Intronic
1147085130 17:38057802-38057824 TGGGGCTGGGGGTGCTGGGAGGG + Exonic
1147096136 17:38138737-38138759 TGGGGCTGGGGGTGCTGGGAGGG - Intergenic
1147101076 17:38181768-38181790 TGGGGCTGGGGGTGCTGGGAGGG + Intergenic
1147179507 17:38675103-38675125 CGGCGCGGCGGCGGCTGGGAGGG + Exonic
1147331123 17:39700161-39700183 CGGGGCGCGGGGTGCTGCGAGGG - Exonic
1147689017 17:42304225-42304247 CGGGGCAGGGGCTGCTGGCAGGG + Intronic
1147907633 17:43833187-43833209 CGGCGCGGCAGCCGCAGGGAGGG - Intergenic
1147914786 17:43879808-43879830 GGGCGTGGTCGCTGCTGGGAAGG - Exonic
1147996809 17:44363972-44363994 GAGCGCGGGGGCTGCGGGGTGGG - Intergenic
1148550083 17:48544925-48544947 GGGGGAGGGGGCTGCTGGGGGGG + Exonic
1148559147 17:48596190-48596212 GGGCGCGCGGGATGCTGGGTGGG + Exonic
1148863663 17:50617761-50617783 CTGGGCTGGGGCTGCTGGGATGG - Intronic
1150225594 17:63523083-63523105 CGGGGAGGGGGCCGCTGGGCGGG - Intergenic
1150255632 17:63741948-63741970 CGGCGCGGCGGCGGCTGCTAGGG - Intronic
1150423067 17:65056176-65056198 CGGCGGGCGGGCTGGCGGGAAGG - Intronic
1151653835 17:75486221-75486243 TGGCCTGGGGGCTGCTGGGTGGG + Intronic
1152212120 17:79008270-79008292 CTGCGGTGGGGCTGCAGGGAGGG + Intronic
1152352794 17:79792865-79792887 TGGGGTGGGGGGTGCTGGGAGGG - Exonic
1152773830 17:82187659-82187681 CGGCGCGGGGGAAGCTGGCAGGG + Intronic
1152928786 17:83099766-83099788 CTGCTCCGAGGCTGCTGGGATGG - Intergenic
1203162280 17_GL000205v2_random:63221-63243 ATGCGCAGGGGCTGATGGGAAGG + Intergenic
1203162391 17_GL000205v2_random:63658-63680 CAGCACAGGGGCTGATGGGAAGG + Intergenic
1203162495 17_GL000205v2_random:64088-64110 ATGCGCGGGGGCTGATGGGAAGG + Intergenic
1203162554 17_GL000205v2_random:64304-64326 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1153851852 18:9102593-9102615 AGGGGCGGGGGCTGACGGGAGGG - Intergenic
1154196539 18:12271431-12271453 CGCCGTGGGGGCTGCGGGGCAGG - Intronic
1154214868 18:12408305-12408327 CGGAGCGGGGGCGGCCGGGGCGG + Intronic
1154216630 18:12420700-12420722 GGGCTGGGGGGCTGGTGGGAGGG + Intronic
1155256943 18:24006574-24006596 CGGGGCGGGGGCGGGTGGGGGGG + Intronic
1157353987 18:46917111-46917133 CGGCGCGGGGGCGGCGGGCCTGG - Intronic
1157605335 18:48922835-48922857 CGGGGCGGGGCCTGCAGGGGAGG - Intronic
1158658024 18:59358874-59358896 CGGCGGAGGGGCTGCCAGGAGGG + Intronic
1160156867 18:76441335-76441357 CGGAGCCAGGGCTGCTGGGCTGG + Exonic
1160605485 18:80046580-80046602 CGTCCCTGGGGCTGCTGGGCTGG + Intronic
1160775430 19:853104-853126 CGGGGCCGGGGCTGCTGGCGGGG + Intronic
1160820850 19:1057083-1057105 TGGTGCGGGGGCTGCTTGGACGG + Exonic
1160858975 19:1229703-1229725 AGGCGCGCGGGCTGCGGGGCCGG + Exonic
1160889207 19:1368483-1368505 AAGTGCGGGGGCTGCTGGGCAGG + Intronic
1160930579 19:1567980-1568002 CGGCGTGGGGGCGGCGGGGGAGG - Exonic
1160949531 19:1658759-1658781 GGGCTTGGGGGCTGCAGGGATGG + Intergenic
1160981635 19:1819030-1819052 CCACCCGGGGGCTGCTTGGACGG + Exonic
1161083183 19:2321648-2321670 GGGCGCGGGGGGTGCAGGGCAGG - Exonic
1161144696 19:2670734-2670756 CGGGGCGAGGGCTCCTGGCATGG - Intronic
1161202691 19:3024827-3024849 TGGGGCAGGGGCTGCAGGGATGG - Intronic
1161204542 19:3034213-3034235 CAGGGTGGGGGCTGCTGGGGTGG - Intronic
1161343196 19:3753834-3753856 TGGCGCGGCGGCGGCTGGCACGG - Exonic
1161733777 19:5978097-5978119 CGGCGCGGGGCCTTGTGGGAGGG - Exonic
1162021394 19:7870008-7870030 CGGCGTGGGGCCTGCAGGGTGGG + Exonic
1162403124 19:10457953-10457975 GGGGGCGGGGGCGGCTGGGAGGG - Exonic
1162508886 19:11105208-11105230 CGTCTTGGGGGCTGCAGGGATGG - Exonic
1162736558 19:12750247-12750269 GGGCGAGGGGGCAGCTGGGGCGG - Intergenic
1163076315 19:14895006-14895028 TGGCGGGGGGGGTGGTGGGAGGG + Intergenic
1163268431 19:16235004-16235026 CGCTGCGGGCGCTGCCGGGAAGG - Exonic
1163292020 19:16385099-16385121 AGGCGCGGGGGCTCCGTGGAGGG + Intronic
1163294115 19:16401248-16401270 CGTCCCCTGGGCTGCTGGGAAGG - Intronic
1163417110 19:17193448-17193470 CGGAGCTGTGGGTGCTGGGACGG - Intronic
1163420595 19:17211813-17211835 CGCCCTGGGGCCTGCTGGGATGG - Intronic
