ID: 1083992883

View in Genome Browser
Species Human (GRCh38)
Location 11:66257759-66257781
Sequence GGGGCTGCTGGGAAGGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1459
Summary {0: 1, 1: 0, 2: 9, 3: 75, 4: 1374}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992864_1083992883 25 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374
1083992870_1083992883 13 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374
1083992878_1083992883 -7 Left 1083992878 11:66257743-66257765 CCTTTAAGGCGGCGCGGGGGCTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374
1083992865_1083992883 24 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374
1083992866_1083992883 23 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374
1083992869_1083992883 19 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374
1083992867_1083992883 22 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374
1083992871_1083992883 10 Left 1083992871 11:66257726-66257748 CCGAGGTAGCGGCTTCACCTTTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG 0: 1
1: 0
2: 9
3: 75
4: 1374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992883 Original CRISPR GGGGCTGCTGGGAAGGCCGG CGG Intronic
900238718 1:1604701-1604723 GGGTCTGCTGTGAGGGCCTGAGG - Intergenic
900287395 1:1908344-1908366 GGGGCTGCTGGAGAGGCCGCAGG - Intergenic
900344733 1:2205252-2205274 GGCGCTGCCTGGAAGGACGGTGG - Intronic
900436589 1:2633978-2634000 GGGGCTGCTAGGACAGCCAGCGG - Intergenic
900462622 1:2808841-2808863 GGTGCTGGTGGGAAGGGGGGCGG + Intergenic
900477147 1:2881410-2881432 GGGGCTGCTGGGACTGAAGGAGG + Intergenic
900539886 1:3197344-3197366 GGGGCCGCTGTGATGGCTGGGGG - Intronic
900601277 1:3503780-3503802 GGGGATGCTGGGGAGTCAGGAGG + Intronic
900614163 1:3556990-3557012 GGGGATGCGGGGAAGGCAGGAGG + Intronic
900619786 1:3581433-3581455 GGGGCTGCAGGGAAGCCGGATGG + Intronic
901045668 1:6393993-6394015 GCGGCTGCTGGGAAGACACGGGG + Intronic
901223931 1:7601089-7601111 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
901341594 1:8501771-8501793 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
901341721 1:8502047-8502069 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
901433841 1:9234597-9234619 GGGGCCGAAGGGAAGGGCGGGGG + Intergenic
901439895 1:9271605-9271627 TGGGCTGCCGGGAAGGTTGGGGG - Intergenic
901443343 1:9292750-9292772 AGCACTGCAGGGAAGGCCGGGGG - Intergenic
901529560 1:9844462-9844484 TGGGGGGCTGGGAAGGCAGGAGG + Intergenic
901637746 1:10678188-10678210 CGGGCTGCAGGGAGGGCGGGTGG - Intronic
901654349 1:10760794-10760816 GTGGCAGCTGGGAGGGCAGGTGG + Exonic
901672835 1:10866332-10866354 GGGGCTGGTGGGGGGGCAGGTGG - Intergenic
901757849 1:11452187-11452209 GGGGCAGCTGGGAAGACCAACGG - Intergenic
901791354 1:11655006-11655028 GGGGCTGCCGGGAAGGCTCCTGG + Intronic
901814120 1:11784412-11784434 GGCCATGCTGGGAAGGCCTGTGG - Exonic
901929172 1:12585916-12585938 GCAGCAGCTGGGAAGGCCAGAGG + Intronic
902018990 1:13329212-13329234 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
902584990 1:17433416-17433438 GGGGCGGCGGGGCAGGGCGGGGG + Intronic
902684607 1:18067781-18067803 GGGGCTCATGGGAAGGCCAGAGG - Intergenic
902799089 1:18818397-18818419 AGGGCTGGAGGGAAGGCAGGTGG + Intergenic
902802104 1:18836947-18836969 GGGGCTGCCAGGTAGGGCGGAGG + Intergenic
903081510 1:20815936-20815958 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
903148207 1:21388220-21388242 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
903299947 1:22371717-22371739 GGGTCTCCTGGGAAGGCAGTGGG - Intergenic
903385280 1:22922155-22922177 TGGGCTCCTGGGAAGGCCTCAGG + Intergenic
903508214 1:23853402-23853424 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
903634335 1:24800404-24800426 GGGGCAGCTGGCCAGGCTGGGGG - Intronic
903637592 1:24833138-24833160 GGGGCGGCTGGCCAGGCAGGGGG + Intronic
903637668 1:24833314-24833336 GGGGCGGCTGGCCAGGCAGGGGG + Intronic
903637766 1:24833510-24833532 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
903637819 1:24833637-24833659 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
903748494 1:25604110-25604132 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
903923708 1:26818307-26818329 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
903929673 1:26855085-26855107 GGGGCTGGTGGGTAGGGCTGGGG - Exonic
904077484 1:27853256-27853278 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
904211223 1:28887774-28887796 GGGGCTGGCGCGACGGCCGGGGG - Intronic
904314804 1:29653225-29653247 GGGGCTGCAGGGCAGGCCATGGG + Intergenic
904619477 1:31766666-31766688 GGGGCTCCTGGGAAAGGAGGTGG - Intergenic
904701998 1:32363165-32363187 GGGGCTGGTGCCAAGGCCCGTGG + Intronic
904784482 1:32974373-32974395 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
904784535 1:32974500-32974522 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
904784635 1:32974723-32974745 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
904795127 1:33052224-33052246 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
905315983 1:37081514-37081536 GGGGCGGCTGGCCAGGCCGGGGG - Intergenic
905321372 1:37119779-37119801 GAGGCTGCTGGGGGGGCTGGAGG - Intergenic
905795839 1:40816165-40816187 GGGACATCTGGGAAGGCTGGCGG + Intronic
906046399 1:42834364-42834386 GGTGCTCCTGGGAAGACTGGAGG + Intronic
906240804 1:44241057-44241079 GGGGCTGCTGTGAATGCCACTGG + Intronic
906427396 1:45725222-45725244 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
906486961 1:46241385-46241407 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
906524736 1:46487597-46487619 GGAGCTGCTGGGCAGGCTGGAGG - Intergenic
906761583 1:48382785-48382807 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
906761713 1:48383060-48383082 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
907213414 1:52842596-52842618 GGGGAGGCTGGGGAGGCGGGAGG + Intronic
907388773 1:54142811-54142833 GGGGCTGCTGGGGAGCCCCAGGG - Intronic
907453647 1:54562245-54562267 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
908152176 1:61313327-61313349 TGGGCTTCTGGGAAGGCCTCAGG + Intronic
908370379 1:63473679-63473701 GGGGCGGCTGGCCAGGCAGGGGG - Intronic
908446243 1:64201482-64201504 GGGGCAGCTGGCCAGGCGGGGGG - Intergenic
908581113 1:65518356-65518378 GGGTCTGCTGAGAAGGCCGAGGG + Intronic
909373524 1:74914240-74914262 GGGGCTGCTGTGAAGACCTCTGG + Intergenic
909544604 1:76831843-76831865 GGGGTAGCTGGGCAGGCCTGGGG - Intergenic
909629790 1:77759612-77759634 GGCGCTGCTGGGAGGGGCGCGGG - Intronic
909640948 1:77869842-77869864 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
910343820 1:86216024-86216046 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
910343943 1:86216299-86216321 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
910529628 1:88221028-88221050 TGGGCTGCTGGGAGGGGAGGGGG - Intergenic
912437082 1:109669232-109669254 GGGGATGCTGGGGAGCCTGGTGG + Intronic
912439777 1:109688990-109689012 GGGGATGCTGGGGAGCCTGGTGG + Intronic
912443092 1:109713426-109713448 GGGGATGCTGGGGAGCCTGGTGG + Intronic
912690270 1:111799929-111799951 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
912751816 1:112293646-112293668 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
912751971 1:112293999-112294021 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
912752135 1:112294364-112294386 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
912808026 1:112773590-112773612 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
912825198 1:112898457-112898479 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
912825222 1:112898506-112898528 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
912825275 1:112898633-112898655 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
912844962 1:113069699-113069721 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
913983444 1:143544255-143544277 GGTGCTGCTGGGAAAGCAGTGGG - Intergenic
913993885 1:143638139-143638161 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
913994163 1:143638765-143638787 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
914231484 1:145767047-145767069 GGGGCGGCTGGCAGGGCAGGGGG + Intronic
914775109 1:150728782-150728804 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
914879711 1:151538042-151538064 GGGGCAGCAGGGAAGGCTGAGGG - Exonic
