ID: 1083992882

View in Genome Browser
Species Human (GRCh38)
Location 11:66257756-66257778
Sequence GCGGGGGCTGCTGGGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 873
Summary {0: 1, 1: 0, 2: 6, 3: 97, 4: 769}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992869_1083992882 16 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769
1083992870_1083992882 10 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769
1083992867_1083992882 19 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769
1083992878_1083992882 -10 Left 1083992878 11:66257743-66257765 CCTTTAAGGCGGCGCGGGGGCTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769
1083992871_1083992882 7 Left 1083992871 11:66257726-66257748 CCGAGGTAGCGGCTTCACCTTTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769
1083992864_1083992882 22 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769
1083992866_1083992882 20 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769
1083992865_1083992882 21 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG 0: 1
1: 0
2: 6
3: 97
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992882 Original CRISPR GCGGGGGCTGCTGGGAAGGC CGG Intronic
900191594 1:1354503-1354525 GTGGGGTCTGCGGGGAACGCGGG + Exonic
900290232 1:1920650-1920672 GCTGGGGGAGCTGGGCAGGCAGG - Intergenic
900319384 1:2075000-2075022 GTGCTGGCTGCTGGGGAGGCTGG + Intronic
900539889 1:3197347-3197369 GCTGGGGCCGCTGTGATGGCTGG - Intronic
900613239 1:3553254-3553276 GTGGGGGGAGCTGGGCAGGCTGG - Intronic
900614162 1:3556987-3557009 GCTGGGGATGCGGGGAAGGCAGG + Intronic
900614842 1:3560838-3560860 GAGGGGGTTGCTGGGCTGGCTGG + Intronic
900824413 1:4914483-4914505 GAGAGGGCTGCTGAGAGGGCTGG + Intergenic
901011457 1:6205051-6205073 GGGGGCACTGCTGGAAAGGCCGG + Intronic
901130993 1:6962565-6962587 GTGGGGCCAGGTGGGAAGGCTGG - Intronic
901206313 1:7497927-7497949 GACGGGGCTGCTCGGAAGACAGG + Intronic
901654347 1:10760791-10760813 GCCGTGGCAGCTGGGAGGGCAGG + Exonic
901672837 1:10866335-10866357 GCCGGGGCTGGTGGGGGGGCAGG - Intergenic
901796060 1:11680510-11680532 GCGGGGGCGTCTGGGCCGGCGGG - Intronic
901811808 1:11771642-11771664 ACGTGGGGTGCTGGGAAAGCGGG + Intronic
901853969 1:12032243-12032265 GGGGGGGCCCCTGGGCAGGCTGG + Intergenic
902232425 1:15036374-15036396 GCAGGGGGAGCTGGGCAGGCAGG - Intronic
902472288 1:16657260-16657282 CCTGGGCCTCCTGGGAAGGCAGG + Intergenic
902486515 1:16750186-16750208 CCTGGGCCTCCTGGGAAGGCAGG - Intronic
902504347 1:16929796-16929818 CCTGGGCCTCCTGGGAAGGCAGG - Intronic
902799088 1:18818394-18818416 GGGAGGGCTGGAGGGAAGGCAGG + Intergenic
902931085 1:19732002-19732024 GCTGGAGCTGCTGTGAAGGCCGG + Intronic
903016798 1:20366714-20366736 GCGGAGGCTGCCGGGAGGGCGGG - Intergenic
903127135 1:21255915-21255937 GCGCCGGCTGCTAGGGAGGCTGG - Intronic
903792754 1:25906056-25906078 GCGGGGCCCGCAGGGAAGGGAGG + Intronic
904050527 1:27635391-27635413 GAGGGGGCTTTTGGGAAGGCCGG - Intergenic
904433110 1:30477842-30477864 GGGAGGGCTGCTGGGCACGCGGG - Intergenic
904479848 1:30786898-30786920 GCCACGGCTGCTGGGAAGTCAGG + Intergenic
904619478 1:31766669-31766691 GCAGGGGCTCCTGGGAAAGGAGG - Intergenic
905188306 1:36212941-36212963 GGTGGGGCTGCTGGGGAGGAAGG + Intergenic
905304473 1:37007970-37007992 CCTGGGGCTTCTGGGAATGCAGG - Intronic
905321373 1:37119782-37119804 GGGGAGGCTGCTGGGGGGGCTGG - Intergenic
905876021 1:41432562-41432584 GCGGTGGCGGCTGGGCAGCCTGG - Intergenic
905943517 1:41883224-41883246 GCAGGAGCTGCTGGGAAGGCTGG + Intronic
906046398 1:42834361-42834383 GCAGGTGCTCCTGGGAAGACTGG + Intronic
906295354 1:44646046-44646068 CCTTGGGCTTCTGGGAAGGCAGG - Intronic
906524737 1:46487600-46487622 ACAGGAGCTGCTGGGCAGGCTGG - Intergenic
906529094 1:46512939-46512961 GCGGAGGCTGCAGGGAGGGGTGG - Exonic
906974301 1:50552747-50552769 GTGGGGGCAGCTGGGAGGGGAGG + Intronic
907213413 1:52842593-52842615 GCTGGGGAGGCTGGGGAGGCGGG + Intronic
907308246 1:53525456-53525478 GCTGGGGAGGCTGGGGAGGCTGG + Intronic
907418121 1:54328523-54328545 GCGAGAGCTGCTGGGATTGCTGG - Intronic
907469698 1:54665304-54665326 GCGGAGGCTGCTGGGCTGGGGGG - Intronic
910858544 1:91720138-91720160 GCGGGTTCTGCAGGGCAGGCAGG + Exonic
911087325 1:93989790-93989812 AGCGGGGCTGCAGGGAAGGCTGG + Intergenic
912165775 1:107040544-107040566 TGGGGGACTGTTGGGAAGGCAGG + Intergenic
912414392 1:109498237-109498259 GCGGGGGCTGGTGGGCGGGCGGG + Intronic
912740015 1:112185966-112185988 GAGGGAGCTACTGGGAAAGCAGG + Intergenic
912866567 1:113263055-113263077 GAGGGGGCTGCTGGGAAACTGGG - Intergenic
914048102 1:144106615-144106637 GCTGGGGCGGCTGGGCTGGCTGG + Intergenic
914131081 1:144858833-144858855 GCTGGGGCGGCTGGGCTGGCTGG - Intergenic
915144003 1:153783835-153783857 GCGGGGCAGGCTGGGGAGGCGGG + Intergenic
915564950 1:156707965-156707987 GCTGAGGCTGCTGGGGAGGCTGG + Intergenic
915935752 1:160089438-160089460 GAGGGGGCTCCTGGGGAGGTCGG + Exonic
916170682 1:161999541-161999563 TCGGGGCCTGCTGGGAGTGCTGG + Intronic
916707898 1:167371958-167371980 CTGAAGGCTGCTGGGAAGGCTGG - Exonic
917035349 1:170742421-170742443 TGGGGGACTGTTGGGAAGGCAGG - Intergenic
917581841 1:176386725-176386747 GTAGGGGGTGCTGAGAAGGCAGG + Intergenic
918082716 1:181220142-181220164 GCAGAGACTGCTGGGGAGGCAGG - Intergenic
918487525 1:185045449-185045471 GCCGGCGCTGCGGGGAGGGCGGG - Exonic
919684632 1:200472222-200472244 GTGGGGGCTGATGGGAGGGAAGG + Intergenic
919765882 1:201127169-201127191 GAAGGTGCTGCTGGGCAGGCGGG - Exonic
919858010 1:201718762-201718784 GCAGGGGCTTCTTGGATGGCGGG + Intronic
919895634 1:202008252-202008274 GCTGGGGCTCCCGGGATGGCGGG - Exonic
920099453 1:203507815-203507837 GGAGGGGCTGCTGGAGAGGCTGG + Intronic
920173719 1:204087339-204087361 GCTGGTGCCCCTGGGAAGGCAGG - Intronic
920505671 1:206513634-206513656 CTGGCGGCAGCTGGGAAGGCCGG + Intronic
920531135 1:206703462-206703484 GCTGGGGCTGCTTGGAGAGCAGG + Intronic
920900626 1:210106826-210106848 TGGGGGACTGTTGGGAAGGCAGG - Intronic
921177658 1:212608321-212608343 GCGGGGGGGGCGGGGAAGGTGGG - Intronic
921293795 1:213683507-213683529 GCTGAGGGTGCTGGGCAGGCTGG - Intergenic
921866718 1:220094290-220094312 TCCCGGGCTGCAGGGAAGGCGGG - Exonic
922503814 1:226115079-226115101 GAGGGGGCGGCTGGCCAGGCAGG + Intergenic
922693068 1:227710782-227710804 GAGGGGGCGGCTGGCCAGGCGGG + Intergenic
922769753 1:228175530-228175552 GCGCAGGCTGATGGGGAGGCTGG + Exonic
922784878 1:228277864-228277886 GTGGGGGCTGAGGGGAGGGCGGG + Intronic
924321416 1:242854823-242854845 GCTGCGGCTGCTGTGAAGGATGG + Intergenic
924560712 1:245155040-245155062 GCGGCCGCTGCCGGGAAGGTGGG - Exonic
1062854661 10:773900-773922 GCGGGCCCTGCTGGGGAGGGCGG + Intergenic
1063200967 10:3785252-3785274 GCGGGGGCGGAGGGGGAGGCTGG - Exonic
1063601239 10:7483097-7483119 GTGGGGACTGCTGGGCAGGGTGG + Intergenic
1063636448 10:7787634-7787656 CCGGGGGCTGCGGGGAGGGACGG + Intronic
1064228244 10:13506263-13506285 GCGGGGCCAACAGGGAAGGCAGG - Intronic
1064832689 10:19488959-19488981 GCGGGGGCGGAGGAGAAGGCGGG + Intronic
1065115164 10:22477276-22477298 CCCGGGGCTGCTGGGGACGCAGG - Intergenic
1065528427 10:26645563-26645585 GGCGGGGCTGCTGGCAGGGCAGG + Intergenic
1065738891 10:28778883-28778905 GAGTGGGGTGCTGGGGAGGCAGG - Intergenic
1065882580 10:30049186-30049208 ACGGGGGCTGATGGTAATGCTGG + Intronic
1066429219 10:35336459-35336481 GCGGGGGCTGCGGCGAGGGCGGG + Intronic
1066600206 10:37096833-37096855 GAGGGAGCAGGTGGGAAGGCTGG + Intergenic
1067317408 10:45181110-45181132 GCGCGGGCTGCATGGGAGGCTGG + Intergenic
1067436852 10:46284657-46284679 GCGGGTGCAGCCAGGAAGGCGGG - Intergenic
1067853069 10:49768083-49768105 ACTGGGGCTGGTGGAAAGGCCGG - Intergenic
1068096626 10:52499454-52499476 GCCGCGGCTGCTGGGAGGGATGG + Intergenic
1069615970 10:69806351-69806373 GAGGGAGCTGCAGGGAGGGCCGG + Intronic