1163870682 19:19819101-19819123 TGGCGCGGTGTCTCCTGGGAGGG - Intronic
1165100575 19:33436329-33436351 GGGCATGGGGCCTGCTGGGAAGG - Intronic
1165204507 19:34172416-34172438 CGGCGCGGGGCATGCTGGGAGGG - Intergenic
1165306450 19:35005579-35005601 CAGGGAGGAGGCTGCTGGGATGG + Intronic
1165433907 19:35786746-35786768 AGGGGCGGGGGGTGCTGGGCTGG - Intronic
1165472104 19:36009722-36009744 CTGGGCTGGGGCTGCTGGAAAGG + Intronic
1165532893 19:36418653-36418675 GCGCGCGGAGGCTGCTGGGAGGG + Exonic
1165945286 19:39437979-39438001 GGGGGAGGGGGCTGTTGGGAGGG + Intronic
1165994454 19:39833996-39834018 CGGCGCGGGGACGGGTGGGGCGG - Intronic
1166199365 19:41226398-41226420 CGGCGCGGGGGCTGCGGGCGCGG + Intronic
1166330681 19:42076428-42076450 CGGCGCGCGGGCAGCCGGGCGGG + Intronic
1166809362 19:45506653-45506675 GGGGGCGGGGGCTCCCGGGAGGG + Intronic
1166861669 19:45815124-45815146 CGGCCCGGAGGCTGCTGGGCAGG + Exonic
1167115043 19:47484177-47484199 TGGGGCGGGGGCTGCGGAGAGGG - Exonic
1167323614 19:48811167-48811189 GGGCGCAGGCGCTGGTGGGAGGG + Intergenic
1167411872 19:49349028-49349050 CTGCTGGGGGGCTTCTGGGAAGG + Intronic
1167439544 19:49500396-49500418 CGGGGCCCAGGCTGCTGGGAAGG + Intergenic
1167517632 19:49932605-49932627 CGGCGGGGAGGGTGGTGGGAGGG - Exonic
1167638341 19:50667642-50667664 CGGCGGGCGGGCTGGCGGGAAGG + Exonic
1168073096 19:53963441-53963463 AGCGGCGGGGGCTGCGGGGAGGG - Intronic
1168288655 19:55346705-55346727 CAGGGGAGGGGCTGCTGGGATGG - Intronic
1168528213 19:57105644-57105666 GGGGGCGGGGGATGCTGGGGGGG + Intergenic
1168641388 19:58034055-58034077 CGGCGCGCAGGGTGCGGGGATGG + Exonic
1202647817 1_KI270706v1_random:157872-157894 CAGCGAAGGGGCTGATGGGATGG - Intergenic
1202647928 1_KI270706v1_random:158299-158321 CAGTGCAGGGGCTGATGGGAAGG - Intergenic
1202648178 1_KI270706v1_random:159414-159436 CAGCGCAGGGACTGATGGGAAGG - Intergenic
1202706853 1_KI270713v1_random:30753-30775 GGGCGCGGTGGCTGCGGGGCGGG - Intergenic
925177148 2:1793825-1793847 CTGCAAGGGGGCGGCTGGGAGGG - Intronic
925846971 2:8043407-8043429 AGGCTCAGGGGCTGATGGGATGG - Intergenic
926625164 2:15085045-15085067 CGCCCTGGGGGCTGCTGTGACGG + Intergenic
926698048 2:15784428-15784450 CTGGGAGGGGACTGCTGGGAGGG + Intergenic
927130200 2:20052088-20052110 GGGGGCGGGGCCTGCGGGGAAGG + Intergenic
932288226 2:70554105-70554127 CAGGGCGCGGGCTGCTGGGCGGG + Intronic
932567229 2:72917701-72917723 AGGCGCGGCGGCTGCTGCGGCGG - Exonic
937050303 2:118883016-118883038 CGGCTGGGGGACTGGTGGGACGG - Intergenic
937963596 2:127483571-127483593 CGGGGCGGGGGGTGGTGGGGTGG + Intronic
938489276 2:131753580-131753602 CAGCGCAGGGGCTGATGGGAAGG - Intronic
938489658 2:131755015-131755037 CAGTGCAGGGGCTGATGGGAAGG - Intronic
938489711 2:131755234-131755256 CAGTGCAGGGGCTGATGGGAAGG - Intronic
938489770 2:131755433-131755455 CAGTGCAGGGGCTGATGGGAAGG - Intronic
941095853 2:161238887-161238909 CGGCGCGGGGCCCGCTGGAAAGG - Intergenic
941905049 2:170712210-170712232 CAGCGCGGGGGCTGCGGGGGCGG - Intergenic
944414480 2:199468762-199468784 AGGGGCGGGGGCTGCTGGCGGGG - Intronic
946402006 2:219473122-219473144 GGGGGTGGGAGCTGCTGGGATGG + Intronic
947538539 2:230957549-230957571 CGGCGCCGGCGGTGCTGGGCGGG + Intronic
947623381 2:231604734-231604756 CGGGGCCGGGCCTGCTGGGCCGG - Intergenic
947834560 2:233166210-233166232 CGGGGCAGGGGCTGGTGGGAGGG - Intronic
948524778 2:238564708-238564730 CGGAGCAGGGGCTGCTGGCAAGG + Intergenic
948874437 2:240819498-240819520 CGGGGCGGGGGCTGCGGCGTTGG - Intronic
1168808112 20:684768-684790 CAGAGCCGGGGCTGCTGAGAGGG - Intergenic
1168886856 20:1266284-1266306 CGGGGCTGGGGCTGCCGGGAGGG - Intronic
1169236438 20:3933624-3933646 TGGCTCAAGGGCTGCTGGGAAGG + Exonic
1169405098 20:5315962-5315984 CGGGAAGGGGGCTGCTGGAACGG - Intergenic
1170991185 20:21303248-21303270 CGCCGCCGGGGAAGCTGGGAAGG - Intergenic
1171123635 20:22584604-22584626 CGGCGCGGGGGCTAGTGGGGGGG + Intronic
1172095904 20:32460408-32460430 TGGCGCGGGGGCAGCTGTGTGGG - Intronic
1172100937 20:32483649-32483671 CGGGGCGGGGGCGGGGGGGAGGG + Intronic
1172932991 20:38599553-38599575 TGGAGTGGGGGCTGCTTGGAGGG + Intergenic