915109286 1:153552911-153552933 GGGGCTTCAGGGAGGGCGGGAGG + Intergenic
915216156 1:154342026-154342048 TGTGCTGCTGGGATGGCCTGGGG + Intronic
915339140 1:155166881-155166903 GGGGCTGCGGGGAGTGCGGGAGG - Intergenic
915411047 1:155701066-155701088 GGGGCGGCTGGCCAGGCAGGGGG - Intronic
915502439 1:156328244-156328266 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
915522681 1:156457026-156457048 GGGACTGCTGCGTAGGGCGGCGG + Intergenic
915724560 1:158008279-158008301 GGGCCTGCTGGGCAGCCCAGGGG - Intronic
915912764 1:159924711-159924733 CCTGCTGCTGGGAAAGCCGGTGG - Intronic
915935755 1:160089441-160089463 GGGGCTCCTGGGGAGGTCGGGGG + Exonic
916019023 1:160776745-160776767 GGAGCTGGTGGGGAGGCTGGAGG - Intergenic
916275305 1:162987639-162987661 GGTGCTGCAGGGAAGTCGGGGGG - Intergenic
916673598 1:167046790-167046812 GGGGCAGCTGGGAAGTGTGGGGG + Intergenic
917859947 1:179135660-179135682 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
917860026 1:179135840-179135862 GGGGCGGCTGGCCAGGCTGGGGG - Intronic
918041838 1:180918397-180918419 GGGGCTGGAGCGAAGGCCGTGGG - Intronic
918228606 1:182509468-182509490 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
919686297 1:200486737-200486759 TGGGCTGTGGGGAGGGCCGGTGG - Intergenic
919925797 1:202191430-202191452 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
920152212 1:203919299-203919321 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
920152265 1:203919427-203919449 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
920152456 1:203919872-203919894 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
920531136 1:206703465-206703487 GGGGCTGCTTGGAGAGCAGGTGG + Intronic
921044087 1:211460873-211460895 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
921140120 1:212298679-212298701 GGGGCGGCTGGCCAGGCAGGGGG + Intronic
921140197 1:212298856-212298878 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
921142599 1:212321169-212321191 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
921237846 1:213151196-213151218 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
921293792 1:213683504-213683526 GAGGGTGCTGGGCAGGCTGGGGG - Intergenic
921638426 1:217524054-217524076 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
922057296 1:222053277-222053299 AGGGCTGCTGGGAAGCCCCGTGG - Intergenic
922278567 1:224101105-224101127 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
922471806 1:225881792-225881814 GGGACTGGGGGGAAGGGCGGGGG - Intronic
922503817 1:226115082-226115104 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
922632975 1:227133351-227133373 GGGGCAGCTGGCCAGGCGGGGGG - Intronic
922693071 1:227710785-227710807 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
923468226 1:234267611-234267633 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
923630874 1:235649170-235649192 TGGGCTGCTGGGGAGCCAGGAGG + Intronic
923710951 1:236387108-236387130 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
924233565 1:241982049-241982071 GGGGCGGCGGGTCAGGCCGGTGG + Intergenic
924321419 1:242854826-242854848 GCGGCTGCTGTGAAGGATGGGGG + Intergenic
924939770 1:248804923-248804945 GGGGCAGCAGTGAAGGCTGGAGG - Intergenic
1062824760 10:559315-559337 GGGGCGGTGGGGAACGCCGGGGG + Intronic
1062824985 10:560727-560749 GGGGCTGTTGAGATGGCCAGGGG - Intronic
1063601240 10:7483100-7483122 GGGACTGCTGGGCAGGGTGGAGG + Intergenic
1064108504 10:12519771-12519793 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1066040814 10:31546535-31546557 GGGGCTGCCGTGAAGACCTGTGG + Intergenic
1066085487 10:31970249-31970271 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1066085540 10:31970376-31970398 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1066085640 10:31970573-31970595 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1066085717 10:31970749-31970771 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1066250798 10:33631005-33631027 TGGGGTGCTGGAAAAGCCGGAGG + Intergenic
1066994795 10:42553598-42553620 GGGGCTGGTGGGAAGGAGGCCGG + Intergenic
1067087307 10:43249734-43249756 GAGCCAGCTGGGAAGGCCTGTGG + Intronic
1067217692 10:44316575-44316597 GGGGCTGGTAGGAAGGGCCGAGG - Intergenic
1067325278 10:45260286-45260308 GGGGCGGCTGGCTGGGCCGGGGG - Intergenic
1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG + Intergenic
1068354877 10:55897678-55897700 GGGGCTGCTGTGAAGGCCTCTGG + Intergenic
1068969849 10:62948354-62948376 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1069365681 10:67691772-67691794 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1069438508 10:68407224-68407246 GGAGCTGCTGGACAGGCCGAGGG - Intronic
1069533924 10:69239377-69239399 GTGGCTGCTGGGGAGGCCCAGGG - Intronic
1069591765 10:69646320-69646342 GGGGCTGGAGGGGAGGCCGAGGG + Intergenic
1069619719 10:69829413-69829435 GGGCCTGCTGGGAATGCAGAAGG - Intronic
1069645396 10:69992937-69992959 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1069664605 10:70146202-70146224 GGGGCTGCAGGGGACGCCCGCGG + Exonic
1069699084 10:70408134-70408156 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1069719841 10:70542441-70542463 GGGGCTGCTGGGAGGGAGGATGG - Intronic
1069741285 10:70687664-70687686 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1069929981 10:71875753-71875775 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1070318008 10:75333436-75333458 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1070780702 10:79135969-79135991 GGGGAAGCTGGGAAGGCCGCTGG + Intronic
1070888858 10:79927394-79927416 TGGGCTGCTGGGAAGAGGGGAGG + Intergenic
1070966675 10:80534677-80534699 GGGGCAGCTGGCCAGGCGGGGGG - Intergenic
1071726106 10:88199536-88199558 AGAGGTGCTGGGAAGGCCAGCGG + Intergenic
1072149516 10:92674337-92674359 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1072149876 10:92675116-92675138 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1072180355 10:92975487-92975509 GGGGCGGCTGGGTGGGCGGGGGG - Intronic
1072211466 10:93250400-93250422 GGGGCTGTTGGGAAGCTCAGGGG - Intergenic
1072411428 10:95205917-95205939 TGGGCTGATGGGAAGGCCGAGGG - Intronic
1072602256 10:96941264-96941286 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1072648359 10:97275940-97275962 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1072648462 10:97276166-97276188 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1072999958 10:100277893-100277915 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1073190369 10:101646582-101646604 GAGGCAGCCGGGAAGGCCAGGGG + Intronic
1073266134 10:102229620-102229642 AGGGCTGCTGTGATGGCAGGAGG + Intergenic
1073321487 10:102618853-102618875 GGAGCTGCTGAGGAGGCTGGAGG + Intronic
1073321629 10:102619521-102619543 AGAGCTCCTGGGAAGGCTGGCGG + Intronic
1073479482 10:103777459-103777481 TGAGCTGCTGGGAAAGCCAGAGG - Intronic
1074047017 10:109848513-109848535 GAGTCTGTTGGGAAGGCCTGTGG - Intergenic
1074525604 10:114260615-114260637 TGGGCTGCTGAGAAGGCAGGAGG + Intronic
1075136926 10:119794674-119794696 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1075629868 10:123994487-123994509 GGCGCTCCTGAGAAGGCCGTGGG + Intergenic
1075738944 10:124681712-124681734 GCGGCTGCGGGAAAGGCCGCTGG + Exonic
1076049963 10:127324449-127324471 GGGGCTTCTGGGCAGGACTGGGG + Intronic
1076304385 10:129454076-129454098 TGGGCTGCTATGAAGGCCGGTGG + Intergenic
1076707101 10:132308003-132308025 GGGGCTTCTGGAAGGGGCGGGGG + Intronic
1076707682 10:132310539-132310561 GGGGATGCTGGGAGGGACTGAGG + Intronic
1076804241 10:132847221-132847243 GGGGCTGCCCTGGAGGCCGGCGG + Exonic
1076863043 10:133150995-133151017 GGGGCCCCTGGGGAGGCCGCAGG - Intergenic
1076874170 10:133207890-133207912 GGGGCTGGTGGGGCGGCCGGGGG - Intronic
1076947101 10:133658894-133658916 CGGGCTGCTGGGGAGGCTGAGGG - Intergenic
1077026723 11:442951-442973 AGGGCTGCTGGGCTTGCCGGGGG - Intergenic
1077162424 11:1119819-1119841 TGGGCTGTGGGGGAGGCCGGGGG + Intergenic
1077228843 11:1449799-1449821 TGGGCTGGTGGAAAGGCCTGAGG - Exonic
1077228845 11:1449811-1449833 GGGGCTGCTGAGTGGGCTGGTGG - Exonic
1077366224 11:2162404-2162426 TGGGGAGCTGGGAGGGCCGGAGG - Intergenic
1077391114 11:2301039-2301061 GGGGGTGCTGGGCTGGACGGGGG + Intronic
1077635028 11:3836505-3836527 GTGGTAGCTGGGAAGGCTGGGGG + Intronic