1069893453 10:71666198-71666220 GAGGGTGCTACTGGGAAGGGGGG - Intronic
1070176548 10:73975464-73975486 GGCTGGGCTGCTGGGATGGCTGG - Intergenic
1070748101 10:78947307-78947329 GCAGCGGCTGCTGGGCTGGCAGG - Intergenic
1070752703 10:78973579-78973601 GCGGCGGCTGCTGGGGCTGCTGG - Intergenic
1070770763 10:79081082-79081104 GAGGGAGCTGCTGGGGAGGCAGG - Intronic
1070813729 10:79311049-79311071 GTGGCGGCTGCCGGGGAGGCTGG - Exonic
1070814041 10:79312247-79312269 AGGTGGGCTGGTGGGAAGGCGGG - Intronic
1070935302 10:80289592-80289614 GCGAGGACTGCTGAGAAGGGAGG + Exonic
1071492897 10:86148035-86148057 GTGGGACCTGCTGGCAAGGCAGG + Intronic
1071530514 10:86387781-86387803 GCTGGGGCAGCCAGGAAGGCTGG - Intergenic
1073131705 10:101193244-101193266 GCGGGGACTAGAGGGAAGGCTGG + Intergenic
1073180417 10:101579829-101579851 GAGGGGACTGCTGGGAGGGCAGG + Intronic
1073688744 10:105784381-105784403 GCCTGGGCTGCTGGGGAGGAAGG + Intergenic
1074525603 10:114260612-114260634 GTGTGGGCTGCTGAGAAGGCAGG + Intronic
1074562195 10:114544416-114544438 GTGGCGGCTGCTGAGAAAGCAGG + Intronic
1074703603 10:116112727-116112749 TCCGGGGCTGCTTGGCAGGCTGG - Intronic
1075046485 10:119150281-119150303 GCTGGGGCTGCTGGGGAGACGGG + Intronic
1075298563 10:121299793-121299815 CTGGAGGCTGCTGGGAAGGAAGG + Intergenic
1075645051 10:124091884-124091906 GCCGGCGCGGCTGGGACGGCGGG - Intronic
1075652790 10:124140176-124140198 GGTGGAGCTGCTGGGCAGGCAGG + Intergenic
1076187079 10:128458414-128458436 GCAGGGGATGCTGGGAAGGAGGG + Intergenic
1076814002 10:132905663-132905685 GTGGTGGCTGCTGAGAAGGTTGG + Intronic
1077018507 11:407263-407285 GCGGGGCCTGCGGGGTGGGCGGG + Intronic
1077145646 11:1043084-1043106 GTGGGGGATGCTGGCATGGCTGG + Intergenic
1077228846 11:1449814-1449836 CCGGGGGCTGCTGAGTGGGCTGG - Exonic
1077252674 11:1567506-1567528 GCTGGGGCTCCTGGGCAGGGAGG - Intronic
1077406931 11:2386879-2386901 CCGAGGGTTGCAGGGAAGGCTGG - Intronic
1077442476 11:2575113-2575135 CAGTGGGCGGCTGGGAAGGCAGG - Intronic
1077891215 11:6419256-6419278 GGGGTGTCTGCTGGGAGGGCTGG - Intronic
1078515605 11:12019489-12019511 GCTGGGGCTCATGGGAAGGCAGG + Intergenic
1078679551 11:13463043-13463065 GCGGGGGCGGCGCGGGAGGCTGG - Intronic
1080682583 11:34490289-34490311 GCAGAGGCTGCTGGGAAGCCTGG - Intronic
1081759231 11:45565399-45565421 GCCGGGGGTGCTGAGCAGGCCGG - Intergenic
1081867501 11:46367586-46367608 GCGGGGGCTGATGGGAGGGAGGG + Intronic
1081935142 11:46899026-46899048 GCTGAGGCTGGAGGGAAGGCAGG + Exonic
1082009643 11:47441562-47441584 GTGGGGAGTGCTGGGAGGGCTGG + Intronic
1083322728 11:61857301-61857323 CCGGGGCCTGCAGAGAAGGCTGG - Intronic
1083419973 11:62546948-62546970 GAGTGGGCTGCTGGGGAGGGGGG + Intronic
1083730636 11:64650675-64650697 GGGGGTGATGCTGGGAAGGTGGG + Intronic
1083800939 11:65045908-65045930 CAGGGGGCTGGTGGGGAGGCAGG + Exonic
1083825758 11:65202891-65202913 GCCAGGGCTGCTGGGAGGGCTGG - Intronic
1083992882 11:66257756-66257778 GCGGGGGCTGCTGGGAAGGCCGG + Intronic
1084151347 11:67289300-67289322 GCGCGGGCGGCAGGGAGGGCGGG - Exonic
1084151539 11:67289898-67289920 GAGGGGGCAGGAGGGAAGGCAGG - Intronic
1084195898 11:67523480-67523502 TCGGGGGCGGGTGGGCAGGCGGG + Intergenic
1084509160 11:69592424-69592446 GTGGGGGTGGGTGGGAAGGCTGG - Intergenic
1084685064 11:70688467-70688489 GCCGGGGCTGCTGGCTTGGCTGG - Intronic
1084900478 11:72306418-72306440 GCCCTGGATGCTGGGAAGGCTGG + Intronic
1085284891 11:75353038-75353060 GGGGAGGCTGATGGGTAGGCAGG + Intergenic
1085385182 11:76153447-76153469 GTGGGGGCTATTTGGAAGGCAGG - Intergenic
1085463390 11:76708571-76708593 GGGGGGGCTGCTGGAGAGCCAGG + Intergenic
1085791614 11:79501742-79501764 GCGGGGGATGGTGGTAAGGGAGG + Intergenic
1085890181 11:80570071-80570093 GAGGGAGCAGGTGGGAAGGCTGG - Intergenic
1088361210 11:108991998-108992020 GTGGGGTCTGCTGGGAAGGAGGG + Intergenic
1089243082 11:117098300-117098322 GCGGGGGCGGCTGGGGACCCCGG + Exonic
1089573002 11:119422617-119422639 GCGGGGACTGGGTGGAAGGCGGG - Intronic
1089616028 11:119695309-119695331 GCGGGGACTGGTGGGGAGGGTGG - Intronic
1089729454 11:120511511-120511533 GCGGGGGCGGCGGGAACGGCGGG - Intergenic
1089729457 11:120511520-120511542 GCGGGGGCGGCGGGGGCGGCGGG - Intergenic
1089730896 11:120518060-120518082 GGGGAGGCTGCTGAGAAGGGAGG + Intronic
1089736937 11:120556135-120556157 GCGGGGAGTGCTGGTAAGCCTGG + Intronic
1090206569 11:124887563-124887585 AAGGGGGCTGGTGGGCAGGCCGG - Intronic
1090849555 11:130560340-130560362 GCGGGGTTTGAGGGGAAGGCAGG - Intergenic
1091290596 11:134437385-134437407 GCAGGGGCAGCGGGGAAGGAGGG - Intergenic
1091372570 11:135073186-135073208 GTGGGGGGTGCTGGAGAGGCAGG - Intergenic
1091451551 12:575411-575433 GCAGGAGCAGCTGGGAAGGGTGG - Intronic
1091674930 12:2482262-2482284 GCAGCATCTGCTGGGAAGGCGGG - Intronic
1091684960 12:2555141-2555163 GCTGGGGGTGCTGGGAAAGGAGG - Intronic
1091731637 12:2885390-2885412 GCGGGGCTTTCTGGGAAGGCTGG - Exonic
1091782639 12:3223640-3223662 GCAGGGACTGCTGGAGAGGCAGG - Intronic
1091901202 12:4145514-4145536 GAGGGGTCAGCTGGAAAGGCAGG - Intergenic
1091903496 12:4164668-4164690 GCGGGGACTGCGGGGAAGCGAGG - Intergenic
1092204548 12:6607120-6607142 GCGGGGGCTGGGGAGGAGGCCGG + Intronic
1092230991 12:6775195-6775217 GCTGGGGCTGCAAGGAAGGGAGG - Intronic
1092387639 12:8048216-8048238 GTGGTGGCTGCTGGGCAGGGTGG - Exonic
1093020866 12:14202694-14202716 CAGGAGGCTGCTAGGAAGGCTGG + Intergenic
1093547914 12:20369503-20369525 GCTGGCGCTGCTGGTGAGGCTGG + Exonic
1095110996 12:38294927-38294949 GCGTGGGCTTCTGGGTAGGGTGG + Intergenic
1095347404 12:41167922-41167944 ATGGGTGCTGCTGGGGAGGCAGG - Intergenic
1095461180 12:42446059-42446081 GCGGGGGCTGCGGGGCCTGCAGG - Exonic
1095687240 12:45050487-45050509 GCGGGCGCGGCTGGGGAGGGAGG + Intronic
1095963589 12:47851501-47851523 GCGGAGGGTGTGGGGAAGGCAGG - Intronic
1096178804 12:49539547-49539569 GCTGGGGGTTCGGGGAAGGCGGG - Intronic
1096225954 12:49867161-49867183 GCGGTGGCTGATGAGAAGACAGG + Exonic
1096465669 12:51846969-51846991 GCGGGGCTTGCTGGGGTGGCTGG - Intergenic
1096517578 12:52165621-52165643 GAGGAGGCTGCTGGGAAGGAGGG - Intergenic
1096532464 12:52250337-52250359 GTGGGGGCCGATGGGGAGGCTGG + Intronic
1098521565 12:71439857-71439879 GCCAGGGCTGCTCCGAAGGCCGG + Exonic
1098854463 12:75636743-75636765 GCGGGGGGTGCAGGGAATGTTGG - Intergenic
1099248036 12:80217274-80217296 TCGGGGGCTGGGGGGAAGACTGG + Intronic
1099820790 12:87706649-87706671 GCGGGGCCTGTTGGGAGGTCGGG + Intergenic
1100348223 12:93753411-93753433 TGGGGGACTGTTGGGAAGGCAGG - Intronic
1100632105 12:96399875-96399897 GCGGGGGCTACTGGGGGCGCGGG - Intronic
1101338566 12:103819942-103819964 GCGGTAGTTGCTGGGAAAGCTGG - Intronic
1101679986 12:106955701-106955723 CTGGGGACTGCTGGGAGGGCCGG + Exonic
1102014360 12:109637926-109637948 TTGGGGGCTGCTGGGAGGGAGGG + Intergenic
1102535231 12:113576109-113576131 GCAGCGGTGGCTGGGAAGGCGGG + Intergenic
1103074268 12:117969309-117969331 CCGGGGGCGGCGGGGGAGGCCGG + Intergenic
1103377650 12:120469353-120469375 GAGGGGACAGCAGGGAAGGCGGG + Intronic
1103451327 12:121031417-121031439 GAGGGGGCTGCCAGGATGGCAGG - Intronic
1103611443 12:122126598-122126620 GTGGGGGCTGGTGGCAAAGCAGG + Intronic
1103649421 12:122421995-122422017 GCCGGGGCAGCGGGGGAGGCCGG + Intronic
1103716275 12:122947204-122947226 CCAGGGGCTGGTGGGAAGGCCGG + Intronic
1104735949 12:131136173-131136195 GCGGGGACTGGCGGGGAGGCAGG + Intronic
1104775056 12:131385979-131386001 GCAGAGGCTCCTGGGAGGGCTGG - Intergenic
1104893811 12:132152344-132152366 CCAGGGCCTGCTGGGACGGCCGG + Exonic
1104929270 12:132329551-132329573 GCGGTGGCTGCGGGGCGGGCAGG - Intergenic
1104952408 12:132447487-132447509 ACGGGGGATGGTGGGAAGGCTGG + Intergenic
1105705143 13:22963680-22963702 TTAGGGGCTGCTGGGCAGGCAGG + Intergenic
1105756217 13:23466610-23466632 GCGGCCGCTGCTGGGAATCCTGG - Intergenic