1173001608 20:39109645-39109667 TGGGGAGGGGGCTGCTGGGGTGG - Intergenic
1173001629 20:39109694-39109716 TGGGGAGGGGGCTGCTGGGGTGG - Intergenic
1173649046 20:44651546-44651568 GCGCGCGGGGGCTCCGGGGACGG - Intronic
1174305397 20:49611187-49611209 CCACGCGGGCGCTGCAGGGACGG + Intergenic
1174804695 20:53594540-53594562 CGGGGCGGGGGGCGCGGGGAGGG - Intronic
1175847003 20:62064796-62064818 CGGCGCGGCGGCTGCGGCGCCGG - Exonic
1175878581 20:62243426-62243448 CGGGGCAGGGGCTGCGGGGCAGG - Intronic
1176069009 20:63216358-63216380 CGCCGCGGGGCCTGGCGGGAAGG + Intergenic
1176075860 20:63247958-63247980 AGGCGCAGGAGCGGCTGGGAGGG - Intronic
1176125153 20:63471857-63471879 CGGCGCAGAGGCCGCGGGGAGGG + Intronic
1176178115 20:63738073-63738095 CGGGGCGGGGGCGGCCGGGCGGG + Intronic
1176223180 20:63979560-63979582 GGGCGCGGGGCCGGCTGGGGCGG - Exonic
1176549338 21:8214600-8214622 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1176557231 21:8258823-8258845 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1176568270 21:8397638-8397660 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1176576173 21:8441858-8441880 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1176603672 21:8813281-8813303 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1176603770 21:8813693-8813715 TAGCGCAGGGGCTGATGGGAAGG + Intergenic
1176603814 21:8813997-8814019 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
1176603921 21:8814430-8814452 CAGTGCAGGGGCTGATGGGAAGG + Intergenic
1176604034 21:8814857-8814879 CAGCGAAGGGGCTGATGGGATGG + Intergenic
1176618654 21:9041023-9041045 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1176618798 21:9041677-9041699 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
1176618849 21:9041891-9041913 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1176618902 21:9042107-9042129 CAGCACAGGGGCTGATGGGAAGG + Intergenic
1176619014 21:9042531-9042553 CAGCGAAGGGGCTGATGGGATGG + Intergenic
1176706528 21:10122843-10122865 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1176706824 21:10124049-10124071 CAGCGCAGGGCCTGATGGGAAGG - Intergenic
1176868972 21:14072067-14072089 CTCCGCAGGGGCTGCCGGGAAGG + Intergenic
1176869093 21:14072476-14072498 TGGCGCAGGGGCTGCCGGGAAGG + Intergenic
1176869197 21:14072867-14072889 CGGCGCAGGGGCTGCTGGAAAGG + Intergenic
1177359499 21:20049909-20049931 AGGGGAGGGGGCTGCTGTGAAGG - Intergenic
1177515045 21:22138495-22138517 TGGCGCGGGGGCTTGTGGGGGGG + Intergenic
1178303394 21:31470932-31470954 CCCCGAGGGGGCAGCTGGGATGG + Intronic
1179628216 21:42660340-42660362 AGGTGCGGGGCCTGCAGGGACGG + Intronic
1179970841 21:44836138-44836160 TGGGGTGGGGGCTGCAGGGATGG - Intergenic
1179970908 21:44836275-44836297 TGGGGTGGGGGCTGCAGGGATGG - Intergenic
1180125418 21:45786940-45786962 CGGCGTGCAGCCTGCTGGGATGG + Intronic
1180158883 21:45990285-45990307 GTGAGCGTGGGCTGCTGGGAGGG + Intronic
1180180700 21:46117572-46117594 CTGGGCTGGGGCTGCTGGGCTGG - Intronic
1180290603 22:10849953-10849975 CAGCGAAGGGGCTGATGGGAAGG - Intergenic
1180290663 22:10850168-10850190 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1180290712 22:10850364-10850386 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1180290762 22:10850609-10850631 CAGCGCAGGGGTTGATGGGAAGG - Intergenic
1180291075 22:10851922-10851944 CAGCGCAGGGGCTGATGAGAAGG - Intergenic
1180345955 22:11704832-11704854 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1180346054 22:11705244-11705266 TAGCGCAGGGGCTGATGGGAAGG + Intergenic
1180346099 22:11705574-11705596 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
1180346205 22:11706007-11706029 CAGTGCAGGGGCTGATGGGAAGG + Intergenic
1180346318 22:11706434-11706456 CAGCGAAGGGGCTGATGGGATGG + Intergenic
1180353726 22:11823087-11823109 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1180353777 22:11823311-11823333 TAGCGCAGGGGCTGATGGGAAGG + Intergenic
1180353828 22:11823500-11823522 TAGCGCAGGGGCTGATGGGAAGG + Intergenic