1077668489 11:4137376-4137398 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1077668535 11:4137473-4137495 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
1077842991 11:5994952-5994974 CTGGCTGCAGGGATGGCCGGGGG - Intergenic
1077877573 11:6320681-6320703 GGGCCTGCTGGGAAGCCTGTTGG + Intergenic
1078177021 11:8978510-8978532 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1078177147 11:8978785-8978807 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1078552577 11:12290638-12290660 GGAGCTGCTGGGGAGGCGGCTGG - Intronic
1078653402 11:13216436-13216458 GGGGAAGCTGGGATGGCCGTTGG + Intergenic
1079173959 11:18121337-18121359 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1079371906 11:19859973-19859995 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1079371929 11:19860019-19860041 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1079371981 11:19860147-19860169 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1080098110 11:28430560-28430582 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1080860184 11:36144991-36145013 GGGGCGGCTGGCAGGGCGGGGGG - Intronic
1080908202 11:36567952-36567974 GGGGAGGCTGGGAAGGACAGTGG + Intronic
1081288780 11:41304183-41304205 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1081289169 11:41305061-41305083 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1081582428 11:44361333-44361355 GGGGCCGCTGGGAGGACTGGAGG - Intergenic
1081956291 11:47097111-47097133 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1081956548 11:47097694-47097716 GGGGCGGCTGGCCAGGCAGGGGG - Intronic
1082009644 11:47441565-47441587 GGGAGTGCTGGGAGGGCTGGAGG + Intronic
1082678860 11:56143946-56143968 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1083248180 11:61446455-61446477 GGAGCTGCAGGGAGGGCGGGAGG - Exonic
1083263683 11:61536479-61536501 AGGGCCACTGGGAGGGCCGGGGG - Intronic
1083312145 11:61789432-61789454 GAGGCTGCTGGGAAGTCAGCTGG - Intronic
1083382454 11:62279117-62279139 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1083644902 11:64166372-64166394 GGGGCTGCGTGGAAGGCCCGGGG - Intergenic
1083646005 11:64172179-64172201 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1083739676 11:64702014-64702036 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1083753721 11:64778143-64778165 GCGGCTGCTGGGGAGGCGGAGGG + Exonic
1083780468 11:64914898-64914920 GGGGCTGGTGGGGGGGCCGTGGG + Intronic
1083865677 11:65451683-65451705 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1083865752 11:65451859-65451881 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1083992883 11:66257759-66257781 GGGGCTGCTGGGAAGGCCGGCGG + Intronic
1084091116 11:66879906-66879928 GGAGCTGCTGTGAATGACGGAGG + Intronic
1084180054 11:67441667-67441689 GGGGCTGCTGGGATGTATGGAGG + Intronic
1084190271 11:67495464-67495486 GGGGCGGCTGGCTGGGCCGGGGG + Exonic
1084442143 11:69180642-69180664 AAGGCTGGAGGGAAGGCCGGGGG + Intergenic
1084476832 11:69394091-69394113 CCGGCTGCTGGGAGGGCTGGAGG + Intergenic
1084494354 11:69495493-69495515 GGGGCTGCTGGGAAGTGAGTGGG + Intergenic
1084564766 11:69922495-69922517 GGGGCTGCTGGGAATGGCCTGGG + Intergenic
1084624370 11:70295663-70295685 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
1084957643 11:72699736-72699758 GGGGCTGCTGCAGAGGCCTGGGG - Intronic
1085084179 11:73655816-73655838 GCGGCTCCTGGGAGGGACGGTGG - Exonic
1085292427 11:75410045-75410067 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1085463393 11:76708574-76708596 GGGGCTGCTGGAGAGCCAGGGGG + Intergenic
1086104514 11:83133519-83133541 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1086122400 11:83316487-83316509 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
1086792870 11:91063747-91063769 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1087057234 11:93947096-93947118 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1087948738 11:104194887-104194909 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1088577274 11:111284339-111284361 GGGTCTCCGGGGAAGGGCGGTGG - Exonic
1088770631 11:113032423-113032445 GGGGATTCTGGGAAGGGCTGGGG - Intronic
1089182877 11:116595060-116595082 AGGGCTGCTGGGCAGAGCGGAGG - Intergenic
1089198616 11:116710198-116710220 CGGGCAGCTGGGAAGCCCTGCGG - Intergenic
1089420894 11:118331390-118331412 GGGGCAGCTGGCCAGGCGGGGGG + Intergenic
1089456318 11:118627947-118627969 GGGGCTGCCAGGAATGCTGGTGG - Exonic
1089493883 11:118899077-118899099 GGTGCTGCTGGGGAGGCATGGGG + Exonic
1089585540 11:119507824-119507846 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1089775572 11:120833084-120833106 GGGGCAGCTGGGAGGGAGGGAGG - Intronic
1090439001 11:126710954-126710976 GTGGCTGCTGGGACGGCCAAGGG + Intronic
1090736262 11:129614361-129614383 AGGGCTGCTGGGAACACCGTGGG - Intergenic
1091207744 11:133832997-133833019 GGGACTGCGGGGAGGGGCGGCGG + Intergenic
1091378655 12:42262-42284 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1091378731 12:42437-42459 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1091384417 12:83682-83704 GAGGTTGATGGGAAGGCGGGCGG + Intronic
1091582069 12:1796270-1796292 GGGACTGCTGGGAAGGCCGTGGG - Intronic
1091731636 12:2885387-2885409 GGGCTTTCTGGGAAGGCTGGCGG - Exonic
1091741633 12:2963815-2963837 GGGGCTCCTGGAAGGGCCAGAGG + Intronic
1091780108 12:3208305-3208327 GGGGCAGCTGGGAGGGCCAGGGG + Intronic
1091799759 12:3317402-3317424 GGGACTGGTGGGAAGTTCGGGGG - Intergenic
1091839234 12:3607572-3607594 GTGGCAGCTGGGGAGGCCGCGGG + Intronic
1091901201 12:4145511-4145533 GGGTCAGCTGGAAAGGCAGGAGG - Intergenic
1092296000 12:7200000-7200022 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1092401905 12:8184485-8184507 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1092453749 12:8625628-8625650 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1092453802 12:8625755-8625777 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1092453824 12:8625804-8625826 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1092453878 12:8625932-8625954 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1092453926 12:8626030-8626052 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1092591123 12:9953369-9953391 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1092591147 12:9953418-9953440 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1092827451 12:12413813-12413835 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1092827553 12:12414037-12414059 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1092827625 12:12414185-12414207 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1092827677 12:12414312-12414334 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1092880705 12:12885691-12885713 GGGGCGGCAGGGAGGGGCGGGGG + Intergenic
1095439594 12:42227983-42228005 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1095439795 12:42228437-42228459 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1095439825 12:42228492-42228514 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1095571296 12:43685717-43685739 GGGGCGGCTGGCAGGGCAGGGGG - Intergenic
1096021925 12:48332308-48332330 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1096064017 12:48724953-48724975 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1096495560 12:52037448-52037470 GGGGCTGCCGGGGTGGCGGGAGG + Intronic
1096856609 12:54488314-54488336 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1097046164 12:56189223-56189245 GGGGCTGCTTGGGAGGCCGCGGG + Intronic
1097126864 12:56783293-56783315 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1097182441 12:57179057-57179079 GAGGCTGGAGGGAAGGCCGCAGG + Intronic
1097191562 12:57221829-57221851 GGGGGAGTTGGGAAGGCAGGTGG - Intronic
1097261578 12:57723497-57723519 AGGGCTGCAGGGAGGGCTGGCGG + Intergenic
1097282981 12:57856782-57856804 GGGGTTGGGGGGAAGGGCGGAGG - Intergenic
1098412806 12:70202400-70202422 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1098412937 12:70202675-70202697 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1100570372 12:95840699-95840721 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1100570449 12:95840875-95840897 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1100570549 12:95841070-95841092 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1100570601 12:95841197-95841219 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1100582165 12:95947774-95947796 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1100616454 12:96235177-96235199 GGGGGTGCAGGGAAGGCAGTTGG - Intronic