1105858056 13:24388696-24388718 TTAGGGGCTGCTGGGCAGGCAGG + Intergenic
1105858260 13:24389758-24389780 TCAGGGGCTCCTGGGCAGGCAGG + Intergenic
1105986231 13:25570452-25570474 GCCGAGGCTCCTGGGGAGGCAGG + Intronic
1106109026 13:26760778-26760800 GCGGGCGCGGCGGGGAAAGCTGG - Exonic
1106447660 13:29850641-29850663 GCGGCGGCTGCTGCGAGGGGGGG - Exonic
1106466678 13:30019957-30019979 GCTGGGGGTGCTGGGGAGGATGG - Intergenic
1106794161 13:33187205-33187227 GAGAGGGTTGCCGGGAAGGCAGG + Intronic
1106942903 13:34796675-34796697 TGGGGGACTGTTGGGAAGGCAGG + Intergenic
1107605169 13:42049059-42049081 GCGGGGAAGGCGGGGAAGGCGGG + Intronic
1107605173 13:42049068-42049090 GCGGGGAAGGCGGGGAAGGCGGG + Intronic
1107605177 13:42049077-42049099 GCGGGGAAGGCGGGGAAGGCGGG + Intronic
1107605181 13:42049086-42049108 GCGGGGAAGGCGGGGAAGGCGGG + Intronic
1107605185 13:42049095-42049117 GCGGGGAAGGCGGGGAAGGCGGG + Intronic
1107605189 13:42049104-42049126 GCGGGGAAGGCGGGGAAGGCGGG + Intronic
1107605193 13:42049113-42049135 GCGGGGAAGGCGGGGAAGGCGGG + Intronic
1107657143 13:42603350-42603372 GCAGGGGAGGCTGGGAAAGCTGG + Intronic
1111396217 13:87672407-87672429 GGGGGAGCTGCTGGGAGGGGAGG - Intergenic
1112056146 13:95691167-95691189 GACGGGGCTGCTGGCCAGGCAGG + Intronic
1113312029 13:109140982-109141004 GCGGGGGCGGCGTGGACGGCGGG - Exonic
1113814424 13:113161557-113161579 GCGGGAGAGGCAGGGAAGGCCGG + Intronic
1114473401 14:22979044-22979066 GAGGTGGCTGCTGAGAATGCAGG + Intronic
1114626180 14:24131694-24131716 GCAGGGGCTGCCCAGAAGGCGGG - Exonic
1115652761 14:35414886-35414908 GCAGGGGCTGCTGGGTGGGGAGG + Intergenic
1118366789 14:65102837-65102859 GAGGAGGCTGCTGGGAAGACAGG + Intergenic
1119265597 14:73261851-73261873 GCGAGGGCTGCTGGAATGGCAGG + Intronic
1119851137 14:77867405-77867427 TTGAGAGCTGCTGGGAAGGCAGG - Intronic
1120309768 14:82814223-82814245 GAGGGGGCGGCTGGCCAGGCGGG + Intergenic
1120356180 14:83436806-83436828 GGGGGGCATGCTGGCAAGGCAGG + Intergenic
1121045013 14:90781523-90781545 GCTGGGCCGGCTGGGAAGGAAGG + Intronic
1121334079 14:93066350-93066372 GAGGCGTCTGCTGGGAAAGCAGG + Intronic
1121465294 14:94111808-94111830 GAGGAGGCGGCTGGGAAGGGCGG + Intronic
1121473119 14:94172211-94172233 GTGGGTGCTGCTGGGAAAACTGG + Intronic
1121744121 14:96274605-96274627 GCAGGCGCTGATGGGATGGCAGG + Intergenic
1122230710 14:100305363-100305385 GCGGGAGTTGCTGAGAGGGCCGG - Intronic
1122302202 14:100737619-100737641 GCGGAAGCTGCAGGGCAGGCAGG + Exonic
1122393549 14:101407149-101407171 GCGTGGGGTGCCGGGAAGGCAGG - Intergenic
1122540121 14:102493419-102493441 GCAGGGGCTCCAGGGAAGGGAGG - Intronic
1122774485 14:104111095-104111117 GCGTGGGCTGCTCGGCAGGTGGG + Intronic
1122806935 14:104264564-104264586 GCCTGGGCTGCTGGGAGGACGGG + Intergenic
1122836399 14:104432977-104432999 CCAGGTGCTGCTGGGAGGGCTGG - Intergenic
1122853514 14:104548847-104548869 GCGGGGGCTGGGGAGAACGCTGG - Intronic
1122886665 14:104713366-104713388 GCTGGGGGTGGTGGGGAGGCTGG - Intronic
1122970736 14:105151184-105151206 GCTGGGGCTGCTGGGGCTGCTGG - Intronic
1122970739 14:105151193-105151215 GCGGGGGCTGCTGGGGCTGCTGG - Intronic
1122970745 14:105151211-105151233 GCGGGGGCTGCTGGGGCTGCGGG - Intronic
1202893734 14_KI270722v1_random:183556-183578 GGTGGCGCTGCTGGGAGGGCGGG + Intergenic
1123679123 15:22744939-22744961 GAGGAGGCTGCTGAGAAAGCAGG + Intergenic
1123783019 15:23645675-23645697 GCGGTGCCTGCCAGGAAGGCTGG + Exonic
1123997573 15:25729602-25729624 GCAGGGGCTGCAGGGTCGGCTGG - Intronic
1124018002 15:25894440-25894462 GGGAGGGCAGCAGGGAAGGCAGG - Intergenic
1124331343 15:28819389-28819411 GAGGAGGCTGCTGAGAAAGCAGG + Intergenic
1124439201 15:29674816-29674838 GCGGAGGCAGCGGGGAAGGAAGG - Intergenic
1124623687 15:31295832-31295854 GCTGTGGCTGCTGGGATGGCAGG + Intergenic
1124640457 15:31393190-31393212 GTGGGGGCTGGCGGGAAGGTAGG - Intronic
1125525181 15:40369893-40369915 GCTGGGGCTTCTGGTGAGGCTGG - Exonic
1125891195 15:43268511-43268533 GCAGGGGCTGCTAGGGAAGCTGG - Intergenic
1125930056 15:43593929-43593951 GCGGTGGCAGGCGGGAAGGCGGG + Intronic
1125943224 15:43693761-43693783 GCGGTGGCAGGCGGGAAGGCGGG + Exonic
1126102695 15:45129431-45129453 GCTGGAGCTGCTGGGATTGCTGG - Intronic
1126369617 15:47932363-47932385 GAGGAGGATGCTGGAAAGGCAGG + Intergenic
1127144148 15:56007370-56007392 GCGGCGGCGGCGGGGGAGGCGGG + Intergenic
1127262534 15:57336827-57336849 GGGGGTGGTGCTTGGAAGGCTGG - Intergenic
1127275428 15:57439256-57439278 GCGGGCACACCTGGGAAGGCCGG - Exonic
1128225906 15:66001191-66001213 TCAGATGCTGCTGGGAAGGCTGG + Intronic
1128291573 15:66482324-66482346 GGACGGGCTGCTGAGAAGGCAGG - Intronic
1128326018 15:66724819-66724841 GGGGAGGCTGCTGGCGAGGCAGG + Intronic
1128501461 15:68229855-68229877 GCGGGGGCTGCTGGCCTGTCCGG + Intronic
1128740711 15:70082087-70082109 TGGGAGGCTGCTGGGAAGGTTGG - Intronic
1129393425 15:75231933-75231955 GAGGGGGCTGCTGGGGAGAGGGG - Intergenic
1129519780 15:76178320-76178342 GAGGGGGCTGCAGGGAAGTGGGG + Intronic
1130541301 15:84822449-84822471 GGCTGGGCTGCTGGGAAGGAAGG + Intronic
1130960156 15:88653702-88653724 GCGGGGGCGGGCGGGAGGGCTGG - Intronic
1131938402 15:97533515-97533537 GCGGGGGCTTTTGGGTAGTCTGG + Intergenic
1132354677 15:101162653-101162675 GAGGGGGCTGCTGGCCTGGCTGG - Intergenic
1132359714 15:101202123-101202145 GCAGAGGCTGCAGGGAAGGATGG + Intronic
1132359787 15:101202438-101202460 GCAGAGGCTGCAGGGAAGGATGG + Intronic
1132359798 15:101202501-101202523 GCAGAGGCTGCAGGGAAGGATGG + Intronic
1132687486 16:1168406-1168428 GGGGAGGCTCCTGGGCAGGCGGG + Intronic
1132727228 16:1344175-1344197 GTGGGGGCGGCTGGCAGGGCAGG + Intronic
1132727522 16:1345427-1345449 GCTGGGGTTGCTGGGGAGGCGGG - Intronic
1132727530 16:1345445-1345467 CTGGGGGTTGCTGGGGAGGCTGG - Intronic
1132727564 16:1345527-1345549 GCTGGGGTTGCTGGGGAGGCTGG - Intronic
1132727571 16:1345545-1345567 GCTGGGGTTGCTGGGGAGGCTGG - Intronic
1132727578 16:1345563-1345585 GCTGGGGTTGCTGAGGAGGCTGG - Intronic
1132727583 16:1345581-1345603 GCTGGGGTTGCGGGGGAGGCTGG - Intronic
1132727591 16:1345599-1345621 GCTGGGGTTGCTGAGGAGGCTGG - Intronic
1132727615 16:1345662-1345684 GCGGGGGTTGTGGGGGAGGCTGG - Intronic
1132727637 16:1345707-1345729 GCTGGGTTTGCTGGGGAGGCAGG - Intronic
1132759280 16:1501003-1501025 GCCGGGGCTGCAGGGCAGCCAGG + Intronic
1132975691 16:2710096-2710118 GCTGGGTCTGCTGGGCAGGGAGG + Intergenic
1133029644 16:3004348-3004370 GCGGGTGCGGCAGGGACGGCGGG - Intergenic
1133125209 16:3641902-3641924 GGTGGGACGGCTGGGAAGGCTGG - Intronic
1133384810 16:5360877-5360899 GCTTGTGCTGCTGGGAAAGCAGG - Intergenic
1133487613 16:6235352-6235374 GCTGGGGCTGGTGGAAAGGGAGG - Intronic
1133627002 16:7579931-7579953 GCGGGCACTGCTGGGAAGAAAGG - Intronic
1133664569 16:7953733-7953755 GAGGGGGCTGAGGGGAAGGTGGG + Intergenic
1133774500 16:8886396-8886418 GCAGGGGCTGATTGGAGGGCTGG - Intergenic
1133937047 16:10277816-10277838 GAGGTGGCTGTTGGGATGGCGGG - Intergenic
1134614880 16:15643246-15643268 GCGGGGCATGCTGGGAACCCCGG + Exonic
1134704513 16:16293053-16293075 GCGCCTGCTGCAGGGAAGGCTGG + Intronic
1134837226 16:17371198-17371220 GCAGGGGCTGATGAGAAGACAGG - Intronic
1134849855 16:17470853-17470875 GCGGGAGCTGCGGGGAGCGCGGG - Exonic
1134963029 16:18419061-18419083 GCGCCTGCTGCAGGGAAGGCTGG - Intronic
1134967324 16:18501660-18501682 GCGCCTGCTGCAGGGAAGGCTGG - Intronic
1135003915 16:18801585-18801607 GCGGGGGCCGTCGGGAAGGGCGG - Exonic
1136380919 16:29895225-29895247 GAGGGTGCTGCTGGAAGGGCAGG - Intronic
1136569947 16:31090734-31090756 GGAGGGCCTGCTGGGAAGGGTGG - Intronic
1136994655 16:35181481-35181503 GCTGGGACTCCTGGGGAGGCTGG + Intergenic
1137033133 16:35543703-35543725 GCGGGGGGCGCTGGGGAGGCAGG - Intergenic
1137513772 16:49124805-49124827 GAGGGCGCTGCTGGGTAGGTAGG - Intergenic
1138475727 16:57269678-57269700 GGAGTGGCTGCTGGGAATGCAGG + Intronic