1180353871 22:11823731-11823753 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
1180384376 22:12168594-12168616 CAGCGCAGGGGCTGATGAGAAGG - Intergenic
1180384468 22:12169048-12169070 TAGCGCAGGGGCTGATGGGAAGG - Intergenic
1180384519 22:12169272-12169294 CAGCGCAGGGACTGATGGGAAGG - Intergenic
1180493404 22:15879374-15879396 CAGCGAAGGGGCTGATGGGAAGG - Intergenic
1180493464 22:15879589-15879611 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1180493513 22:15879786-15879808 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1180493563 22:15880036-15880058 CAGCGCAGGGGTTGATGGGAAGG - Intergenic
1180493880 22:15881344-15881366 CAGCGCAGGGGCTGATGAGAAGG - Intergenic
1180840923 22:18958457-18958479 CGGGGCGGGGGTAGCCGGGATGG + Intergenic
1181060566 22:20280317-20280339 CGGGGCGGGGGTAGCCGGGATGG - Intronic
1181064510 22:20299216-20299238 AGGAGCGGGCGCGGCTGGGAAGG + Intergenic
1181085582 22:20437971-20437993 GGGGGCGGGGGCTGCGCGGAGGG - Intronic
1183301454 22:37061007-37061029 GGGCCCCGGGGCTGCTGGGGGGG + Intronic
1183363401 22:37394584-37394606 CGGGGCGGGAGCTGCGGGGGAGG - Intronic
1183455776 22:37922337-37922359 GGGCGTGGGGGGTGCTGGGGTGG - Exonic
1183457895 22:37932678-37932700 TGGTGCGGGAGCGGCTGGGAGGG + Exonic
1183472383 22:38016527-38016549 GGGCGAGGGGGCTGCTTGGCAGG + Intronic
1183864642 22:40694529-40694551 CGGGGCGGGGGCTGTAGAGAAGG - Intergenic
1184086904 22:42270700-42270722 CGGCGCGCGGGCGGGCGGGAGGG + Intronic
1184111764 22:42399654-42399676 CTGGGCCGGGCCTGCTGGGAAGG + Intronic
1184923810 22:47623849-47623871 CCGTCCGAGGGCTGCTGGGATGG - Intergenic
1185375572 22:50481451-50481473 CGGGGAGGGGGCTGCGGCGAAGG - Intergenic
1185397651 22:50600961-50600983 CGGGGCTGGGGCGGCGGGGACGG - Intronic
1203254223 22_KI270733v1_random:130916-130938 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1203262279 22_KI270733v1_random:175995-176017 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
949877143 3:8633814-8633836 AGAGGCGGGGGCTTCTGGGAAGG + Intronic
950485832 3:13273609-13273631 CTGGGCAGAGGCTGCTGGGATGG - Intergenic
950666414 3:14497955-14497977 GGGTGCTGGAGCTGCTGGGAGGG + Intronic
952354405 3:32570880-32570902 CGGGGCGGGGCCTGCGGGGGCGG + Intergenic
952706255 3:36380649-36380671 CCTCGCGGGGGCTGCTCGGAGGG - Exonic
954450210 3:50567586-50567608 CGGCTCGGGGCTTGCAGGGAGGG - Exonic
954615629 3:51967573-51967595 CGGCACTGGGGCGGCTGGGGCGG - Intronic
954615692 3:51967744-51967766 CAGCGCGGGCGGTGCGGGGAAGG - Intronic
954802225 3:53193908-53193930 CAGGGAGGGGGCTGCAGGGATGG + Intergenic
955387679 3:58492272-58492294 CTGGGCGGGGGCTCCTGGAACGG + Intronic
957215726 3:77317653-77317675 CTGCTGGGGGGCTGCTGGGGGGG + Intronic
957215808 3:77317847-77317869 CTGCTGGGGGGCTGCTGGGGGGG + Intronic
957792970 3:84962057-84962079 GGGAGCGGGGGGTGCGGGGAAGG + Intronic
960026775 3:113019424-113019446 CGGCCCGGGGGACGCTGGGAAGG - Intronic
961243784 3:125434386-125434408 CTGCATGGGGGCTTCTGGGATGG + Intergenic
961663700 3:128483817-128483839 CTGGGAGGGGGCTGCTGGGCAGG - Intronic
962588145 3:136862505-136862527 GGGCGCGGAGGCTGCTCGGAGGG + Intronic
962816628 3:139006238-139006260 AGGCGCTGGGGCTGCGGGGCCGG + Exonic
962818127 3:139020631-139020653 AGGCGCTGGGGCTGCGGGGCCGG + Exonic
962820617 3:139044590-139044612 AGGCGCTGGGGCTGCAGGGCCGG + Exonic
962850941 3:139307961-139307983 AGGCACGGGGGCTGGTGGGCAGG - Intronic
965290803 3:166876798-166876820 AGGTGGGGTGGCTGCTGGGAGGG + Intergenic
966355059 3:179071377-179071399 CGGGGCGGGGGCAACTGAGAGGG + Intronic
967849473 3:194071129-194071151 GGGCGCGGGGGCGGCCGGGCAGG + Intergenic
968046162 3:195624846-195624868 CGGGGCGGAGGCTGCGGGGCAGG + Intergenic
968308492 3:197665241-197665263 CGGGGCGGAGGCTGCGGGGCAGG - Intergenic
968543515 4:1181673-1181695 CTGCGCTGGGGCTGGTGGGGAGG - Intronic
968601621 4:1512543-1512565 CGGGCCGGGGGCAGCTGGGGTGG + Intergenic
968661879 4:1802052-1802074 CGCCGCTGGGGCTCCTGGGCTGG + Intronic
968850509 4:3074671-3074693 CGCCGTGGGGGCTGCCGGGACGG + Exonic
968942160 4:3644459-3644481 GGGCCTGGGGGGTGCTGGGATGG + Intergenic