1100995088 12:100294487-100294509 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1101421467 12:104554616-104554638 GGGACTGCTGGGGAGGATGGAGG + Intronic
1101685921 12:107020654-107020676 GTGGCTTCTGGGAAGGCCTCAGG - Intronic
1102011951 12:109624301-109624323 GGGGGTGTTGGGGAGGCCGAGGG + Intergenic
1102029621 12:109732452-109732474 TGGGCTGCTGGGCAGGCGGCCGG - Intronic
1102413739 12:112742636-112742658 GGGGCTGCTGTCAGGGCTGGGGG + Intronic
1102420772 12:112801114-112801136 GGGGCTGCGGGAAAGGCTGCTGG + Intronic
1102535232 12:113576112-113576134 GCGGTGGCTGGGAAGGCGGGAGG + Intergenic
1102933303 12:116878665-116878687 GGTGCTGCTGGGAAGCCGAGCGG + Intronic
1103011076 12:117458884-117458906 TGGGCTTCTGGGAAGTCAGGGGG - Exonic
1103591390 12:121994037-121994059 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1104588854 12:130068538-130068560 GGGGCTTCTGGGGAGCTCGGGGG - Intergenic
1104635441 12:130435578-130435600 GGTGCTTCTGGGGAGGCCGTGGG - Intronic
1104712707 12:130996987-130997009 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1104727635 12:131087732-131087754 GGGGCCACTGGGAAGGCATGGGG - Intronic
1104761792 12:131301121-131301143 GGGGCTGCTGCCAAGGTCTGAGG - Intergenic
1104817980 12:131659663-131659685 GGGGCTGCTGCCAAGGTCTGAGG + Intergenic
1104856211 12:131903649-131903671 GGGGCTGCAGGGTAGGGTGGGGG - Intronic
1105248529 13:18674094-18674116 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1105526944 13:21186323-21186345 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1105543971 13:21338665-21338687 GGGGCTGATGGGAAGACAGGAGG - Intergenic
1105636482 13:22220533-22220555 GGGGCTGCAGGGAGGGGCTGGGG - Intergenic
1105805561 13:23950002-23950024 GGGGGTGCTGGGCAGCCAGGGGG + Intergenic
1105980408 13:25512761-25512783 GGGGCGGCTGGCCAGGCAGGGGG + Intronic
1106006436 13:25774399-25774421 GGGCCTGTTGGGGAGGCAGGGGG + Intronic
1106560103 13:30839579-30839601 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1106678261 13:31984486-31984508 GGGGCTGCTGTGAAGACCTCTGG - Intergenic
1106763661 13:32892531-32892553 GAGGATGCTGAGAAGGCCAGGGG + Intergenic
1106789316 13:33138663-33138685 TGGGCCGCTGGGAATGCCGCGGG + Intronic
1106918765 13:34541078-34541100 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1107499046 13:40955686-40955708 GGGGCGGCTGGCCAGGCCGGGGG - Intronic
1107508959 13:41061920-41061942 GGGGCTGGTTGGACGGCCGCGGG + Intronic
1107549111 13:41458266-41458288 GGGGCTGCGGGCAGGGCCAGGGG - Exonic
1108077715 13:46698952-46698974 GGGGCTGCCGGGAAGGAACGAGG - Intronic
1108270547 13:48755698-48755720 GGGGCTGCTGTGAAGACCTGAGG - Intergenic
1108273271 13:48783683-48783705 GGGGCTGCGGGGAGGGGTGGAGG + Intergenic
1108351484 13:49593337-49593359 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1108478337 13:50843105-50843127 GGGGCTGCTGGGATGGCGATGGG - Intronic
1108510076 13:51148211-51148233 CAGGCTGCTGGCAAGGCCTGGGG - Intergenic
1108608845 13:52064509-52064531 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1109391774 13:61704044-61704066 GGGGCTGCTGTGAAGGTCTCTGG - Intergenic
1110269487 13:73575189-73575211 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1111418169 13:87976266-87976288 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1111418297 13:87976568-87976590 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1111965975 13:94862253-94862275 AAGGCTGCTGAGAAGGCTGGTGG + Intergenic
1112056147 13:95691170-95691192 GGGGCTGCTGGCCAGGCAGGCGG + Intronic
1112433266 13:99372078-99372100 GAGGCTGCTGTGCAGGCAGGCGG + Intronic
1112623581 13:101077824-101077846 GGGGCTGCTGTGAAGGTCTCTGG - Intronic
1113104830 13:106760502-106760524 GCGGCTGCCGGGAAAGCTGGGGG + Intergenic
1113861687 13:113491050-113491072 GGCGGTGCTGGGCAGGGCGGCGG + Exonic
1113925584 13:113939823-113939845 GGAGGTGCTGGGAAGGCCAAAGG + Intergenic
1114165269 14:20212929-20212951 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
1114199408 14:20506824-20506846 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1114318352 14:21526381-21526403 GGAGCTGCTGGGGAGGGAGGCGG + Intronic
1114380466 14:22198420-22198442 GGGGCTGCTGTGAAGACCTCTGG - Intergenic
1114427825 14:22637596-22637618 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1114427897 14:22637744-22637766 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1114428022 14:22638040-22638062 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1114626179 14:24131691-24131713 GGGGCTGCCCAGAAGGCGGGCGG - Exonic
1114998122 14:28385735-28385757 GGGGATGCTGGGAGGGGCTGAGG - Intergenic
1115609957 14:35039646-35039668 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1115703326 14:35976877-35976899 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1115703571 14:35977439-35977461 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1116098950 14:40408663-40408685 GGGGCTCCTGGGAAGGTCTCTGG + Intergenic
1116480525 14:45389605-45389627 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1116940111 14:50783161-50783183 GGGTCAGCGGGGAGGGCCGGAGG - Intronic
1116945305 14:50830770-50830792 GGGGCTGCTTCGGAGGCGGGAGG - Intronic
1117396231 14:55312855-55312877 GGGGCTGCTGTGAAGACCTCTGG + Intronic
1117544061 14:56776860-56776882 GGGGCTGCTTGGCAGTCAGGGGG + Intergenic
1118148661 14:63165805-63165827 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1118184312 14:63523096-63523118 GGGGCTGCTGGCCGGGCGGGGGG - Intronic
1118332592 14:64825553-64825575 GGGGCTGCTGGACAGGCTTGTGG - Intronic
1118340867 14:64895003-64895025 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1118340944 14:64895179-64895201 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1118341044 14:64895376-64895398 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1118341097 14:64895503-64895525 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1118378867 14:65201458-65201480 GGGCCAGGTGGGAAGGACGGGGG + Intergenic
1118409550 14:65463976-65463998 GGGGCTGCAGGGGTGGCTGGGGG - Intronic
1118428399 14:65692208-65692230 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1118584715 14:67341474-67341496 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1118584740 14:67341524-67341546 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1119163381 14:72471709-72471731 GGGGCTGCTGGGTGGTCAGGAGG - Intronic
1119254237 14:73184031-73184053 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1119761463 14:77154972-77154994 AGGGCTGCTGTGAAGGTCCGTGG - Intronic
1120009468 14:79397021-79397043 GGAGCTGTTAGGAAGGCCAGAGG + Intronic
1120309769 14:82814226-82814248 GGGGCGGCTGGCCAGGCGGGTGG + Intergenic
1120820832 14:88910472-88910494 AGGGCTGGTGGGAAAGCCGTGGG - Intergenic
1120829416 14:88984836-88984858 GTGGCAGCTGGGAAGGCTGATGG + Intergenic
1120874528 14:89363272-89363294 GGGTTTGGTGGGAAGGCCAGAGG - Intronic
1120892875 14:89506033-89506055 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1121465297 14:94111811-94111833 GAGGCGGCTGGGAAGGGCGGGGG + Intronic
1121472113 14:94164111-94164133 GGGGCTGCTGGGAAGGCGAGAGG + Intronic
1122299776 14:100725100-100725122 GGGGCTGCTGGGAACGGCTTTGG - Intergenic
1122369368 14:101220823-101220845 GGGGCAGGTGGGAAGGAGGGAGG - Intergenic
1122374230 14:101247776-101247798 GGGGCGGCTGGGGAGGTGGGCGG - Intergenic
1122716703 14:103700485-103700507 AGAGCTGCTGGCAAGGCCCGTGG - Intronic
1122785764 14:104162671-104162693 GGGGCTGCAGGGGAGGGTGGAGG + Intronic
1122792663 14:104190880-104190902 GGGAGTGCTGGGGAGGCCGGGGG + Intergenic
1122820693 14:104343328-104343350 GTGGAAGCTGGGGAGGCCGGAGG + Intergenic
1122826532 14:104373544-104373566 GGGGTTGCTGAGAAGGAGGGAGG + Intergenic
1122963614 14:105111565-105111587 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1122963767 14:105111918-105111940 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1122963790 14:105111967-105111989 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1122981594 14:105194620-105194642 AGGGGTGCTGGGAAGGATGGAGG - Intergenic
1123028070 14:105437940-105437962 GGAGCTGGTGAGAAGGCTGGAGG + Intronic
1202923745 14_KI270724v1_random:6131-6153 CGGGCTGCTGGGGAGGCTGAGGG + Intergenic