1138506100 16:57479101-57479123 GCAGGGGCGGCTGGCAAGGCCGG - Intronic
1138597736 16:58038161-58038183 GGAGGGGCGGCTGGGAAGCCCGG + Intronic
1139431879 16:66915187-66915209 GCGGGGTGTGCTGGGGAGGGAGG - Intronic
1139643602 16:68311107-68311129 GCTGGGTATGCTGGGAAGGTGGG + Intronic
1141029496 16:80575232-80575254 GAGTGGGCTGCAGGGAGGGCAGG + Intergenic
1141402759 16:83764803-83764825 GCGAGGGCTTCAGGGAAGGCAGG - Intronic
1141412550 16:83845383-83845405 GCGGGTGGTGCTGGGCAGACAGG - Intergenic
1141895086 16:86954073-86954095 GCGGGGGCTGGGGGGAGGGCCGG + Intergenic
1142046314 16:87927293-87927315 GAGGGCGCTGTGGGGAAGGCAGG + Intronic
1142120103 16:88382984-88383006 GGGCCGGGTGCTGGGAAGGCCGG - Intergenic
1142252299 16:88997561-88997583 GCGGGGGCTGGTGGGAGGCTGGG + Intergenic
1142474640 17:181565-181587 GCGGGGGCTGCGGGCATCGCCGG + Exonic
1142699747 17:1651662-1651684 GCTGGGGCAGCTGGCCAGGCAGG + Exonic
1142743045 17:1941784-1941806 GCGGGGCCAGCTGGGACAGCTGG - Intronic
1142933483 17:3308330-3308352 GCAGAGGCTGCTGGGCCGGCGGG + Intergenic
1142982378 17:3679687-3679709 GCCAGGGCTGCTGGGGATGCCGG - Exonic
1143335082 17:6166046-6166068 GCGTGGGCTGCTGGGAGTGAAGG - Intergenic
1143371739 17:6444679-6444701 GGGGCGTCTGGTGGGAAGGCCGG + Intronic
1143382978 17:6507962-6507984 GCTGGGGTTGCTGGGAATGCTGG + Intronic
1143382986 17:6507992-6508014 GCTGGGGTTGCTGGGAATGCTGG + Intronic
1143382994 17:6508022-6508044 GCTGGGGTTGCTGGGAATGCTGG + Intronic
1144420914 17:15097809-15097831 GAGGGGGCTGATGGGATGGAGGG - Intergenic
1144519472 17:15944684-15944706 TGGGGGGCTGCCGGGCAGGCAGG - Intergenic
1144584824 17:16481852-16481874 GCAGGTGCTCCTGGGGAGGCAGG - Intronic
1144758271 17:17693329-17693351 CAGTGGGTTGCTGGGAAGGCAGG + Intronic
1144967895 17:19089377-19089399 GCGGGGGCGGCGGGGGTGGCGGG - Intergenic
1144980022 17:19162686-19162708 GCGGGGGCGGCGGGGGTGGCGGG + Intergenic
1144988200 17:19215546-19215568 GCGGGGGCGGCGGGGGTGGCGGG - Intergenic
1145750946 17:27354435-27354457 GCAGTGGGTGCTGGGAAGCCGGG - Intergenic
1145980802 17:29010348-29010370 GCTGGGGGTGGTGGGCAGGCTGG - Intronic
1146055280 17:29577816-29577838 GTGGGGGCAGCTAGGAAGGCTGG - Intronic
1146721444 17:35126942-35126964 GCTGGGGATGCTGGTAAGTCAGG + Intronic
1146759149 17:35460776-35460798 GCGGGCGGTGCTGCCAAGGCAGG - Intergenic
1147376633 17:40026619-40026641 GCAAACGCTGCTGGGAAGGCGGG + Intronic
1147746576 17:42698637-42698659 GCTGGGGCTGGTGGGAATGTTGG + Exonic
1147931179 17:43982597-43982619 GCAGGGGCTGGGGGGAAAGCAGG + Intronic
1147994705 17:44354402-44354424 GCGGGGGCGGCGGCGAGGGCTGG - Exonic
1148299519 17:46534800-46534822 GAGGGGGCGGCTGGCCAGGCGGG + Intronic
1148553068 17:48562305-48562327 GGGGAGGCAACTGGGAAGGCTGG - Intronic
1148562383 17:48613500-48613522 CCGGCGGCTGCTGGGAATGGGGG + Exonic
1148636099 17:49150313-49150335 GACGGGGCTGCTGGCCAGGCGGG - Intronic
1148846770 17:50534240-50534262 GCAGGGGCTGGGGGGAAGGGCGG - Intronic
1148847929 17:50540188-50540210 GCGGGGCCTGGAGGGAGGGCAGG - Intronic
1150225214 17:63520962-63520984 GCATGGGCTCCTGGGGAGGCTGG + Intronic
1150373512 17:64661891-64661913 GCGGGGGCGGCGGGGGCGGCGGG + Exonic
1151155387 17:72120784-72120806 GGGGGTGCTGCGGGGAAGGCGGG - Intergenic
1151707746 17:75779553-75779575 GCGGGGGCTGCTCGGGCCGCTGG - Intronic
1152118601 17:78404197-78404219 GCAAGGGCTGCTGGGAAGGTAGG - Intronic
1152212492 17:79009797-79009819 GCAGAGGCTGCCGGGAACGCGGG - Exonic
1152376617 17:79921927-79921949 GTGGGTGCTGCGGGGAGGGCCGG - Intergenic
1152394517 17:80024132-80024154 GCCGGGGCTGCGGGTAGGGCCGG - Intronic
1152409163 17:80113202-80113224 CCTGGGGCTGCAGGGCAGGCGGG - Intergenic
1152446852 17:80349916-80349938 GAGAGGGCAGCAGGGAAGGCAGG - Intronic
1152497177 17:80681492-80681514 GCGGGGAGTGTAGGGAAGGCCGG + Intronic
1152559202 17:81069480-81069502 GCGGGGGCCGCCGAGAAGCCAGG - Intronic
1152612000 17:81320200-81320222 GCGGGGGCTGCTTGGCAGCTGGG - Intronic
1152706135 17:81844600-81844622 GCAGGGCCTGCTGGGAGTGCTGG - Intronic
1152800357 17:82327998-82328020 GGGGGGGCTGGTGGACAGGCCGG - Intronic
1152810272 17:82378581-82378603 GGGGGGTCTGCTGGAAAAGCGGG - Intergenic
1154097308 18:11430307-11430329 GCGGGGGGTGAGGGGGAGGCGGG + Intergenic
1154335921 18:13464764-13464786 GTGGGGGCTGAAGGGAAGGAGGG - Intronic
1154503057 18:15005940-15005962 GCGGGGGCTGAGGGGCACGCAGG + Intergenic
1156312909 18:35941102-35941124 CCAGGGACTGCTGGCAAGGCAGG - Intergenic
1157804975 18:50651133-50651155 GCAGGTGCTGCTGGGGAGACTGG + Intronic
1158435943 18:57435670-57435692 GCGGGGGCGGCGGGGGCGGCCGG - Exonic
1158649725 18:59274092-59274114 GTGGGCGCTGCGGGGAAGGAGGG - Intergenic
1160151099 18:76394837-76394859 GGGAGGGCAGGTGGGAAGGCAGG + Intronic
1160574580 18:79845263-79845285 GAGGAGGTGGCTGGGAAGGCAGG + Intergenic
1160682042 19:416387-416409 GCGGGGGCTGCTGGGCAGAGGGG + Intergenic
1160697903 19:493512-493534 TCTGGGGCTGGTGGGATGGCTGG + Intronic
1160708930 19:541881-541903 GGGGGCGCTGCTGGGAACGTGGG + Exonic
1160739842 19:680663-680685 GCGGGGCCTGCTGGAGGGGCGGG + Intronic
1160739850 19:680681-680703 GCGGGGCCTGCTGGAGGGGCGGG + Intronic
1160776522 19:859144-859166 GCAGAGGCAGCTGGGAAGACTGG - Intergenic
1160788710 19:913076-913098 GCGGCGGCTGCTGTGAGCGCGGG - Exonic
1160820852 19:1057087-1057109 GCGGGGGCTGCTTGGACGGGTGG + Intronic
1160921621 19:1523547-1523569 GCTGGGGCTGGTGGGGAGGGCGG - Intergenic
1160992480 19:1865368-1865390 CTGGGGGCTGCTGGGATGGTGGG - Intergenic
1161055294 19:2187975-2187997 TCTGGAGCTGCGGGGAAGGCGGG + Intronic
1161106087 19:2444775-2444797 GAGGAGGCTCCTGGGATGGCTGG - Intronic
1161202689 19:3024823-3024845 GCAGGGGCTGCAGGGATGGAGGG - Intronic
1161303746 19:3555985-3556007 GAGAGGGCTGTTGGGAGGGCAGG - Intronic
1161533389 19:4803915-4803937 GAGGGGGCTGTTGGCATGGCTGG + Intergenic
1161677960 19:5663616-5663638 GCCAGGGCTGCTGGCAGGGCAGG + Intronic
1161961631 19:7526621-7526643 GCAGGTGCTGGTGGGCAGGCAGG + Intronic
1162128151 19:8510617-8510639 GAGGGGGCTGCAGGGAAGGGGGG - Exonic
1162486320 19:10962496-10962518 ACGGGGGCTGCTTGGAAGAGGGG + Intronic
1162556633 19:11390617-11390639 GCTGGAGCTGATGGGAAGGAGGG + Intronic
1162793444 19:13074633-13074655 GAGGGAGCTGCTTGGGAGGCAGG + Intronic
1162794269 19:13078547-13078569 GGGGTGGGTGCGGGGAAGGCGGG - Intronic
1162903459 19:13809072-13809094 GCGGGAGATGCTGCGAATGCGGG + Exonic
1163113968 19:15178306-15178328 GCGTGGCCTCCTGGGATGGCAGG - Intronic
1163126012 19:15244516-15244538 GTGGGGGCTGCTGGGGAGGCGGG + Exonic
1163154130 19:15430968-15430990 GCAGGGGATGCTGGCCAGGCTGG - Intronic
1163156035 19:15440360-15440382 GGGGTGGCGGCTGGGCAGGCAGG + Intronic
1163294990 19:16406100-16406122 GCCTGGGCTGCTGGGGTGGCTGG + Intronic
1163313026 19:16525383-16525405 GCGGGTGCTGCTGGTGGGGCGGG + Exonic
1163364560 19:16868796-16868818 GTGGGAGCTGGTGGGAGGGCTGG + Intronic
1163509440 19:17726337-17726359 GTGGGGGCTCCTGGGACGACAGG + Exonic
1163622118 19:18367344-18367366 GAGGGGTGTGGTGGGAAGGCTGG + Exonic
1163664156 19:18595219-18595241 GCAGGGGAGGCTGGGGAGGCCGG - Intronic
1163790724 19:19304784-19304806 GCTTGGGCTGCTGGGAATGGGGG + Intronic
1164179420 19:22806665-22806687 GCGAGGGCTTCAGGGAGGGCTGG - Intergenic
1164536723 19:29091602-29091624 CTGGGGGCTTCTGGGAAGACAGG - Intergenic
1164714597 19:30382123-30382145 GCGGGGGCAGCAGGGAGGGGAGG - Intronic
1165104636 19:33461736-33461758 GCAGGGGGTCCTGGGAATGCTGG + Intronic
1165266680 19:34667275-34667297 GAGGGGTCTTCTGGGAAGGAGGG - Intronic
1165357648 19:35313605-35313627 GGAGGGGCAGCTGGGAAGGAGGG - Exonic
1165379223 19:35466271-35466293 GCTGGGACTGCTGAGTAGGCAGG - Intergenic
1165395872 19:35563340-35563362 GCGGGAGCTGGAGGGTAGGCTGG - Intronic
1165433905 19:35786742-35786764 GCGGGGGGTGCTGGGCTGGCGGG - Intronic
1165436255 19:35797086-35797108 GAGGGGTCTGATGGGAAGGGAGG + Intergenic