969239074 4:5887867-5887889 CCGCGCGAGGCCTGCGGGGAGGG + Intronic
969323311 4:6426115-6426137 CAGGGCGGAGCCTGCTGGGAAGG - Intronic
970635375 4:18004682-18004704 TTGCGGGGGGACTGCTGGGAGGG - Intronic
972863643 4:43203016-43203038 TGTCTTGGGGGCTGCTGGGAAGG + Intergenic
973374083 4:49276061-49276083 CAGCGAAGGGGCTGATGGGATGG - Intergenic
973374196 4:49276485-49276507 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
973374303 4:49276919-49276941 CAGCGCAGGGGCTGATGAGAAGG - Intergenic
973374350 4:49277151-49277173 TAGCGCAGGGGCTGATGGGAAGG - Intergenic
973374451 4:49277564-49277586 CAGCGCAGGGACTGATGGGAAGG - Intergenic
973382960 4:49332677-49332699 CAGCGCAGGGACTGATGGGAAGG + Intergenic
973383061 4:49333090-49333112 TAGCGCAGGGGCTGATGGGAAGG + Intergenic
973383108 4:49333320-49333342 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
973383216 4:49333754-49333776 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
973383329 4:49334178-49334200 CAGCGAAGGGGCTGATGGGATGG + Intergenic
973386586 4:49517719-49517741 CAGCGCAGGGACTGATGGGAAGG + Intergenic
973386635 4:49517943-49517965 TAGCGCAGGGGCTGATGGGAAGG + Intergenic
973386713 4:49518336-49518358 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
973386825 4:49518769-49518791 CCACGCAGGGGCTGATGGGAAGG + Intergenic
973386936 4:49519193-49519215 CAGCGAAGGGGCTGATGGGATGG + Intergenic
973613682 4:52659309-52659331 CGGCGCGGGGAGGGCGGGGAGGG + Exonic
976087849 4:81424508-81424530 TGGAGCTGGGACTGCTGGGAAGG - Intergenic
981898646 4:149835459-149835481 AGGCGGGAGGGGTGCTGGGAGGG - Intergenic
982198488 4:152937626-152937648 CGGGGCGGGGACTGCGGGGCGGG - Intronic
983608071 4:169612651-169612673 CGCAGCGGAGGCGGCTGGGAAGG + Intronic
985660668 5:1155426-1155448 CGGGGCAGGGGCCGCGGGGATGG - Intergenic
985747149 5:1654029-1654051 CGGGGCGGAGGCTGCGGGGCAGG - Intergenic
985770773 5:1809254-1809276 TGGCGTGCGGGCTGCTGTGACGG + Intronic
986321151 5:6633493-6633515 CGGCGCGGGGGCAGGAGGGGCGG - Exonic
988589529 5:32536799-32536821 CGGATCGGGGGCAGCAGGGAAGG - Intronic
989637970 5:43556726-43556748 CGGAGCGGGGCCTGCTGAGCGGG - Exonic
997265066 5:132490589-132490611 CGACGCAGGGGCTGCAGTGAGGG + Exonic
999223468 5:150000705-150000727 CGCCGCGAGGGCCGCCGGGACGG + Exonic
999324735 5:150636794-150636816 CGGGGTGGGGGGTGTTGGGAAGG + Intronic
999727237 5:154446651-154446673 CGGGGCGGCGGCAGCTGGGGCGG - Exonic
1001142947 5:169160684-169160706 CCACGCTGGGGATGCTGGGAGGG - Intronic
1001773365 5:174311836-174311858 CAGAGCGGGGGCTGCTGGAGGGG + Intergenic
1001928872 5:175658625-175658647 GAGAGCGGGGGCTGCTGGGGAGG + Intronic
1001945319 5:175773321-175773343 CGGCGCGGGGGAAGCGGGGCCGG - Intergenic
1002044005 5:176532119-176532141 CGGGACGGCGGCTGCTGGGAGGG + Exonic
1002308157 5:178296493-178296515 CCACGCAGGGGCTGCTGGGAAGG + Intronic
1004426398 6:15510113-15510135 GGGGGCGGGGGCTGTGGGGAGGG + Intronic
1004561884 6:16760285-16760307 CGGCTGCGCGGCTGCTGGGAGGG - Intronic
1004635382 6:17462557-17462579 GGGTGCTGGGGCTGCTGGGAGGG - Intronic
1006154799 6:32008289-32008311 TGGGGCAGGGGCTGCAGGGAGGG - Intergenic
1006161111 6:32041024-32041046 TGGGGCAGGGGCTGCAGGGAGGG - Exonic
1006171582 6:32096324-32096346 GGGCGCGGGCGCTGCGTGGATGG - Intronic
1006370566 6:33641393-33641415 CCTCGCGGGGGATGCTGGAAGGG + Intronic
1006929813 6:37680923-37680945 CTGAGCAGGGCCTGCTGGGAAGG + Intronic
1007605359 6:43114033-43114055 CGGCCCCAGGGCTGCTGGGGCGG + Intronic
1008941052 6:57046503-57046525 CGCCGCAGAGGATGCTGGGATGG - Intergenic
1010597173 6:77778135-77778157 CGGGGCGGGGGGTGGTGGGGTGG + Intronic
1011733977 6:90295236-90295258 CGGCGCGGCCGCTGCCGGGGTGG - Intronic
1017163847 6:151390516-151390538 CGGCGCCGGGGCTGTTGCGCCGG - Intronic
1017793776 6:157823508-157823530 CGGGGCCGGGGCCGCGGGGAGGG + Intronic
1018930841 6:168239408-168239430 CGGGGCAGGGGCTGAGGGGAAGG + Intergenic
1019112130 6:169724600-169724622 CGGGCCGGGGGCCGCGGGGAGGG - Intronic
1019319895 7:410871-410893 TGGAGCTGGGGCTGCAGGGAGGG - Intergenic