1124245930 15:28070501-28070523 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1124335006 15:28849671-28849693 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1124987552 15:34636561-34636583 AGGGCAGCTGGGATGGCAGGGGG - Intergenic
1125016886 15:34946541-34946563 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1125228247 15:37420872-37420894 GGGGGTTCTGGCATGGCCGGTGG + Intergenic
1125459509 15:39894063-39894085 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1125603646 15:40928413-40928435 GGGGCTGCTGGGGTGGGGGGAGG + Intergenic
1125659315 15:41382842-41382864 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1125815659 15:42581647-42581669 GAGGCTGCTGGCGAGGCCCGAGG - Intronic
1126295644 15:47133170-47133192 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1126448577 15:48779716-48779738 GGGGCTACTGGGAAGAGCGTGGG - Intronic
1127073064 15:55303270-55303292 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1127154216 15:56110151-56110173 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1127154269 15:56110280-56110302 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1127262533 15:57336824-57336846 GGTGGTGCTTGGAAGGCTGGTGG - Intergenic
1127275427 15:57439253-57439275 GGCACACCTGGGAAGGCCGGAGG - Exonic
1127584457 15:60367081-60367103 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1127824214 15:62689909-62689931 GGGGCAGCTGGCCAGGCGGGGGG + Intronic
1127824313 15:62690125-62690147 GGGGCGGCTGGCCAGGCAGGGGG + Intronic
1128254421 15:66186333-66186355 GGGGCTGCTGGCCAGTCCCGGGG - Intronic
1128467889 15:67928150-67928172 GGGGCTGCCGAGAGGGCTGGGGG + Intergenic
1128527409 15:68421896-68421918 GGGGCTGCTGGCAAGCCTGCTGG + Intronic
1128587031 15:68859985-68860007 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1128970235 15:72100980-72101002 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1129107875 15:73321693-73321715 GGGCCTGCTGCGAAGTCCTGGGG + Exonic
1129162247 15:73753235-73753257 GGGGCGGCGGGGCGGGCCGGGGG - Intergenic
1129330389 15:74824134-74824156 GGAACAGCTGGGAAGGCCTGGGG - Intronic
1129341362 15:74888583-74888605 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1129388989 15:75211163-75211185 GGGGCAGCTGGGCAGGCAGAAGG - Exonic
1129390981 15:75220864-75220886 GGGGCTGTGGGGCAAGCCGGGGG - Intergenic
1129428425 15:75481353-75481375 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1129431814 15:75504810-75504832 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1129617725 15:77113067-77113089 TGGGCTGTTGGGATGGCCGTAGG - Exonic
1130340605 15:82997809-82997831 GGGGCGGCTGGCAGGGCAGGGGG + Intronic
1130340682 15:82997988-82998010 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1131027025 15:89151963-89151985 GGGGCTGTTGGGAAGCCTGCTGG + Intronic
1131117531 15:89804153-89804175 CGGGCTGCTGAGAAGGGAGGAGG - Intronic
1131125392 15:89854355-89854377 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1131127316 15:89868176-89868198 GGGGCAGCTGGCCAGGCGGGGGG - Intronic
1131440857 15:92458640-92458662 TGGGCTCCTGGGAAGGTCGTTGG - Intronic
1132121929 15:99183841-99183863 GGGGCTGCTGTGAAGGTCTCTGG - Intronic
1132359715 15:101202126-101202148 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132359799 15:101202504-101202526 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132410786 15:101577063-101577085 GAGGCTGCTGGGAAGGGCTGGGG - Intergenic
1132498040 16:273107-273129 GGGGCTGTGGGGAGGCCCGGTGG - Intronic
1132519259 16:379899-379921 GGGGCTGTGGGGCAGGCAGGGGG - Intronic
1132579280 16:677707-677729 GGGGCCGGGGGGAGGGCCGGGGG + Intronic
1132611627 16:819629-819651 GGGGCTGCTGGCCTGGCCTGGGG + Intergenic
1132659201 16:1054070-1054092 GGGGGTGCTGCCAAGGCAGGTGG - Intergenic
1132690103 16:1178301-1178323 GAGGCGGCTGGGGAGGCCGTGGG - Intronic
1132883199 16:2171363-2171385 AGGGGGGCTGGGAAGGGCGGCGG - Intronic
1132898259 16:2238979-2239001 GGGGCTGCGGGGTGGGCCTGGGG - Intergenic
1133129223 16:3665902-3665924 GGGGCTGCTGAGGAAGCTGGTGG - Intronic
1133212536 16:4271619-4271641 GTGGCTTCTGGGGAGGCCTGCGG + Intronic
1133364819 16:5202480-5202502 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1133623148 16:7545479-7545501 AAGGCTGCAGGGAAGGTCGGGGG - Intronic
1133740407 16:8646999-8647021 GGGGCTGCAGGGAGGGCCAAGGG - Exonic
1133933689 16:10252281-10252303 GGGGCGGCTGGGGAGGACTGAGG - Intergenic
1134614883 16:15643249-15643271 GGGCATGCTGGGAACCCCGGGGG + Exonic
1135565794 16:23510211-23510233 GCGGCCGCAGGGGAGGCCGGCGG - Intronic
1135860183 16:26049313-26049335 GGACCTGCTGGGAAGTCCGGAGG + Intronic
1135935843 16:26779284-26779306 GGGGGTGGAGGGAAGGCCTGGGG + Intergenic
1136117337 16:28102847-28102869 GGGGCAGTCGGGGAGGCCGGTGG + Intronic
1136250247 16:28999713-28999735 AGGGCTGCAGGGAACACCGGGGG + Intergenic
1136282338 16:29221112-29221134 GGGGCGGCTGGGAGGCCCTGGGG + Intergenic
1136365814 16:29808752-29808774 AGGGCTGCCGGGAGGGCCAGGGG + Intronic
1136425790 16:30169013-30169035 GGGGCTGCTGGCCTGGCGGGGGG - Intergenic
1136425856 16:30169160-30169182 GGGGCGGCTGGCCAGGCGGGAGG - Intergenic
1136496462 16:30648091-30648113 GGGGCTGCTGGTGTGGCCGTGGG - Intergenic
1136567860 16:31080693-31080715 TGGGGTGCAGGGAAGGCAGGTGG + Exonic
1136572442 16:31105168-31105190 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1136572543 16:31105394-31105416 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1136593575 16:31232406-31232428 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1136593752 16:31232807-31232829 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1137033132 16:35543700-35543722 GGGGGCGCTGGGGAGGCAGGCGG - Intergenic
1137412863 16:48244314-48244336 GTGACTGCGGGGCAGGCCGGGGG + Exonic
1137938520 16:52658403-52658425 GGGGCCACTGGGCAGGCCAGGGG - Intergenic
1138138554 16:54546274-54546296 AGAGCTGTTGGGAAGCCCGGGGG + Intergenic
1138400428 16:56739875-56739897 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1138400530 16:56740101-56740123 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1138483052 16:57316889-57316911 GGAGCTTCTGGGAGGGCCAGTGG - Intergenic
1138591039 16:58000100-58000122 GGGCCTGCAGGCAGGGCCGGCGG - Intronic
1139623168 16:68163471-68163493 GGGGCTGCTGGCTGGGCGGGGGG + Intronic
1139750457 16:69106499-69106521 GGGGCTGCAGGAACGGCCGCCGG - Intronic
1139864460 16:70051740-70051762 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1139864514 16:70051867-70051889 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1139864589 16:70052043-70052065 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1140994385 16:80244019-80244041 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1141029499 16:80575235-80575257 TGGGCTGCAGGGAGGGCAGGGGG + Intergenic
1141407660 16:83808126-83808148 GGGACGGCTGTGAGGGCCGGAGG + Intronic
1141608615 16:85169336-85169358 GGGGGTGCTCGGCAGGCCCGGGG + Intergenic
1141657598 16:85424354-85424376 GGGGCTCATGGGGAGGCTGGGGG + Intergenic
1141895087 16:86954076-86954098 GGGGCTGGGGGGAGGGCCGGCGG + Intergenic
1141972360 16:87492480-87492502 GGGGCGGCCGGGGCGGCCGGGGG + Intergenic
1142086710 16:88187030-88187052 GGGGCGGCTGGGAGGCCCCGGGG + Intergenic
1142160547 16:88555155-88555177 GGGGCCGTGGGGAAGGGCGGTGG - Intergenic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142224921 16:88872660-88872682 GGGGCTGGCGGGAGAGCCGGCGG - Intergenic
1142399352 16:89851265-89851287 GAGGCTGGTGGGGAGGCAGGAGG - Intronic
1142412868 16:89924969-89924991 GGGGCTCCTGGGAGGGTCAGGGG + Intronic
1142468104 17:147367-147389 GTGGCTGCTGGGGAAGCCCGGGG + Exonic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142670505 17:1485662-1485684 GGGGCGGCGGGGCAGGGCGGGGG - Intronic
1142747439 17:1966934-1966956 GAGGATGCTGGGAAGGCCAGGGG - Intronic
1142748118 17:1970692-1970714 GGGACTGGAGGGAAGGACGGTGG + Intronic
1142818744 17:2447814-2447836 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1142818814 17:2447961-2447983 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1142825346 17:2507084-2507106 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1142855032 17:2724473-2724495 GGGGCTCCTGGGGAGGCGGCTGG + Intergenic
1143162612 17:4881365-4881387 GGGGAGGCTGGGTAGACCGGAGG - Intronic
1143183046 17:4996003-4996025 GGGGCAGTTGGGAATGCCTGTGG + Intronic
1143815213 17:9507199-9507221 GGGGCCTTTGGGCAGGCCGGGGG - Intronic