1165472106 19:36009726-36009748 GCTGGGGCTGCTGGAAAGGGAGG + Intronic
1165493917 19:36141046-36141068 GCGGCGGCGGCGGGGGAGGCGGG + Exonic
1165532894 19:36418657-36418679 GCGGAGGCTGCTGGGAGGGCCGG + Intergenic
1165764655 19:38343234-38343256 GGGAGGGATGCTGGGAAGGTGGG - Intronic
1166054557 19:40280596-40280618 CCTGGGGCTGCGGGGCAGGCAGG - Intronic
1166067423 19:40367931-40367953 GCGGGGGCTGTGGGGAATGAAGG + Intronic
1166529729 19:43535102-43535124 GCGGGGGCCGCCGGCGAGGCCGG - Exonic
1166726659 19:45032555-45032577 GCAGGGCCTCCTGGGAAGGTCGG + Exonic
1166888047 19:45973426-45973448 GCGACGGCTGCTGGGGAGGCTGG + Exonic
1167323615 19:48811171-48811193 GCAGGCGCTGGTGGGAGGGCAGG + Intergenic
1167410037 19:49339083-49339105 GCGGGGTCTGCAGGAAGGGCAGG + Intronic
1167625075 19:50582689-50582711 CTGGGGGCTGCTGACAAGGCTGG + Intergenic
1167638637 19:50668536-50668558 GCGGCGGCTGCGGGGAGGCCGGG + Exonic
1168255148 19:55160980-55161002 GCGGGGCCTGCTGTGGGGGCGGG + Intronic
1168288654 19:55346701-55346723 GGAGGGGCTGCTGGGATGGCAGG - Intronic
1168308992 19:55451464-55451486 TCGCGGGCCGCGGGGAAGGCAGG + Intergenic
1168414461 19:56159725-56159747 CCCGGGGCCGCTAGGAAGGCGGG - Exonic
1168528215 19:57105648-57105670 GCGGGGGATGCTGGGGGGGTGGG + Intergenic
1202704685 1_KI270713v1_random:14054-14076 CCTGGGCCTCCTGGGAAGGCAGG + Intergenic
925077444 2:1029081-1029103 GCTGGGGTTGCTGGAAAGCCCGG - Intronic
925293557 2:2763722-2763744 GTAGGGGCGGCTGGGAAGCCGGG + Intergenic
925362359 2:3288438-3288460 GCTGGGGCTGCTGGGGTGTCCGG + Intronic
925546289 2:5020437-5020459 TCTGGGGTTGTTGGGAAGGCTGG + Intergenic
925610471 2:5697099-5697121 GCGGCGGATGCTCGGAAGGGGGG - Exonic
925750943 2:7090253-7090275 GCGGGGACTGCGGGGACTGCGGG - Intergenic
926251836 2:11159285-11159307 GAGGGGGCTGCTCAGGAGGCTGG + Intronic
926349837 2:11984614-11984636 GCGGGGGCTGGTTGGCAGCCGGG + Intergenic
926929504 2:18023146-18023168 TGGGGGACTGTTGGGAAGGCAGG - Intronic
927181374 2:20448513-20448535 GGGAGGGCTGCTGGGGAGGATGG + Exonic
927497193 2:23558976-23558998 GCCGTGGCTGCAGGGAGGGCGGG + Intronic
927596656 2:24403215-24403237 GAGGGGGCTGGGGGGAGGGCGGG - Intergenic
927674037 2:25091457-25091479 ACGGGGGCAGCTTGGAAGCCAGG + Intronic
929078225 2:38096068-38096090 ACGGGGGCGGCGGGGAAGGGCGG - Intronic
931780694 2:65577032-65577054 GCTGGAGATCCTGGGAAGGCAGG + Intergenic
932410770 2:71546182-71546204 GAGGGGGCTGCAGGCAAGTCGGG - Intronic
932448517 2:71795043-71795065 GAAGGGGGTGCTGGGAAGGTGGG + Intergenic
932523948 2:72443944-72443966 TGGGGGACTGTTGGGAAGGCAGG - Intronic
932771233 2:74502000-74502022 GCGGGGCCAGCGGTGAAGGCTGG - Intronic
932960821 2:76410204-76410226 TGGGGGGCTGTTGGGAAGGCAGG + Intergenic
933559590 2:83874236-83874258 GGGGTGGCTGTCGGGAAGGCGGG + Intergenic
933727319 2:85434249-85434271 GCAGGGGCAGCTTGGAATGCTGG + Intronic
933958777 2:87395979-87396001 GCTGGGGCTCCTGGGCTGGCTGG - Intergenic
933973954 2:87492856-87492878 GCTGGGGCTGCTGGGAGGACGGG - Intergenic
934242905 2:90287977-90287999 GCTGGGGCTCCTGGGCTGGCTGG - Intergenic
934242934 2:90288107-90288129 GCTGGGGCTCCTGGGCTGGCTGG - Intergenic
934515734 2:94985374-94985396 GCGGGGGCTGCTGCAGGGGCTGG - Intergenic
934567056 2:95346868-95346890 GGCGGGGCTGCTGGGTTGGCTGG - Intronic
934568257 2:95352547-95352569 GGGAGGGCTGGGGGGAAGGCTGG - Intronic
934771045 2:96907761-96907783 ACGTGGGCTGCTGGGATGTCGGG + Intronic
934913703 2:98280855-98280877 GCGGGGGCTCAAGGGAAAGCTGG - Intronic
934966671 2:98730545-98730567 GCGGGGGCCGCGGGGCAGGTGGG - Intronic
936319767 2:111457348-111457370 GCTGGGGCTGCTGGGAGGACGGG + Intergenic
937395342 2:121530132-121530154 GAGGGGGCTGGAGGGGAGGCAGG + Intronic
937906864 2:127056701-127056723 TCGGGGAGTGCGGGGAAGGCCGG + Intronic
937911022 2:127075740-127075762 TGGGGGGCAGCTGGGAGGGCTGG - Intronic
937911039 2:127075784-127075806 GGGGGGGCAGCTGGGAGGGCCGG - Intronic
937911074 2:127075886-127075908 TTGGGGGCAGCTGGGAGGGCTGG - Intronic
937992712 2:127673481-127673503 GCCGGAACCGCTGGGAAGGCAGG - Intronic
938502222 2:131836110-131836132 GCGGGGGCTGAGGGGCACGCAGG + Intergenic
940635617 2:156293706-156293728 GCGGGGGCGGCTGGCCGGGCGGG - Intergenic
940783520 2:157958571-157958593 TGGGGGACTGTTGGGAAGGCAGG - Intronic
940897728 2:159096691-159096713 GCGGGGTTTGGTGGGAAGGACGG + Intronic
941095851 2:161238883-161238905 GCGGGGCCCGCTGGAAAGGAGGG - Intergenic
942049290 2:172123855-172123877 CCGGGGCCTGCTGGGGAGGGGGG - Intergenic
942278964 2:174342297-174342319 CGGGGGGCGGCTGGGCAGGCAGG + Intergenic
942485950 2:176439859-176439881 GTGTTGGCTGGTGGGAAGGCAGG - Intergenic
942681449 2:178480947-178480969 CGGGGGGCTGCTGAGAAGGCGGG + Intronic
943649474 2:190441482-190441504 GCGGGGGTTGGGGGGAAAGCAGG + Intronic
945202484 2:207296597-207296619 GTGGGGGCTGCTGGGCAGAAGGG - Intergenic
946082304 2:217132524-217132546 TCGGGGGCTGCAGGGAGGGAAGG - Intergenic
946219864 2:218217213-218217235 GCGGCGGCGGCTCGGCAGGCGGG + Exonic
947471982 2:230409184-230409206 GCTGGAGCTGCTGGGAAGGTGGG + Intergenic
947549777 2:231037821-231037843 GCGAGGGCGGCTGGGGCGGCGGG + Exonic
948270856 2:236672118-236672140 GCGGGGGATGTGGGGAAGCCTGG + Intergenic
948479916 2:238242851-238242873 GGGGAGGCTGCTGTGAAGGAGGG - Intergenic
948695609 2:239731768-239731790 GCCAAGGCTGCTGGGAAGGAAGG + Intergenic
949040817 2:241849372-241849394 GTGGGGGCAGCGGGGGAGGCGGG - Intergenic
1168878211 20:1185423-1185445 GTGGCGGCCGCTGGGGAGGCGGG + Intronic
1168886854 20:1266280-1266302 GCTGGGGCTGCCGGGAGGGAGGG - Intronic
1170438059 20:16350515-16350537 GAGGGTGGTGCTGAGAAGGCGGG + Intronic
1170756801 20:19212478-19212500 GCGGGGGCGGCGGGGGCGGCCGG - Intergenic
1170885722 20:20338339-20338361 GAGAGGGCTGCTGGAAAGTCAGG - Intronic
1171215098 20:23346705-23346727 GCGGGGGATTCTGAGAAGGCAGG - Intergenic
1171293224 20:23994407-23994429 GCCCAGGCTGCAGGGAAGGCCGG - Intergenic
1171446300 20:25207060-25207082 GCGGCTGCTGGTGGGAAGGGGGG - Exonic
1171823196 20:29874217-29874239 GCGGGGGCGGTTGGGAAGCACGG - Intergenic
1171891628 20:30723590-30723612 CCAGGGGCTGCGGGGAAGCCGGG + Intronic
1172168135 20:32911440-32911462 CTGGGGGCTGCTGGAGAGGCCGG - Intronic
1172178638 20:32987449-32987471 GCGGGGGCTGGGGAGAAGGCGGG - Intronic
1172178646 20:32987467-32987489 GAGGGGGCTACTGACAAGGCGGG - Intronic
1172183909 20:33019759-33019781 GGTGGGGCTGGTCGGAAGGCAGG + Intronic
1172474462 20:35226688-35226710 GCGGCGGCGGCGGCGAAGGCAGG + Exonic
1172526218 20:35601874-35601896 CCTGGGGCTGCTGGGCAGCCTGG - Intergenic
1172624640 20:36340222-36340244 GCAGGGGCTGTTGGGCAGCCAGG - Intronic
1173231987 20:41205575-41205597 GCGGGGGTGGCTAGGAAGACCGG + Intronic
1173253639 20:41377507-41377529 GCGGGGGCTGACGGGGTGGCAGG + Intergenic
1173522850 20:43712124-43712146 GCAGGGGCTCCTGGGCAGGGGGG + Intronic
1173684008 20:44910109-44910131 GCCGGGGCTGCGGGGCAAGCAGG - Exonic
1173900792 20:46587442-46587464 GCGAGGCCTGGTGGGAAGGAAGG - Intronic
1175428745 20:58888782-58888804 GCGCGCGCCGCTGGGAGGGCGGG + Intronic
1175429368 20:58891229-58891251 GCGGCGGCGGCTGGGAGGGCGGG - Intronic
1175713000 20:61235938-61235960 GCTGGGGTTGCTGAGAAGGTAGG + Intergenic
1175753502 20:61514969-61514991 GCGGGGGCGGGTGGCACGGCTGG + Intronic
1175777714 20:61663582-61663604 TCGGGAGCTGCTGGGACGGCAGG + Intronic
1175832918 20:61976801-61976823 GCTGGGTCAGCTGGGAAGGCTGG + Intronic
1175853680 20:62107413-62107435 AAAGGGGCTCCTGGGAAGGCAGG + Intergenic
1175972146 20:62692085-62692107 GCTGGGCTTGCTGGGAAGGGCGG - Intergenic
1176068924 20:63216024-63216046 GCGGCGGCTGCTGGGCGCGCGGG + Exonic
1176093803 20:63330398-63330420 CCAGGGGCTCCTGGTAAGGCTGG + Intronic
1176213872 20:63939229-63939251 GGGGGGCCTGCTCGGAAAGCAGG + Intergenic
1176568271 21:8397642-8397664 TCCGGGACGGCTGGGAAGGCCGG + Intergenic
1178712974 21:34936083-34936105 AGGGGGGCTTCTGGGAAGGGGGG - Intronic