1019335319 7:480038-480060 AGGCGCTGGGGGTGCTGGGCTGG + Intergenic
1019354223 7:570527-570549 GGGCTCGGGGACTGCTGGGCAGG - Intronic
1019702330 7:2480055-2480077 CGGGGAGGGGGTTCCTGGGAAGG - Intergenic
1020210557 7:6154890-6154912 CTGCGCGGGGGCTGCTGGGGCGG - Exonic
1020262244 7:6536913-6536935 GGGCGGGGGGGCGGCGGGGAGGG + Intronic
1020787306 7:12588819-12588841 GGGTGCGGGGGCGGGTGGGAAGG + Intronic
1022101193 7:27170010-27170032 CGGCGGGCGGGCAGCTAGGAGGG - Intronic
1022485126 7:30771818-30771840 CGGGGCGGCGGCAGCTGGGGAGG + Intronic
1023831965 7:44044713-44044735 CGGCGCGGAGACTGCGGGGCGGG + Exonic
1026911602 7:74094591-74094613 AGGCGTGGGGGCTTCTGCGAGGG + Intronic
1028173553 7:87628234-87628256 CGACGCGTGGGCTGCTGTCAAGG - Intronic
1028417466 7:90595943-90595965 GAGCGCGGGGGCGGCCGGGAGGG + Intronic
1029123242 7:98281890-98281912 CGGCGGGGGCGCGGCGGGGATGG - Exonic
1029169005 7:98617770-98617792 CGGCGCGGGGGCCACGGGCAAGG + Exonic
1029207589 7:98878709-98878731 CGGCGCGGCGGCTCCGCGGAGGG + Intronic
1029285949 7:99466171-99466193 CCGCGCGAGGGCTGCTGGGTAGG + Exonic
1029381820 7:100220048-100220070 AGGGGCAGGGGCTGCAGGGAGGG + Intronic
1029401987 7:100352498-100352520 AGGGGCAGGGGCTGCAGGGAGGG + Intronic
1029452066 7:100646893-100646915 GGGCGTGGGGGAGGCTGGGAAGG - Intronic
1031997238 7:128240912-128240934 CGGGGCGGGGGTGGCTGTGAGGG - Intergenic
1032529491 7:132608673-132608695 GGGGGTGGGGGATGCTGGGAGGG - Intronic
1033406401 7:141074134-141074156 CGGCCCGGGGACTGCGGGGATGG - Intergenic
1034392794 7:150800001-150800023 CGGTGGGGTGGCTCCTGGGACGG - Intronic
1034441062 7:151086359-151086381 AGGGGCGGGGGCGGCGGGGAGGG + Intronic
1035202399 7:157276074-157276096 GGGCGAGGGTGCTGCAGGGAGGG - Intergenic
1035209624 7:157318178-157318200 CTGCCCAGTGGCTGCTGGGAAGG + Intergenic
1035222421 7:157414084-157414106 CCGCCCTGGGGCTGCCGGGATGG - Intronic
1035401890 7:158570975-158570997 CATGGCGGCGGCTGCTGGGAAGG - Intronic
1035589388 8:801614-801636 GGACGGTGGGGCTGCTGGGATGG + Intergenic
1035726445 8:1827159-1827181 CAGCGTGGGGGCTGGTGGCAGGG - Intronic
1035737898 8:1902140-1902162 CGGGGCGGGGGGTGAGGGGAGGG - Intronic
1036793697 8:11740468-11740490 CGGGGTGGGGACTGCTGGGCAGG + Intronic
1037567411 8:20129562-20129584 AGGCGTGATGGCTGCTGGGAAGG - Intergenic
1037633113 8:20676406-20676428 GGGAGCGGTGGCTGGTGGGAGGG + Intergenic
1037877332 8:22554515-22554537 CAGCGCGGAGGCTGCGGGGTGGG - Exonic
1038450059 8:27634032-27634054 CGGCGCGCGGGCTGCGGAGGCGG - Intronic
1039798204 8:40933179-40933201 CCACGTGGGGGCTGCTGGGGTGG - Intergenic
1040106427 8:43544819-43544841 CAGCGCAGGGCCTGTTGGGAAGG + Intergenic
1040106607 8:43545511-43545533 CAGCGCAGGGCCTGCCGGGAAGG + Intergenic
1040106789 8:43546152-43546174 CGGCGCAGGGCCTGCCGGGAAGG + Intergenic
1040107462 8:43548786-43548808 CCACGCAGGGCCTGCTGGGAAGG + Intergenic
1040107515 8:43549004-43549026 CGGCGCAGGGCCAGCTGGGAAGG + Intergenic
1040107569 8:43549222-43549244 TGGGGCAGGGCCTGCTGGGAAGG + Intergenic
1040107923 8:43550563-43550585 CGGCGCAGGGCCTGCTGGGAAGG + Intergenic
1040108085 8:43551235-43551257 AGGCGCAGGGCCTGCTGGGAAGG + Intergenic
1040110246 8:43564011-43564033 TGGCGCAGGGCCTGTTGGGAGGG + Intergenic
1040111081 8:43567464-43567486 CGGTGCGGGGGCTGCCGGGAAGG + Intergenic
1040111145 8:43567683-43567705 GGTCGCGGGGGCTGCCGGGAAGG + Intergenic
1040111412 8:43568606-43568628 AGGCACGGGGTCTGTTGGGAAGG + Intergenic
1040111506 8:43568917-43568939 AGGTGCGGGGACTACTGGGAAGG + Intergenic
1040111856 8:43570222-43570244 TGGCTTGGGGACTGCTGGGAAGG + Intergenic
1040111916 8:43570438-43570460 GGGCGCGGGGGCTGCTGGGAAGG + Intergenic
1040275804 8:46013061-46013083 CCATGCAGGGGCTGCTGGGAAGG + Intergenic
1040276362 8:46016052-46016074 CTGTGCAGGGGCTGCCGGGAAGG + Intergenic
1040276510 8:46016664-46016686 CAGCGCAGGGGCTGCTGGCAAGG + Intergenic
1040276704 8:46017533-46017555 CTGTGCAGGTGCTGCTGGGATGG + Intergenic
1040276750 8:46017756-46017778 CAGTGCAGAGGCTGCTGGGAAGG + Intergenic
1040277342 8:46020784-46020806 CCGCACAGGGGCTTCTGGGAAGG + Intergenic