1144051583 17:11501572-11501594 GAGGCTGCTGGGCAGGCAGTTGG + Intronic
1144201596 17:12947225-12947247 GGGGTTGCTGGGGATCCCGGAGG - Intronic
1144626684 17:16847477-16847499 GGGGCTCCTGGAAAGACCAGAGG - Intergenic
1144956943 17:19023457-19023479 GGGGATGCTGGCAAGGCCTGGGG - Intronic
1145027095 17:19476089-19476111 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1145047120 17:19627693-19627715 GGGGCGGCTGGGCGGGCGGGGGG + Intergenic
1145152487 17:20519152-20519174 GGGGCTCCTGGAAAGACCAGAGG - Intergenic
1145174258 17:20685477-20685499 GGGGCGGCTGGGTGGGCGGGGGG - Intergenic
1145205966 17:20984904-20984926 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1145418189 17:22741480-22741502 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1145733755 17:27212445-27212467 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1145863012 17:28224340-28224362 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1145980801 17:29010345-29010367 GGGGGTGGTGGGCAGGCTGGAGG - Intronic
1146132556 17:30291724-30291746 CCGGCGGCGGGGAAGGCCGGGGG - Intronic
1146216029 17:30979638-30979660 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1146216129 17:30979835-30979857 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1146216184 17:30979963-30979985 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1146279009 17:31533111-31533133 GGGCATGTTGGGAAGGGCGGTGG + Exonic
1146444187 17:32922309-32922331 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1146444260 17:32922457-32922479 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1146444312 17:32922584-32922606 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1146492312 17:33291997-33292019 GCGGCTGCCGGGCAGCCCGGGGG - Exonic
1146594846 17:34159387-34159409 TGGGCTGCTGGGGAGGAGGGCGG - Intronic
1147182907 17:38698016-38698038 GGGGTTGAAGGGAAGGCCGCTGG - Intergenic
1147466588 17:40615625-40615647 GGGGCTGGAGGGAAGGGCTGAGG + Intergenic
1147561206 17:41510388-41510410 GGAGGTGCTGGGCAGGCAGGAGG + Intergenic
1147686202 17:42288261-42288283 GGGCCTGCTGGGACTCCCGGGGG + Exonic
1147700063 17:42388238-42388260 GGGGCCGTTGGGGAGGCCTGGGG - Intronic
1147963479 17:44180889-44180911 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1147963625 17:44181214-44181236 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1147974420 17:44238779-44238801 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1148140677 17:45325764-45325786 GGAGCTTCTGGGAAAGCTGGGGG + Intergenic
1148155871 17:45425122-45425144 GGGGCTCCTGGGACAGCCTGGGG + Intronic
1148326511 17:46786303-46786325 GGGGCTGCTGAGCAGGCCAGGGG - Intronic
1148636096 17:49150310-49150332 GGGGCTGCTGGCCAGGCGGGGGG - Intronic
1149578020 17:57727664-57727686 GGTGCTGCAGGGAAGGAAGGAGG + Intergenic
1149624979 17:58074140-58074162 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1149678553 17:58487980-58488002 GGTGGTGCTGGGCGGGCCGGGGG - Exonic
1149989009 17:61369998-61370020 GGGGCTCCTGAGAAGGCGGTGGG - Intronic
1150128524 17:62653730-62653752 GGGGCTGTTGGGGAGGAGGGAGG + Intronic
1150292146 17:63988172-63988194 AGGGCTGCTGAGGAGCCCGGGGG + Intergenic
1150738399 17:67759834-67759856 GGAGCTGCTGGGCAGGCAGTAGG - Intergenic
1151329617 17:73399135-73399157 GGGGCTGCTGGTCAGGCCCCAGG + Intronic
1151351482 17:73534589-73534611 AAGGCAGCAGGGAAGGCCGGTGG + Intronic
1151448298 17:74181523-74181545 GAGGCTGCTGGGTTGGCTGGGGG + Intergenic
1151928029 17:77213093-77213115 CCGGGTGCTGGGAAGCCCGGAGG - Intronic
1152020234 17:77776757-77776779 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1152020308 17:77776904-77776926 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1152068685 17:78124838-78124860 GGGGCGGCTGGGCAGGGCTGGGG - Intronic
1152079013 17:78175021-78175043 CGGCCTGCAGGGAAGGCAGGTGG + Intronic
1152212121 17:79008277-79008299 GGGGCTGCAGGGAGGGTCTGTGG + Intronic
1152310424 17:79546635-79546657 GGTACTGCTGGGAATGCCGGCGG - Intergenic
1152376616 17:79921924-79921946 GGTGCTGCGGGGAGGGCCGGCGG - Intergenic
1152376668 17:79922206-79922228 GGGGCTGGCGGGAAGGGCGGGGG - Intergenic
1152497178 17:80681495-80681517 GGGAGTGTAGGGAAGGCCGGTGG + Intronic
1152518213 17:80838493-80838515 GGAGCTGCCGCGAAGGCCCGGGG - Intronic
1152609389 17:81308182-81308204 GGGGGTGCTGGGAGGGCCCGAGG - Intergenic
1152633244 17:81420077-81420099 GGGGCTGCTGGCACGGCTGCTGG + Intronic
1152696088 17:81797753-81797775 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1152729213 17:81961490-81961512 GGGGCAGCTGGAAGGGGCGGCGG + Intronic
1152797535 17:82315566-82315588 GGCTCTGCTGGGAAGCCCTGGGG - Intronic
1152809603 17:82375322-82375344 CGGGCAGCGGGGGAGGCCGGGGG + Exonic
1152810269 17:82378578-82378600 GGGTCTGCTGGAAAAGCGGGGGG - Intergenic
1203171000 17_GL000205v2_random:147852-147874 GGGGCTGCTGGGGAGGCTGAGGG - Intergenic
1153265018 18:3261809-3261831 GGCGCGGCTGGGCAGGCCGCTGG - Intergenic
1153322090 18:3783605-3783627 GGGGCTGTGGGGAGGGCTGGAGG + Intronic
1153515227 18:5895614-5895636 GGGGGAGCGGGGAAGGCCGGCGG - Intronic
1154954807 18:21242848-21242870 GGGGGTGCCGGGCAGGCGGGCGG + Intronic
1155041556 18:22069372-22069394 TGGGCTGTTGGGAGGGTCGGAGG + Intergenic
1155238779 18:23846395-23846417 AGGGCTGCAGTGAGGGCCGGTGG - Exonic
1155964909 18:32026603-32026625 GGGGGTGCTGGGAGGGTCTGGGG - Intronic
1156317868 18:35987757-35987779 GGGGCTGGTGGGGAGGAGGGTGG + Intronic
1156326193 18:36077465-36077487 GGGGCGGCTGGTCAGGCGGGGGG + Intergenic
1156482487 18:37445012-37445034 GGGGCTGCTCGGAAAGGAGGAGG + Intronic
1157573046 18:48725513-48725535 GGGGGTGGTGGGAAGGCAGAAGG - Intronic
1157591495 18:48838901-48838923 GGGGCTGGTGGGCAGGCCCGGGG - Intronic
1157605606 18:48924196-48924218 GGAGCTGCTGGGAAGGAGGCGGG + Intronic
1157639872 18:49202915-49202937 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1157677251 18:49577772-49577794 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1158435942 18:57435667-57435689 GGGGCGGCGGGGGCGGCCGGCGG - Exonic
1158649724 18:59274089-59274111 GGCGCTGCGGGGAAGGAGGGAGG - Intergenic
1158775633 18:60575266-60575288 TGGGCTGCTGGGGAGGCCTCAGG - Intergenic
1159992702 18:74928771-74928793 GGCCCTGAAGGGAAGGCCGGAGG - Intronic
1160150171 18:76392485-76392507 AGGCCAGCTGGGAAGGCAGGTGG + Intronic
1160228412 18:77028726-77028748 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1160557893 18:79737995-79738017 GGACCTGCGGGGGAGGCCGGGGG - Intronic
1160574583 18:79845266-79845288 GAGGTGGCTGGGAAGGCAGGGGG + Intergenic
1160590903 18:79944185-79944207 GAGGCTGCAGGGAGGGCCTGGGG - Intronic
1160605488 18:80046587-80046609 GGGGCTGCTGGGCTGGCACGTGG + Intronic
1160605503 18:80046629-80046651 GGGGCTGCTGGGTCGGCACGTGG + Intronic
1160685893 19:436472-436494 TGGGCAGCTGGGAATCCCGGTGG - Intronic
1160708931 19:541884-541906 GGCGCTGCTGGGAACGTGGGCGG + Exonic
1160719889 19:592396-592418 GGGCTTGGGGGGAAGGCCGGTGG + Intronic
1160738946 19:677197-677219 GGGGCTGCAGGGATGGGGGGTGG - Intronic
1160739608 19:679892-679914 CGCTCTTCTGGGAAGGCCGGAGG - Intronic
1160820855 19:1057090-1057112 GGGGCTGCTTGGACGGGTGGGGG + Intronic
1160927891 19:1555815-1555837 GGGGCTGCTGGGCAGCGAGGTGG + Exonic
1160930209 19:1566836-1566858 CAGCCTGCTGGGCAGGCCGGCGG - Intronic
1160975245 19:1789793-1789815 GGGACTGCTGGCGAGGCCGAGGG - Intronic
1160997195 19:1888260-1888282 GGGGCTGCAGGGAAGATGGGAGG - Intergenic
1161002728 19:1919047-1919069 GGGCCTGCTGGGAAGCCAGGCGG + Intronic
1161040998 19:2110710-2110732 GGGGCAGCTGGAAAGGCACGGGG + Exonic
1161055295 19:2187978-2188000 GGAGCTGCGGGGAAGGCGGGAGG + Intronic
1161078597 19:2299213-2299235 GGTGCTGCCGGGGAGGCAGGAGG + Intronic
1161202688 19:3024820-3024842 GGGGCTGCAGGGATGGAGGGAGG - Intronic
1161284899 19:3463912-3463934 GGGGCTGGTGGAGAGGCTGGAGG - Intronic
1161299923 19:3537634-3537656 GGGGCTGCAGGGGAGGCTGTGGG + Intronic
1161303745 19:3555982-3556004 AGGGCTGTTGGGAGGGCAGGAGG - Intronic
1161321558 19:3643922-3643944 GGGGCTGCTGGGACCGCCCCAGG - Intronic
1161321657 19:3644248-3644270 AGGGCTGCAGGGAAGGGTGGGGG + Exonic
1161383208 19:3977375-3977397 GTGGCCGCTGGGCAGGACGGTGG + Intronic
1161453116 19:4357592-4357614 GGGGCTGTTGGGAGAGCCTGGGG + Intronic
1161575434 19:5052056-5052078 AGGGCTGCTGGGGAGGCCAGGGG + Intronic
1161677962 19:5663619-5663641 AGGGCTGCTGGCAGGGCAGGAGG + Intronic