1178881029 21:36450211-36450233 GAGGGGGATGCAGGGAAGGCAGG - Intergenic
1179011386 21:37558876-37558898 GCTGGCTCTGCTGGGAAGGATGG - Intergenic
1179251340 21:39673863-39673885 GAGGGAGCTGCTGGGAGGGGAGG - Intergenic
1179460822 21:41533807-41533829 GAGGGGGCTGCTGGGCATGGTGG + Intergenic
1179505297 21:41835948-41835970 GCGGGGGCTGTGGGGGAGGGAGG - Intronic
1179505310 21:41835978-41836000 GCGGGGGCTGTGGGGGAGGGAGG - Intronic
1179621274 21:42617765-42617787 GCGGGGGAGGCAGGGGAGGCAGG - Intergenic
1179970839 21:44836134-44836156 GTGGGGGCTGCAGGGATGGTGGG - Intergenic
1179970906 21:44836271-44836293 GTGGGGGCTGCAGGGATGGTGGG - Intergenic
1180062173 21:45391041-45391063 CCTGGGGGTGCTGGGAGGGCCGG - Intergenic
1180106600 21:45622896-45622918 GTGGGGACTGCGGGGAAGACGGG - Intergenic
1180180694 21:46117554-46117576 GCTGGGGCTGCTGGGCTGCCGGG - Intronic
1180231303 21:46428320-46428342 GGGCGGGCAGCAGGGAAGGCCGG + Intronic
1180824284 22:18852122-18852144 GCCCAGGCTGCAGGGAAGGCCGG - Intronic
1180955799 22:19740706-19740728 TCGGGGCCCGCTGGGCAGGCGGG - Intergenic
1181064512 22:20299220-20299242 GCGGGCGCGGCTGGGAAGGCGGG + Intergenic
1181064523 22:20299260-20299282 GCGGGCGCGGCTGGGAGCGCGGG + Intergenic
1181085580 22:20437967-20437989 GCGGGGGCTGCGCGGAGGGGCGG - Intronic
1181124712 22:20695276-20695298 GCCCAGGCTGCAGGGAAGGCCGG - Intergenic
1181188450 22:21122426-21122448 GCCCAGGCTGCAGGGAAGGCCGG + Intergenic
1181210748 22:21288067-21288089 GCCCAGGCTGCAGGGAAGGCCGG - Intergenic
1181398760 22:22638821-22638843 GCCCAGGCTGCAGGGAAGGCCGG + Intergenic
1181417788 22:22772723-22772745 GAGGGGGCTGGAGGGAAGGGCGG - Intronic
1181501491 22:23318177-23318199 GCCCAGGCTGCAGGGAAGGCCGG + Intergenic
1181650661 22:24257238-24257260 GCCCAGGCTGCAGGGAAGGCCGG - Intergenic
1181706720 22:24653500-24653522 GCCCAGGCTGCAGGGAAGGCCGG + Intergenic
1182335525 22:29581025-29581047 GCGGCGGCTGCTGGGGGGCCCGG - Exonic
1182792899 22:32967782-32967804 GCAGAGGCTGCTGGCAGGGCTGG + Intronic
1183036705 22:35146138-35146160 GTGGGGGCTGTTGGTAGGGCAGG - Intergenic
1183704800 22:39469841-39469863 GCCGGGGCTGCAGGGCAGGGCGG + Intronic
1183943190 22:41308215-41308237 GTGAGGGCTGCAGGGAAGGTGGG + Intronic
1184112101 22:42401510-42401532 CCTGGGGGTGCTGGGGAGGCTGG + Intronic
1184466301 22:44670341-44670363 GCGGGGATTGCTGTGAAGTCCGG + Intronic
1184557396 22:45240753-45240775 GCGGCGGCGGCGGGGAGGGCGGG + Intronic
1184853677 22:47135186-47135208 CCAGGGGGTTCTGGGAAGGCCGG - Intronic
1184871097 22:47238994-47239016 GTGGGGGCAGCTGGGGAGGAGGG - Intergenic
1184923807 22:47623845-47623867 CCGAGGGCTGCTGGGATGGGCGG - Intergenic
1185020848 22:48374031-48374053 GCAGGGGATGCTGGGAAGCGTGG - Intergenic
1185125687 22:49009520-49009542 GCAGGGGAGACTGGGAAGGCAGG - Intergenic
1185239500 22:49735121-49735143 GCTGGGGCTGCAGGGGAGGCCGG + Intergenic
1185330378 22:50249593-50249615 ACTGGGGCTGCAGGGAAGGGTGG + Intronic
1185384334 22:50525007-50525029 GGAGGAGCTGCTGGGAAGCCTGG - Intronic
1203216199 22_KI270731v1_random:7363-7385 GCCCAGGCTGCAGGGAAGGCCGG + Intergenic
1203274423 22_KI270734v1_random:78026-78048 GCCCAGGCTGCAGGGAAGGCCGG - Intergenic
950261252 3:11544573-11544595 GCGGGAGCAGCTGGGGTGGCAGG - Intronic
950618048 3:14178298-14178320 GCGGGGACAGCGGGGAGGGCCGG + Intronic
950666416 3:14497959-14497981 GCTGGAGCTGCTGGGAGGGGAGG + Intronic
951013267 3:17704624-17704646 GACGGGGCTGCTGGCCAGGCGGG + Intronic
952651911 3:35737364-35737386 TAGGGGGCTGGTTGGAAGGCAGG + Intronic
953020925 3:39112562-39112584 GCTGGGGCTGATGGGAAAGGTGG + Exonic
953563351 3:44011895-44011917 GACGTGGCGGCTGGGAAGGCAGG - Intergenic
953872684 3:46641184-46641206 GTGGGGGTTGGGGGGAAGGCAGG - Intergenic
954025504 3:47780420-47780442 CCGGGCGCGGCTTGGAAGGCCGG - Intronic
954146999 3:48639431-48639453 CTGGGAGGTGCTGGGAAGGCTGG + Intronic
954291788 3:49653754-49653776 TCGGAGCCTGCTGGGGAGGCTGG - Exonic
954417393 3:50399965-50399987 GCAGGGGCTGCTGGGCATCCTGG - Intronic
954656250 3:52195992-52196014 GCGGGTGCTGGTTGGAAGGGTGG - Intergenic
954700214 3:52446920-52446942 GCAGGGGCTGCAGGGAAGCCTGG + Intergenic
954801119 3:53187420-53187442 GCGGGGGCTCTTGGGAGGGGAGG + Intronic
955405410 3:58622750-58622772 GGGGAGGCTGCTGGGCAGGAGGG + Intronic
956468628 3:69542605-69542627 GCGGGGGCTGCTGGGGAGAGAGG - Intergenic
956707949 3:72015612-72015634 GCGGAGGCTGGGGGGAGGGCAGG - Intergenic
957151977 3:76497827-76497849 GCTGGGAATGCTGGGAATGCTGG - Intronic
957151979 3:76497836-76497858 GCTGGGAATGCTGGGAATGCTGG - Intronic
957792681 3:84959863-84959885 GGGCTGACTGCTGGGAAGGCAGG - Intronic
958013802 3:87914664-87914686 GCTGGGGCTGCTGTGGAGGATGG - Intergenic
959267850 3:104167165-104167187 TGGGGGACTGTTGGGAAGGCTGG - Intergenic
960051279 3:113241507-113241529 GTTGGGGCTGGTGGAAAGGCTGG - Intronic
960638963 3:119809539-119809561 GCGGGGGGTGGGGGGAAGGCGGG + Intronic
961450932 3:127002018-127002040 GCTGTGGCTGCAGGGCAGGCAGG + Intronic
961487427 3:127226820-127226842 GGGGTGGCAGCTGGGAAGGGTGG + Intergenic
961536871 3:127575906-127575928 GCTGGGGCAGCTGGGGTGGCTGG - Intronic
961560214 3:127723539-127723561 GGGGGGGCGACTGGGAAGGTGGG - Intronic
961661496 3:128470960-128470982 TCTGGGGCGTCTGGGAAGGCTGG + Intergenic
961775242 3:129279335-129279357 GCGGGGACTGGGGGGAAGGACGG + Intronic
961976096 3:131026839-131026861 GCGGGGCATACTGGGAAGTCGGG - Intronic
963311855 3:143718527-143718549 GTGAGAGCTGCTGGGATGGCTGG - Intronic
963414062 3:144972046-144972068 CCGGGGTCTGTTGGGAAGTCAGG - Intergenic
963683426 3:148409666-148409688 TAGGGGACTGCTGGGAAGGCAGG - Intergenic
964709828 3:159659888-159659910 GAGGGGGCTTCTGGAAAGACAGG + Intronic
965535726 3:169822188-169822210 GCTGGGGCTGCTGAGCAGCCTGG + Exonic
965571787 3:170181139-170181161 GCGGGGGCTGCTTGCAGGTCTGG - Intronic
966311271 3:178596678-178596700 GCGGGGGTTGGTGGGAATGTGGG - Intronic
966345697 3:178977202-178977224 GAGGCGTCAGCTGGGAAGGCGGG + Intergenic
967857704 3:194130867-194130889 GGTGGGGGTGCTGGGAAGGGGGG - Intergenic
968085596 3:195872606-195872628 ACGGGGGCTGTTGGGGAGGAGGG - Intronic
968470968 4:782101-782123 GGCGGGTCTGCTGGGAAGGCCGG + Intergenic
968502215 4:956074-956096 GGAGGGGCCGCTGGGAAGGGAGG - Intronic
968502223 4:956092-956114 GTGGGAGCCGCTGGGAAGGGAGG - Intronic
968525703 4:1055580-1055602 TGGGAGGCTGCTGTGAAGGCAGG + Intergenic
968543514 4:1181669-1181691 GCTGGGGCTGGTGGGGAGGATGG - Intronic
968666052 4:1822922-1822944 GCGGGGGTTTCTAGGGAGGCTGG + Intronic
968673007 4:1862506-1862528 ACGGGGGCTGCGGGGGCGGCAGG + Intergenic
968697724 4:2041130-2041152 GCGCGGGCTGCTGGGTGGGGTGG + Intronic
968760903 4:2442437-2442459 GGGGAGGCTGCTGGGGAGGGTGG + Intronic
968803127 4:2756046-2756068 CCGGGAGCAGCTGCGAAGGCAGG - Exonic
968904893 4:3446578-3446600 GCGGGGCCTGCGGGGAGGACAGG - Intronic
969174314 4:5387082-5387104 GCGGTGGCCCCTGGGAAAGCTGG + Intronic
969323310 4:6426111-6426133 GCGGAGCCTGCTGGGAAGGAAGG - Intronic
969551508 4:7871223-7871245 GAGGGGCCTGCTGGCAAGGCTGG + Intronic
969637002 4:8375056-8375078 GCGAGGGCGGCACGGAAGGCTGG + Exonic
969718906 4:8882304-8882326 GCGGGTGCGGCGGGGAGGGCGGG + Intergenic
971299585 4:25430826-25430848 GCAAGCGCTGCAGGGAAGGCTGG - Intergenic
971499069 4:27299432-27299454 GGTGGGTCTGCTGGGATGGCTGG + Intergenic
972099881 4:35401640-35401662 GCGGGGCCTGCCGGGAAGTCAGG + Intergenic
974076621 4:57173379-57173401 GACGGGGCTGCTGGCCAGGCGGG - Intergenic
976087847 4:81424504-81424526 GCTGGGACTGCTGGGAAGGTGGG - Intergenic
978774854 4:112495605-112495627 GAGATGGCTGCAGGGAAGGCAGG - Intergenic
979468958 4:121072435-121072457 GCGCGGGGTGCTGGGAGAGCCGG + Exonic
980308981 4:131101741-131101763 TGGGGGACTGTTGGGAAGGCAGG + Intergenic
980658953 4:135831102-135831124 GGAGGGGCTGCTGGGAGGCCAGG - Intergenic
981546871 4:145902766-145902788 GCTGGGCGTGGTGGGAAGGCGGG + Exonic