1040277826 8:46022948-46022970 CAGCACAGAGGCTGCTGGGAAGG + Intergenic
1040278525 8:46025995-46026017 TGGCGCAGGGGCTTCCGGGAAGG + Intergenic
1040278578 8:46026212-46026234 CAGCACAGGGGCTGCCGGGAAGG + Intergenic
1040278736 8:46026872-46026894 TGGCGCAGGGGCTGCTGGGACGG + Intergenic
1040293195 8:46135945-46135967 CAGCCCAGGGGCTTCTGGGATGG + Intergenic
1040330158 8:46381771-46381793 CAGCCCAGGGGCTTCTGGGATGG - Intergenic
1040333264 8:46403191-46403213 CAGCCCTGGGGCTTCTGGGATGG - Intergenic
1040334455 8:46408996-46409018 CAGCTCTGGGGCTTCTGGGAGGG - Intergenic
1040335081 8:46412014-46412036 CAGCCCTGGGGCTTCTGGGATGG - Intergenic
1040342580 8:46448396-46448418 CGGCCCAGGAGCTTCTGGGAAGG + Intergenic
1041637068 8:60156322-60156344 CGGTCTGGGGGCTGTTGGGAGGG + Intergenic
1044245485 8:89939731-89939753 CTGCCAGTGGGCTGCTGGGAAGG + Intronic
1048155333 8:131942734-131942756 TGGAGTGGGGGCTGTTGGGAGGG + Intronic
1048304034 8:133271134-133271156 CTGCCCAGGGCCTGCTGGGAAGG - Intronic
1048344836 8:133568795-133568817 TGGCTCGGGGGCTGCTTGGTGGG + Intronic
1048620169 8:136124001-136124023 CGGGGTGGGGGCTGAGGGGAGGG - Intergenic
1049271278 8:141697544-141697566 CTGCGCCTGGGCTGCTGGGCTGG + Intergenic
1049330188 8:142046279-142046301 CAAGGCGGGGGCTGCAGGGAGGG + Intergenic
1049427101 8:142542495-142542517 GGGGGCAGGGGCTGCTGGGGAGG - Exonic
1049569091 8:143360015-143360037 CGCCGCCGGTGCTGCCGGGAAGG + Intergenic
1049571791 8:143373085-143373107 CGGTGCGGGGGCTTGGGGGATGG + Intronic
1049571900 8:143373354-143373376 CGGGGCGGGGGCTTGGGGGATGG + Intronic
1049571963 8:143373507-143373529 CGGGGCGGGGGCTTGGGGGATGG + Intronic
1049641070 8:143716271-143716293 GGGGGCGGGGGGTGTTGGGAGGG + Exonic
1049674144 8:143882416-143882438 CTGGGCTGGAGCTGCTGGGAGGG - Intergenic
1049687995 8:143946671-143946693 GGGCGGGGGGTCTGCTGGGCGGG - Intronic
1049861627 8:144902455-144902477 CTGCGTGGGGGCGGCGGGGAAGG + Intergenic
1053643921 9:40110354-40110376 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1053644123 9:40111194-40111216 CAGCGCAGGGCCTGATGGGAAGG - Intergenic
1053762033 9:41354291-41354313 CAGCGCAGGGCCTGATGGGAAGG + Intergenic
1053762231 9:41355135-41355157 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1053762331 9:41355528-41355550 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1054324675 9:63707189-63707211 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1054324777 9:63707583-63707605 CAGCGCAGGGGCTGATGGGAAGG - Intergenic
1054350735 9:64015587-64015609 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1054350848 9:64016011-64016033 CAGCGAAGGGGCTGATGGGATGG + Intergenic
1054540627 9:66265408-66265430 CAGCGCAGGGCCTGATGGGAAGG + Intergenic
1054540828 9:66266255-66266277 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1054540926 9:66266647-66266669 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1057045988 9:91886585-91886607 CGGGCCGGGGGTTGCCGGGAAGG - Intronic
1057187374 9:93064398-93064420 AGGCTCTGGGGATGCTGGGAAGG + Intronic
1057208079 9:93184986-93185008 CGGCGCGGGGCCCGCGGGCATGG + Exonic
1057259668 9:93576677-93576699 CCGCGCGGGGGCGGCGGGGGCGG - Exonic
1057494955 9:95553496-95553518 CGGCGGGGCGGCGGCTGGGGCGG - Intergenic
1058357025 9:104094558-104094580 GGGCGCGGGGGCTGTAGGGAGGG + Intronic
1059375140 9:113875906-113875928 GGGCGCGGGGGGCGCGGGGAGGG + Intergenic
1059942168 9:119369159-119369181 CGGCGCGGGGACTGCAGGCGTGG + Exonic
1061050348 9:128191480-128191502 AGGCGTGGGGGCTGCGGGGCCGG - Exonic
1061149080 9:128818779-128818801 CGGCGCCGGGACTGCTGGGCCGG + Exonic
1061765394 9:132878338-132878360 CGGCGCGGAGCCTGCAGGGCGGG - Exonic
1061873947 9:133534767-133534789 CGGCGCGGGGGAGGAGGGGAAGG + Intronic
1062013526 9:134279963-134279985 GGGTGCGGGGGCTGCTGCCAGGG - Intergenic
1062208480 9:135350111-135350133 CGGCGCTGGGGCAGCGGGGAGGG + Intergenic
1062364361 9:136201977-136201999 CGGCGCGGGGTGGGCTGGGGCGG - Intronic
1062385338 9:136307136-136307158 GGGAGCTGGTGCTGCTGGGAGGG - Intergenic
1062565796 9:137163464-137163486 CGGGGCGGGGCCTGCGGGGTAGG - Intronic