1162031371 19:7918847-7918869 TGGTCTGCTGGGAAGGGAGGTGG + Intronic
1162113386 19:8413429-8413451 GGGCCTGCAGGTAGGGCCGGAGG + Intronic
1162454857 19:10777227-10777249 GGGGGTGCTGGGGAAGCAGGAGG + Intronic
1162697104 19:12484828-12484850 GGCGCCGCCGGGAAGGCGGGCGG - Intronic
1162806103 19:13138780-13138802 GGGGCTGCAGTGAGGGGCGGAGG - Exonic
1162967643 19:14163628-14163650 GGGGCAGCTGGGCAGGGCGTGGG - Intronic
1163182762 19:15615757-15615779 GGGGCTGCGGGAAACACCGGAGG - Exonic
1163622121 19:18367347-18367369 GGGTGTGGTGGGAAGGCTGGGGG + Exonic
1163637598 19:18444621-18444643 GGGGCTGCCCTGAAAGCCGGCGG + Exonic
1163905834 19:20149921-20149943 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1163945186 19:20529738-20529760 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1164066592 19:21721523-21721545 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1164066645 19:21721650-21721672 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1164066745 19:21721847-21721869 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1164081713 19:21865805-21865827 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1164081737 19:21865854-21865876 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1164105920 19:22107474-22107496 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1164106067 19:22107798-22107820 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1164192069 19:22926110-22926132 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1164192193 19:22926384-22926406 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1164839275 19:31380474-31380496 GGGGGTGCAGGGGAGGCAGGAGG - Intergenic
1165049542 19:33132626-33132648 GGGCGTGCTGGGGATGCCGGCGG + Intronic
1165192912 19:34079372-34079394 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1165306452 19:35005586-35005608 GAGGCTGCTGGGATGGCCCAGGG + Intronic
1165325893 19:35114704-35114726 AGGGTGGCTGGGAAGGGCGGGGG - Intergenic
1165433904 19:35786739-35786761 GGGGGTGCTGGGCTGGCGGGAGG - Intronic
1165436256 19:35797089-35797111 GGGTCTGATGGGAAGGGAGGTGG + Intergenic
1165758477 19:38307567-38307589 GGGGCTGGCGTGAAGGGCGGGGG + Intronic
1165764654 19:38343231-38343253 AGGGATGCTGGGAAGGTGGGAGG - Intronic
1165949257 19:39464779-39464801 GGGGCTGCAGGGTGAGCCGGTGG - Exonic
1166028467 19:40108515-40108537 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1166029956 19:40118425-40118447 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1166043824 19:40218031-40218053 GGGGCTGCTGGTGGGCCCGGGGG + Exonic
1166162782 19:40965843-40965865 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1166162934 19:40966194-40966216 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1166261608 19:41644839-41644861 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1166381899 19:42359079-42359101 GGGGCTGTTGGGGAGACGGGGGG - Exonic
1166425792 19:42676624-42676646 GGGGCGGCTGGCCAGGCAGGGGG + Intronic
1166994679 19:46714461-46714483 GGGGCTCCTGGGAAAGTGGGGGG + Intronic
1167268287 19:48493986-48494008 GCGGCTGGCGGGGAGGCCGGCGG - Exonic
1167330627 19:48853746-48853768 GGGGCTCCCGGGAGGGCCTGGGG - Exonic
1167502839 19:49857242-49857264 GGAGCTGCAGGGGAGCCCGGAGG + Intronic
1167716053 19:51143474-51143496 GGTGCTCCAGGGAAGCCCGGAGG + Intronic
1167768688 19:51500619-51500641 GGTGCTTCAGGGAAGCCCGGAGG - Intronic
1167970648 19:53186858-53186880 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1167970746 19:53187078-53187100 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1167970797 19:53187177-53187199 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1167970852 19:53187305-53187327 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1168115894 19:54221221-54221243 GGGGCTGCTGGCCAGGGCGCTGG + Exonic
1168118877 19:54240969-54240991 GGGGCTGCTGGCCAGGGCGCTGG + Exonic
1168185591 19:54697785-54697807 GGGGCTGCTGGCCAGGGCGCTGG - Intronic
1168237410 19:55071970-55071992 GGGGCTGCAGGGGTGGCCAGCGG - Intergenic
1168317773 19:55491522-55491544 GGAGCTGGTGGGAAGGAGGGAGG + Intronic
1168328358 19:55550238-55550260 GAGGCTGGTGGGCAGGACGGAGG - Intergenic
1168337670 19:55605617-55605639 GGGGCTGCCGGGGAGGGGGGAGG + Intronic
1168404371 19:56103108-56103130 GGGTCGGCTGGGAAGGCCTCTGG + Intronic
925036589 2:692089-692111 GGGGCTGATGGGGAGCCCAGGGG - Intergenic
925095206 2:1193048-1193070 GGGGCTGCTGAGGATGCCCGCGG + Intronic
925403172 2:3590412-3590434 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
925403274 2:3590638-3590660 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
925403322 2:3590736-3590758 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
926166025 2:10522538-10522560 GGGGGTGCTGAGGAGGCTGGCGG - Intergenic
926362672 2:12105215-12105237 CGGGCTGGTGGGAAGGCAAGAGG - Intergenic
926526916 2:13992337-13992359 GGGGCTGCTGTGAAGGTCTCTGG + Intergenic
926639517 2:15220008-15220030 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
927044540 2:19263557-19263579 GCGGTTGCTGGGAAGACCTGGGG - Intergenic
927181377 2:20448516-20448538 AGGGCTGCTGGGGAGGATGGGGG + Exonic
927596655 2:24403212-24403234 GGGGCTGGGGGGAGGGCGGGCGG - Intergenic
927833212 2:26370857-26370879 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
927833336 2:26371131-26371153 GGGGCGGCTGGGCTGGCGGGGGG + Intronic
927845892 2:26472829-26472851 GGGGAAGCTGCGGAGGCCGGTGG + Intronic
928002961 2:27539944-27539966 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
928005308 2:27557792-27557814 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
928109583 2:28495775-28495797 GGGTCTGCTGGGAAGAACGTGGG - Intronic
928200920 2:29247117-29247139 GGCGCTGCCGCGGAGGCCGGGGG - Intronic
928200937 2:29247170-29247192 GGCGCTGCCGCGGAGGCCGGGGG - Intronic
928542017 2:32293820-32293842 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
928557995 2:32447582-32447604 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
928585519 2:32754851-32754873 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
929447751 2:42014513-42014535 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
929614788 2:43298013-43298035 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
929690161 2:44067178-44067200 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
929690184 2:44067228-44067250 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
929739721 2:44588708-44588730 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
929739820 2:44588932-44588954 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
929739958 2:44589272-44589294 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
929768967 2:44875413-44875435 GGGCATGCTGGGAAGGCATGAGG + Intergenic
930054289 2:47240113-47240135 AGGGCTGCTGGGAAGGCTGTGGG + Intergenic
930079118 2:47433075-47433097 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
930201743 2:48555899-48555921 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
930201815 2:48556047-48556069 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
930201886 2:48556195-48556217 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
930202035 2:48556547-48556569 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
930439802 2:51391278-51391300 GCTGCTGCTGGGAAGGGAGGAGG + Intergenic
930445833 2:51471038-51471060 GCGGCTTCTGGGAAGGCAGCAGG + Intergenic
930941055 2:57014595-57014617 GTGGCTTCTGGGAAGGCCTCAGG - Intergenic
931230645 2:60371801-60371823 GGGGCTTCTGGGAAGGCTTTGGG + Intergenic
931656269 2:64512294-64512316 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
931783705 2:65601029-65601051 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
931811807 2:65861661-65861683 AGGGATCCTGGGAAGGCCAGAGG - Intergenic
932408331 2:71528958-71528980 GGGGCTGCCAGGAAAGCCTGTGG - Intronic
932415970 2:71574150-71574172 GAGGCCGGTGGGAAGGCTGGGGG - Intronic
932448520 2:71795046-71795068 GGGGGTGCTGGGAAGGTGGGGGG + Intergenic
932710726 2:74061396-74061418 GGGGCGGCTGGCAGGGCGGGGGG + Intronic
934559733 2:95306953-95306975 CAGGCTGCTGGGGAGGCGGGAGG - Intronic
934650082 2:96085648-96085670 GGGGCTGCTGAGAGGCCCTGGGG + Intergenic
934664815 2:96163048-96163070 GGGGCTGCTGGGGAAGTGGGGGG + Intergenic
935488966 2:103694034-103694056 GGGGCTGTTGGGAAGGGGTGGGG - Intergenic
935630586 2:105210573-105210595 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