981820264 4:148879626-148879648 TGGGGGACTGTTGGGAAGGCAGG - Intergenic
982067659 4:151668775-151668797 GAGGGTTCTGGTGGGAAGGCAGG - Intergenic
982104825 4:152002667-152002689 GCTGAGGCTGCTGGGGGGGCTGG + Intergenic
982219227 4:153110783-153110805 GTGGAGGGTGCTGGGAAGGAAGG + Intergenic
984695487 4:182775309-182775331 GCAGGTGCAGCTGGGGAGGCTGG + Intronic
985081282 4:186266861-186266883 GCGGGGCCGGCGGGGAAGGAGGG + Intronic
985669693 5:1201040-1201062 GTGGGGACTGGTGGGAAGCCGGG + Intergenic
985780386 5:1867899-1867921 GCGGGGACGGCGGGGACGGCGGG - Intergenic
985780390 5:1867908-1867930 GCGGGGACGGCGGGGACGGCGGG - Intergenic
985780394 5:1867917-1867939 GCGGGGACGGCGGGGACGGCGGG - Intergenic
985972948 5:3392327-3392349 GCTGGGGAGGCTGGGGAGGCGGG + Intergenic
985972961 5:3392363-3392385 GCTAGGGTGGCTGGGAAGGCTGG + Intergenic
985972972 5:3392389-3392411 ACGGGGGTGGCTGGGGAGGCTGG + Intergenic
985973015 5:3392488-3392510 GCTGGGGTGGCTGGGGAGGCCGG + Intergenic
985973040 5:3392542-3392564 GCTGGGGTGGCTGGGGAGGCCGG + Intergenic
986349976 5:6868308-6868330 GAGGCGGCTGCTGGCCAGGCGGG - Intergenic
986779766 5:11054563-11054585 GTGGGGACTGGCGGGAAGGCGGG - Intronic
988401765 5:30771283-30771305 GCGGGAGCAGCAGGGAGGGCTGG + Intergenic
988589525 5:32536795-32536817 TCGGGGGCAGCAGGGAAGGGGGG - Intronic
989235660 5:39145861-39145883 GCAGGGGATGCTGAGAAGGGAGG - Intronic
992812871 5:80407544-80407566 GCGGGGGAAGCGGGGGAGGCGGG + Intergenic
992891697 5:81210018-81210040 GTGGTGGCAGCGGGGAAGGCAGG - Intronic
996740881 5:126797902-126797924 GCTGGGGCAGATGGGAAGACAGG - Intronic
997658762 5:135574529-135574551 GCTGGGTCTGGTGGGAAGGAAGG + Intronic
997737991 5:136228538-136228560 GTGGCGGCTGCTGGGGAGGCGGG + Intronic
998350316 5:141496165-141496187 GCTGGGGCTGCTTGGATGGGAGG - Intronic
998451525 5:142238177-142238199 GTGGGTGCTTCTGGGAAGGAGGG - Intergenic
998473065 5:142398484-142398506 GCTGGTGCTGCTGGGAAGACAGG + Intergenic
998613730 5:143717276-143717298 TAGGGGGCTGCTGGGTATGCAGG + Intergenic
999154669 5:149449986-149450008 GCGACGCCTCCTGGGAAGGCAGG - Intergenic
999303472 5:150505274-150505296 GCCGGGGCTAATGTGAAGGCAGG - Intronic
999727235 5:154446647-154446669 GCGGCGGCAGCTGGGGCGGCGGG - Exonic
1000846924 5:166293147-166293169 GTGGGGCCTGTGGGGAAGGCAGG - Intergenic
1001442214 5:171751589-171751611 GCGAGGGAGGCTGGGAAAGCAGG - Intergenic
1001557773 5:172647968-172647990 GTGGGGGCTGCCTGGAAGTCCGG - Intronic
1001773367 5:174311840-174311862 GCGGGGGCTGCTGGAGGGGCGGG + Intergenic
1001984559 5:176061932-176061954 CCAGGGGCTGCGGGGAAGCCGGG - Exonic
1002187111 5:177459538-177459560 CGGGGGGCTGCTGGGAAGCGGGG + Intronic
1002201729 5:177532580-177532602 GCTGGGGCAGCTGGCAAGCCAGG + Exonic
1002232955 5:177782265-177782287 CCAGGGGCTGCGGGGAAGCCGGG + Exonic
1002258982 5:177981383-177981405 GCTGGGCATGGTGGGAAGGCTGG + Intergenic
1002263036 5:178007554-178007576 CCAGGGGCTGCGGGGAAGCCGGG - Intronic
1002533707 5:179864590-179864612 GAGGGGGGTGCTGGGGAGGGTGG + Intronic
1002600674 5:180352717-180352739 GGGCGGGCTGCGGGGACGGCGGG + Intronic
1003050911 6:2780557-2780579 GCGGGGCCTGCTCAGATGGCTGG + Intronic
1003395447 6:5749030-5749052 GAGGTGACTTCTGGGAAGGCAGG - Intronic
1003480927 6:6532388-6532410 GAGGGGGCTGGTGTGAAGGTAGG - Intergenic
1004472161 6:15939055-15939077 TGGGGGACTGTTGGGAAGGCAGG + Intergenic
1006105260 6:31712588-31712610 GCGGGGGCCACAGGAAAGGCCGG + Intronic
1006154798 6:32008285-32008307 GCAGGGGCTGCAGGGAGGGCAGG - Intergenic
1006161110 6:32041020-32041042 GCAGGGGCTGCAGGGAGGGCAGG - Exonic
1006239501 6:32665105-32665127 GCGGCGGCTGCGGGGGCGGCCGG - Intronic
1006929814 6:37680927-37680949 GCAGGGCCTGCTGGGAAGGCTGG + Intronic
1007248219 6:40477601-40477623 GCAGCGCCTGCTGGGAAAGCAGG - Intronic
1007656709 6:43455215-43455237 GCGGGGGCCGGAGGGAAGGACGG + Intronic
1007729781 6:43938886-43938908 GCGGGAGCTGAGGTGAAGGCAGG - Intergenic
1008383180 6:50856781-50856803 ACGGGGGAGGCAGGGAAGGCCGG - Intergenic
1008932434 6:56954850-56954872 GCGGGGGCGCCTGGGGAGGGAGG - Intergenic
1010807087 6:80250142-80250164 GCAGTGGCTGTTGGGGAGGCCGG - Intronic
1011586327 6:88929692-88929714 GTGGTGGCTGCTTGGAAGGCTGG - Intronic
1013183676 6:107738958-107738980 GAAGGGGCTGCTTGGAAGGTAGG - Intronic
1016208887 6:141504776-141504798 TTGGGGACTGTTGGGAAGGCAGG - Intergenic
1016859653 6:148705074-148705096 GCAGGCCCTGCTGGGAAGTCAGG - Intergenic
1017666136 6:156721678-156721700 GATGGGGGTGCAGGGAAGGCAGG - Intergenic
1017732265 6:157327111-157327133 AAGGAGGCTGCTGGGAAAGCAGG + Intergenic
1018231837 6:161682748-161682770 GCGAGGCCTGGTGGGAAGCCAGG + Intronic
1018391242 6:163343418-163343440 GCCGGGGCTGCTGTGCAGACAGG + Intergenic
1018721268 6:166574317-166574339 CTGGGGGCTGCTGGGGAGGAGGG - Intronic
1018876705 6:167827399-167827421 ACGGGGGCTGCGGGGGACGCCGG - Intronic
1018930842 6:168239412-168239434 GCAGGGGCTGAGGGGAAGGCTGG + Intergenic
1019175397 6:170156931-170156953 GGGGGTGCTGCTGGGAAGACAGG + Intergenic
1019179198 6:170176405-170176427 GCGGGGGCGCCTGGGAAGGACGG + Intergenic
1019198824 6:170297303-170297325 GCGGGGGCGGCGGGGAAGCACGG - Intronic
1019308535 7:347770-347792 GCGGGGACTGTGGGGCAGGCTGG - Intergenic
1019354707 7:572466-572488 ATGGAGGCAGCTGGGAAGGCAGG - Intronic
1019472756 7:1229979-1230001 GCGGCGGCTGCGGGGGCGGCGGG + Intergenic
1019534757 7:1523226-1523248 GCTGGGGCTGTTGGGATGGCGGG - Intergenic
1019558593 7:1644847-1644869 GAGGGGGCTGCCGGGAGGACTGG + Intergenic
1019558776 7:1645589-1645611 GCAGGGGCTGCAGGGGTGGCAGG + Intergenic
1019712559 7:2524273-2524295 TTGGAGGCTGCTGGAAAGGCGGG - Intronic
1020008075 7:4792686-4792708 GCCGGGGCCGCAGGAAAGGCTGG + Intronic
1020088352 7:5323521-5323543 GTGGGGGCCCCAGGGAAGGCAGG - Intronic
1021969435 7:25951614-25951636 GAGGGGGCTCCGGGGAAAGCGGG - Intergenic
1022683987 7:32577539-32577561 CAGGGTGGTGCTGGGAAGGCAGG + Intronic
1022715143 7:32891875-32891897 GCGGGGGCGGCGGGGGCGGCGGG - Exonic
1022910529 7:34896206-34896228 TCGGGGACTGTTGGGAAGGCAGG + Intergenic
1023348160 7:39292860-39292882 TGGGGGGCTGCAGGGATGGCTGG + Intronic
1023638598 7:42237138-42237160 GCGGGGCGCGCGGGGAAGGCGGG + Intronic
1023805853 7:43872461-43872483 GAGGGGTCTGCTGGGAGGTCAGG + Intronic
1024480327 7:49855775-49855797 GTGAGGGCAGCTGGGAGGGCTGG - Intronic
1024522097 7:50314737-50314759 GCTGGGGCTCCTGTGGAGGCGGG - Intronic
1025144170 7:56490604-56490626 GCTGGGGCTGCTGGGATTGTGGG + Intergenic
1025205960 7:56993594-56993616 GTGGGGGCCCCAGGGAAGGCAGG + Intergenic
1025227126 7:57175497-57175519 GCTGGGGCTGCTGGGGCTGCAGG - Intergenic
1025230209 7:57198901-57198923 GCAGGGGCTGCTGGGGCTGCAGG - Intergenic
1025502692 7:61324520-61324542 GCTGGGGCTGGGGGGAAGGGTGG + Intergenic
1025517562 7:61670742-61670764 GCTGGGGCTGGGGGGAAGGGTGG + Intergenic
1025541885 7:62099392-62099414 GCTGGGGCTGGGGGGAAGGGTGG + Intergenic
1025665980 7:63583345-63583367 GTGGGGGCCCCAGGGAAGGCAGG - Intergenic
1026911603 7:74094595-74094617 GTGGGGGCTTCTGCGAGGGCAGG + Intronic
1027220402 7:76210283-76210305 GAGGGGGCTTCTGGGGAGGCAGG + Intronic
1027375432 7:77543672-77543694 CCTGGGGCTTATGGGAAGGCGGG - Intronic
1027591895 7:80128673-80128695 GCGAGGGCTGCAAGGTAGGCAGG - Intergenic
1028045756 7:86117043-86117065 GTGGGGGCTGCTGGGCAGAAGGG - Intergenic
1028641177 7:93043637-93043659 GCGGGGGCTGCGGAGCGGGCGGG + Intergenic
1028906966 7:96165250-96165272 GGGAGGGATGATGGGAAGGCAGG + Intronic
1029432305 7:100539268-100539290 GCGGAGGCGGCTGAGGAGGCGGG + Exonic
1029546417 7:101212692-101212714 GTGGGGGCAGCAGGGAAGTCCGG - Intronic
1029639738 7:101813581-101813603 GCAGGGGGTGGTGGGAAGGGAGG - Intergenic
1030303986 7:108001888-108001910 GCAGGAGAGGCTGGGAAGGCAGG + Intronic
1030798902 7:113825048-113825070 GAGGGGGCTGCAGGTAGGGCAGG - Intergenic