1202791568 9_KI270719v1_random:92924-92946 CAGCGCAGGGCCTGATGGGAAGG - Intergenic
1203698020 Un_GL000214v1:115059-115081 TAGCGCAGGGGCTGATGGGAAGG - Intergenic
1203698067 Un_GL000214v1:115249-115271 TAGCGCAGGGGCTGATGGGAAGG - Intergenic
1203470624 Un_GL000220v1:114060-114082 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1203478445 Un_GL000220v1:158032-158054 CGGCTCCGGGACGGCTGGGAAGG + Intergenic
1203551085 Un_KI270743v1:165508-165530 CAGCGCAGGGACTGATGGGAAGG + Intergenic
1203551187 Un_KI270743v1:165922-165944 TAGCGCAGGGGCTGATGGGAAGG + Intergenic
1203551232 Un_KI270743v1:166159-166181 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
1203551335 Un_KI270743v1:166590-166612 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1203551444 Un_KI270743v1:167013-167035 CAGCGAAGGGGCTGATGGGATGG + Intergenic
1185736499 X:2500497-2500519 CTGCACGGGGGCTGCTTGGTTGG + Intronic
1188811394 X:34657257-34657279 CGGCGCGGGGCCGGCGGCGAAGG - Exonic
1190062254 X:47219046-47219068 CGGCGCGGCGGCGCCTGGGGCGG - Intronic
1190214244 X:48469301-48469323 GGGAGCGTGGGCTGCGGGGATGG - Intronic
1191251202 X:58261031-58261053 CGGCTCAGAGGCTGCTGGGAAGG - Intergenic
1191251254 X:58261224-58261246 TGGCGCAGGGGCTGCTGGGAAGG - Intergenic
1191252727 X:58267146-58267168 TGGCCCAGGGGCTGCTGGAAAGG + Intergenic
1191253328 X:58269486-58269508 CTGCGCAGGGGCTGCCGGGAAGG + Intergenic
1191253453 X:58269933-58269955 CCATGCAGGGGCTGCTGGGAAGG + Intergenic
1191253680 X:58270802-58270824 TGGCGCAGAGGCTGCTGGGAAGG + Intergenic
1191253996 X:58271985-58272007 AAGTGCGGGTGCTGCTGGGAAGG + Intergenic
1191254243 X:58272956-58272978 GGGCGCAGGGGCTGCTGGGAAGG + Intergenic
1191254397 X:58273546-58273568 AGGCACCAGGGCTGCTGGGAAGG + Intergenic
1191255143 X:58276435-58276457 GGGTGCGGGGGCTCCCGGGAAGG + Intergenic
1191255437 X:58277623-58277645 AGGTGCAGGTGCTGCTGGGAAGG + Intergenic
1191255489 X:58277836-58277858 GGGCGCGGGGGCTGCAGAGAAGG + Intergenic
1191255536 X:58278025-58278047 AGGCGCAGGGGCTGCCGGGAAGG + Intergenic
1191255803 X:58279072-58279094 AGGCGAGGAAGCTGCTGGGAAGG + Intergenic
1191256233 X:58280791-58280813 GGGCACAGGGGCTGCCGGGAAGG + Intergenic
1191257494 X:58285945-58285967 AGGTGCGGGGGCTGCCAGGAAGG + Intergenic
1191257845 X:58287498-58287520 CAGCGCAGGGGCTGCCCGGAAGG - Intergenic
1191258010 X:58288151-58288173 CGACGCAGGGGCTGCCGGGAAGG - Intergenic
1192491022 X:71577889-71577911 GGGGGCGGGGGTTGCAGGGAAGG - Intergenic
1194490267 X:94536917-94536939 CGGGGTGGGGGCTGAGGGGAGGG + Intergenic
1197869515 X:131051685-131051707 CATCACGGGGGCTGGTGGGAAGG - Intergenic
1198870884 X:141176510-141176532 CGGGGTGAGGGCTGCGGGGAGGG + Exonic
1199471272 X:148198683-148198705 CGGAGGGGGGGCGGCGGGGAGGG + Intergenic
1199992063 X:152993003-152993025 GGGCAGGGGGGCTGCTGGTAGGG + Intronic
1200951821 Y:8905177-8905199 AGGGGTGGGGGCTGCTGGCAGGG + Intergenic
1201151490 Y:11097652-11097674 CAGCGCAGGGGCTGATGGGAAGG + Intergenic
1201152408 Y:11101335-11101357 CAGTGCAGGGGCTGATGGGAAGG + Intergenic
1201152501 Y:11101766-11101788 CAGCGCAGGGGCTGATGAGAAGG + Intergenic
1201152719 Y:11102616-11102638 CAGCGAAGGGGCTGATGGGATGG + Intergenic
1201490454 Y:14535643-14535665 CGGGGCGGGGGTTGGGGGGATGG + Intronic
1201763440 Y:17560919-17560941 CGGCGCAGGGGCCGCCAGGAAGG + Intergenic
1201763537 Y:17561297-17561319 CAGCGCAGGGGTTGCCGGGAAGG + Intergenic
1201764156 Y:17563805-17563827 CAGCGTAGGGGCTGCCGGGAAGG + Intergenic
1201764325 Y:17564612-17564634 CGGCGCAGGGTCTGCCGGGAAGG + Intergenic
1201764675 Y:17566100-17566122 TGGCACAGAGGCTGCTGGGAAGG + Intergenic
1201836878 Y:18339890-18339912 TGGCACAGAGGCTGCTGGGAAGG - Intergenic
1201837228 Y:18341378-18341400 CGGCGCAGGGTCTGCCGGGAAGG - Intergenic
1201837397 Y:18342185-18342207 CAGCGTAGGGGCTGCCGGGAAGG - Intergenic
1201838016 Y:18344693-18344715 CAGCGCAGGGGTTGCCGGGAAGG - Intergenic
1201838113 Y:18345071-18345093 CGGCGCAGGGGCCGCCAGGAAGG - Intergenic
1201904597 Y:19076665-19076687 GAGCCCGGGGGCTGCTGTGAGGG - Intergenic