1032536902 7:132672099-132672121 GGGAGGGCTGCGGGGAAGGGGGG - Intronic
1033154708 7:138946972-138946994 GTGGGGGCTGCTGGGAGACCAGG - Intronic
1033181335 7:139182104-139182126 GCGGGGGGAGTTGGAAAGGCTGG + Intronic
1033361553 7:140641459-140641481 CCGTGGGCTGCGGGGAAGGCGGG + Intronic
1033757000 7:144403874-144403896 GCTGGGGCAGCTGCGAGGGCGGG + Intronic
1033808271 7:144979028-144979050 GCAGGGGCTGAGGGGTAGGCAGG + Intergenic
1034200891 7:149282269-149282291 GCGGGGGCGGCAGGGAAGTGTGG - Exonic
1034222778 7:149459497-149459519 TCGGGGGCGGCGGGGGAGGCCGG - Intronic
1034264026 7:149772866-149772888 GGGGGGGCTGGAGGGAAGGGCGG - Intronic
1034264054 7:149772936-149772958 TCGGGGGCTGGGGGGAAGGGAGG - Intronic
1034414065 7:150955778-150955800 GCGGCCGCTGCTGGGCTGGCGGG - Intronic
1035013236 7:155739792-155739814 GCGGGGGCTGGTGCGGAGGCTGG - Exonic
1035013239 7:155739804-155739826 GCGGGGGCTGGTGCGGGGGCTGG - Exonic
1035076174 7:156179059-156179081 GCCGGGGCAGCAGGGCAGGCGGG + Intergenic
1035251128 7:157597817-157597839 GTGGGGGCCACTGGGAAGGCGGG + Intronic
1035389647 7:158496503-158496525 GGGGAGGCTGCAGGGAAGGTGGG - Intronic
1035395193 7:158530396-158530418 GCAGGAGCTCCTGGGAATGCTGG + Intronic
1035546982 8:489257-489279 CCGGGGGCAGGGGGGAAGGCGGG + Intergenic
1035652007 8:1273604-1273626 CCAGGGGCTACTGGGAAGGATGG - Intergenic
1036182051 8:6594156-6594178 GCGGGGGCTCCTGGGAGGCCAGG - Intronic
1036423097 8:8616406-8616428 GCGGGGGCAGCAGGGAAGGGGGG - Intergenic
1036939747 8:13040033-13040055 GCGGGCGCTACTCGGGAGGCTGG + Intergenic
1037450782 8:19013929-19013951 GCGGGGCCTCCGGGGGAGGCTGG + Intronic
1037617636 8:20533925-20533947 GCAGAGGATGGTGGGAAGGCTGG + Intergenic
1037951219 8:23019661-23019683 GGTGGGGATGCAGGGAAGGCCGG + Intronic
1038376264 8:27043047-27043069 GCTGGGGATGAGGGGAAGGCAGG - Intergenic
1039569191 8:38573513-38573535 GAGGGTTTTGCTGGGAAGGCAGG + Intergenic
1040276512 8:46016668-46016690 GCAGGGGCTGCTGGCAAGGTGGG + Intergenic
1040500034 8:47997718-47997740 GAGCGGGCTGCTGGGCATGCTGG + Intergenic
1042617828 8:70669367-70669389 GCGGGCAGTGGTGGGAAGGCTGG + Exonic
1042903026 8:73746959-73746981 GCGGGAGCGGCTGCGCAGGCGGG - Intronic
1043442113 8:80285326-80285348 GCTGGGGCTGCTCGCAGGGCTGG + Intergenic
1044539314 8:93391989-93392011 GCAGGGGCTGCTGGGAATGGGGG - Intergenic
1045252178 8:100491445-100491467 GCCGGGGCTGCTGGTACTGCTGG + Intergenic
1046766449 8:118074700-118074722 CTGGGGGCTGGAGGGAAGGCTGG + Intronic
1047024553 8:120811803-120811825 GCGGCGGCGGCTGGGCCGGCTGG - Exonic
1047428309 8:124766868-124766890 GAGGAGGATGCTGGGAAGGTGGG + Intergenic
1048304030 8:133271130-133271152 CCAGGGCCTGCTGGGAAGGAGGG - Intronic
1049047686 8:140165637-140165659 GGGGGGGATGCGGGGAAGGAGGG + Intronic
1049088057 8:140493358-140493380 GCGGGGGCCTGTTGGAAGGCAGG + Intergenic
1049190049 8:141282294-141282316 GTGGGGCCACCTGGGAAGGCAGG - Intronic
1049246897 8:141567607-141567629 ACGGGGGCAGCTGGGAAGATGGG + Intergenic
1049330190 8:142046283-142046305 GCGGGGGCTGCAGGGAGGGTGGG + Intergenic
1049400884 8:142426704-142426726 GCTGGGGTTGGTGGGTAGGCGGG + Intergenic
1049434874 8:142581881-142581903 GTGGGGGCTGCTGGGTAGCCTGG - Intergenic
1049471746 8:142777810-142777832 GAGGCGGCTGCGGGGAAGGCTGG - Exonic
1049558544 8:143296022-143296044 GCGGGGGCAGCTGGAAGGGGCGG + Exonic
1049697916 8:143992634-143992656 GGGCGGGATGCTGGGCAGGCAGG + Intronic
1049707828 8:144050980-144051002 GCGGCTTCTGCCGGGAAGGCCGG - Intergenic
1049798380 8:144506668-144506690 GCGGGGCCTGCGGGGTGGGCAGG + Intronic
1049831594 8:144704582-144704604 GTGGGGGCGGCTGGGGAGGAGGG + Intergenic
1052996728 9:34555192-34555214 GCGCGGGCAGCTGGCCAGGCGGG + Intronic
1054357207 9:64072151-64072173 CCAGGGGCTGCGGGGAAGCCGGG - Intergenic
1056441773 9:86629123-86629145 TCTGGTGCTGTTGGGAAGGCAGG + Intergenic
1056841355 9:90000111-90000133 CCACTGGCTGCTGGGAAGGCTGG + Intergenic
1057045985 9:91886581-91886603 CCGGGGGTTGCCGGGAAGGGCGG - Intronic
1057152940 9:92809910-92809932 CCAGGGGCTGCAGGGAAGCCGGG - Intergenic
1057259666 9:93576673-93576695 GCGGGGGCGGCGGGGGCGGCGGG - Exonic
1057397054 9:94689668-94689690 GTGGGGGCTGGTGGGAAGGCGGG - Intergenic
1059375141 9:113875910-113875932 GCGGGGGGCGCGGGGAGGGCAGG + Intergenic
1060406975 9:123377636-123377658 GTGGAGGCAGCTGGGAAGTCAGG + Exonic
1060581135 9:124747744-124747766 GAGGGGACTGTTGGGAAGGGTGG - Intronic
1060763652 9:126276661-126276683 GAGGAGGCTGCTGGGAGTGCTGG + Intergenic
1060770100 9:126326585-126326607 GAGGGGGAGGCTGGGGAGGCGGG + Intergenic
1060960347 9:127676398-127676420 GCAGGGGTTGCTGAGAAGCCGGG + Intronic
1061203658 9:129150973-129150995 GCGTGGGCTTCTGGGCAGGATGG + Intergenic
1061237430 9:129351159-129351181 GCTGGGGTTGCGGGGAAGGCGGG - Intergenic
1061349667 9:130054212-130054234 GCGGGGTCTGTGGGGAAGGCGGG + Intronic
1061392592 9:130326111-130326133 GAGAGGGCTGCTGGGGACGCGGG - Intronic
1061579963 9:131530739-131530761 GGGGGGTATGCTCGGAAGGCGGG + Intronic
1061904973 9:133692117-133692139 TCTGGGGGTGCTGGGAGGGCTGG - Intronic
1061924757 9:133800502-133800524 GCGGGGCCTGGTGGGAAGTCAGG - Intronic
1062013525 9:134279959-134279981 GCGGGGGCTGCTGCCAGGGAAGG - Intergenic
1062015175 9:134287744-134287766 GCGGGGGCGGGAGGGAAGGTGGG - Intergenic
1062028905 9:134353108-134353130 GCTGGGGCTGCTGGTGTGGCTGG + Intronic
1062176840 9:135168011-135168033 GCGGTGGCAGCTGGGAGAGCGGG - Intergenic
1062212558 9:135372724-135372746 GGAGGGGCTGCTGGGAGGGGAGG + Intergenic
1062276313 9:135733204-135733226 GTGGGGGCAGGTGTGAAGGCAGG - Intronic
1062310200 9:135931336-135931358 GCAGCGGCTGCTGGGGAGGTGGG - Intergenic
1062332239 9:136049887-136049909 GCGGGGGCTGCGGTGGCGGCGGG - Exonic
1062378423 9:136275309-136275331 GCTGGGGGTGCTGGGAGGGCAGG + Intergenic
1062497219 9:136837569-136837591 GCGGGGGCTGAGGGGCACGCAGG - Exonic
1203490785 Un_GL000224v1:102751-102773 GGCGGCGCTGCTGGGAGGGCGGG + Intergenic
1203503409 Un_KI270741v1:44629-44651 GGCGGCGCTGCTGGGAGGGCGGG + Intergenic
1185464221 X:345738-345760 GCGGGCGGGGCAGGGAAGGCTGG + Intronic
1186795668 X:13044504-13044526 GGTGGGGATGCGGGGAAGGCGGG - Intronic
1186927469 X:14350906-14350928 GGAGGGGCTGGTGGGAAGGTGGG + Intergenic
1187281430 X:17860917-17860939 CCGGGGCCGGCTGGGAGGGCCGG - Intronic
1187464828 X:19517748-19517770 GCTGGGGATGTTGGGAAGGAGGG - Intergenic
1187667289 X:21627882-21627904 TGGGGGACTGTTGGGAAGGCAGG - Intronic
1189254561 X:39627721-39627743 GCAATGGCTGCTGGGATGGCCGG - Intergenic
1190732514 X:53234791-53234813 GTGGGGGCTGCTGGGGAGGTGGG + Exonic
1191258664 X:58290993-58291015 GCAGGGTCTGCTGGGAAGCCAGG - Intergenic
1191637419 X:63393367-63393389 GAGGGGGCGGCTGGCCAGGCGGG - Intergenic
1192183562 X:68930975-68930997 GCCTGGGCAGCTGGCAAGGCAGG - Intergenic
1192430975 X:71111384-71111406 GAGGGGGCTGGTGAGAAGGGTGG - Intronic
1192609601 X:72554491-72554513 GCGGGGGGAGCGGGGAGGGCGGG + Intronic
1192795935 X:74423720-74423742 TCAGGGGCTCCTGGGAAAGCAGG + Intronic
1193279464 X:79629336-79629358 TTGGGGACTGTTGGGAAGGCAGG + Intergenic
1195094783 X:101492796-101492818 GCTGGGGCTGGTGGCCAGGCTGG + Exonic
1195221243 X:102746533-102746555 TGGGGGGCTCCCGGGAAGGCCGG + Intronic
1195243955 X:102979556-102979578 GAGGGGGCTGCTGTGAAGAGGGG - Intergenic
1196169888 X:112575500-112575522 TGGGGGACTGTTGGGAAGGCAGG + Intergenic
1196842549 X:119871827-119871849 GCGGGGCTTGCTGGGAAGAGAGG + Exonic
1197215215 X:123860386-123860408 GCCGGCGCTGCTGGGGAGGGCGG + Intronic
1197372821 X:125646038-125646060 TTGGGGACTGTTGGGAAGGCAGG - Intergenic
1197725604 X:129774364-129774386 GCAGGGGCTGATGGGAGGGGAGG - Intergenic
1199949167 X:152692546-152692568 TGGGGGACTGTTGGGAAGGCAGG + Intergenic
1199960509 X:152775903-152775925 TGGGGGACTGTTGGGAAGGCAGG - Intergenic
1201948295 Y:19535805-19535827 GAGGGGGCAGCTGGCAGGGCGGG - Intergenic