936546280 2:113394686-113394708 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
937245698 2:120491246-120491268 TGGGGTGCTGGAAAGGCAGGTGG - Intergenic
937358799 2:121214622-121214644 GGGGCTGGTAGGGAGGCCTGTGG + Intergenic
937919509 2:127119861-127119883 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
937947520 2:127353580-127353602 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
937992710 2:127673478-127673500 GGAACCGCTGGGAAGGCAGGTGG - Intronic
938088904 2:128418803-128418825 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
938407984 2:131043340-131043362 GGCGCTGCAGGCAAGGCCAGGGG + Intronic
938534037 2:132221703-132221725 GGGGCGGCTGGCCAGGCAGGGGG - Intronic
938534135 2:132221928-132221950 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
939578414 2:143921964-143921986 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
940299231 2:152160709-152160731 GGGGCAGCTGGCCAGGCGGGGGG - Intronic
940299308 2:152160885-152160907 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
940643513 2:156368940-156368962 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
940643567 2:156369067-156369089 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
940643641 2:156369214-156369236 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
940652197 2:156451270-156451292 GGGGCAGCTGGCAGGGCGGGGGG + Intronic
940652246 2:156451397-156451419 GGGGCAGCTGGCAGGGCGGGGGG + Intronic
940652367 2:156451672-156451694 GGGGCAGCTGGCAGGGCGGGGGG + Intronic
941023897 2:160438994-160439016 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
941171692 2:162145893-162145915 GGGTATGCTGGGAAGGGAGGGGG - Intronic
941768811 2:169327194-169327216 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
941847825 2:170150038-170150060 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
941847925 2:170150292-170150314 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
942630327 2:177946063-177946085 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
942754097 2:179319610-179319632 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
942754150 2:179319737-179319759 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
943060545 2:183038151-183038173 GAGGCTGCTGCGAAGGCCGCGGG - Exonic
943198839 2:184792917-184792939 GGGGGTGGTGGGAAGGAGGGAGG - Intronic
943739894 2:191398173-191398195 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
944055177 2:195515773-195515795 GGGGCTTGTAGGCAGGCCGGCGG - Intergenic
944208322 2:197180481-197180503 GAGGCTGCAGGGAATGGCGGTGG - Intronic
944532855 2:200683486-200683508 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
944532908 2:200683612-200683634 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
944598471 2:201282923-201282945 GGGGCGGCTGGCCAGGCAGGGGG + Intronic
944598599 2:201283198-201283220 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
944598671 2:201283372-201283394 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
944732863 2:202534830-202534852 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
945110335 2:206356253-206356275 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
945110434 2:206356478-206356500 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
945110456 2:206356527-206356549 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
945110607 2:206356877-206356899 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
945233032 2:207610803-207610825 GGGGCGGCTGGCCAGGCGGGGGG - Exonic
945699522 2:213152199-213152221 GGGATTGGTGGGGAGGCCGGGGG + Intronic
945970236 2:216226276-216226298 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
945970309 2:216226424-216226446 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
946107560 2:217385156-217385178 GGGGCTGGTGGCAAGGGAGGAGG + Intronic
946305229 2:218853124-218853146 GGGGCTGCAGGGAAGCCCATTGG - Intergenic
946308806 2:218871617-218871639 GGGGGTGCCGGGCAGGCCGGAGG - Exonic
946318200 2:218931734-218931756 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
946331591 2:219012408-219012430 GGGGCTGCTGGGAAGGCAGAGGG + Intronic
946352610 2:219165216-219165238 CGGGCTGCTGGGAAGCCCCATGG - Exonic
946742652 2:222816527-222816549 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
946751093 2:222896305-222896327 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
947715141 2:232335551-232335573 GTGGGGGCTGGGAAGGCCCGTGG - Intronic
947729089 2:232418359-232418381 GGGGAGGCAGGGAAGGCCTGGGG - Intergenic
947741050 2:232485159-232485181 GGGGAGGCAGGGAAGGCCTGGGG - Intronic
947797942 2:232906179-232906201 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
947901363 2:233724314-233724336 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
948079277 2:235192136-235192158 AGGGAGGCTGGGAAGGGCGGCGG - Intergenic
948080311 2:235200273-235200295 GAGGGTGCTGGGAAGACTGGGGG + Intergenic
948317075 2:237036163-237036185 GGGGCAGCAGGGCAGGGCGGAGG - Intergenic
948479146 2:238239614-238239636 GGGGCTGCGGGGCGGGCGGGCGG - Intronic
948479915 2:238242848-238242870 GAGGCTGCTGTGAAGGAGGGAGG - Intergenic
948748060 2:240110071-240110093 GGGGCTGGAGGGAGGGCAGGAGG + Intergenic
948845619 2:240681574-240681596 GGGGCTGCAGGGAGAGCCAGGGG - Intronic
948848236 2:240693156-240693178 GGGGCTGCAGGGAGAGCCAGGGG + Intronic
948859849 2:240747505-240747527 GGGGCCCCTGGGCAGGCGGGTGG - Intronic
948901664 2:240959462-240959484 GGGGCTCCTGGGGATGCCAGAGG + Intronic
948922321 2:241071557-241071579 GGGGCTGCAGAGCAGGCAGGAGG - Exonic
949032073 2:241802044-241802066 GGGCCTGCTGGGGAGGAGGGCGG + Intronic
1168831623 20:848292-848314 AGGCCTGCAGGGAAGGCGGGAGG - Intronic
1168854961 20:1002030-1002052 GGCGCTGCGGGGCAGACCGGGGG - Intronic
1168878214 20:1185426-1185448 GCGGCCGCTGGGGAGGCGGGGGG + Intronic
1169085818 20:2824249-2824271 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1169085871 20:2824376-2824398 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1169085945 20:2824524-2824546 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1169086020 20:2824700-2824722 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1169086093 20:2824876-2824898 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1169208167 20:3751512-3751534 GGCCCTGCTGGCACGGCCGGAGG + Exonic
1169247056 20:4033061-4033083 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1169718325 20:8644715-8644737 GGGGCGGCTGGCAGGGCGGGGGG - Intronic
1170364987 20:15588357-15588379 GGGGCTGCTGTGAAGGTCTCTGG + Intronic
1170424867 20:16227499-16227521 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1170438060 20:16350518-16350540 GGTGGTGCTGAGAAGGCGGGAGG + Intronic
1170593114 20:17786295-17786317 GTGGGTGCTGGCAGGGCCGGTGG - Intergenic
1170885721 20:20338336-20338358 AGGGCTGCTGGAAAGTCAGGAGG - Intronic
1171130166 20:22644812-22644834 GGGGCTACTGTGAAGGCCTCTGG + Intergenic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1171366010 20:24625970-24625992 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1171381531 20:24737674-24737696 GGGGCTCCAGGGAAGTCAGGGGG - Intergenic
1171823195 20:29874214-29874236 GGGGCGGTTGGGAAGCACGGAGG - Intergenic
1171869564 20:30514235-30514257 GGGGCTGCAGGGGAGGGGGGAGG + Intergenic
1171957761 20:31473020-31473042 GGGGCTCCTGGGGAGGCTGCTGG + Intronic
1172051449 20:32121957-32121979 GGGGCGGCTGGCAGGGCGGGGGG + Intronic
1172051548 20:32122183-32122205 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
1172402226 20:34659439-34659461 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1172819491 20:37718616-37718638 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1173495233 20:43513850-43513872 GGCACTGCTGGGCAGGCCGAGGG - Exonic
1174218710 20:48936053-48936075 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
1174218811 20:48936275-48936297 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1174344969 20:49922507-49922529 GGGGCAGCTGGCCAGGCGGGGGG - Intergenic
1174878357 20:54250618-54250640 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1174878428 20:54250766-54250788 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1175175612 20:57109971-57109993 GGGGCTGGGGTCAAGGCCGGGGG - Intergenic
1175361386 20:58414299-58414321 GGGGCTGCTGGCCTGGCGGGGGG + Intronic
1175368364 20:58470714-58470736 CCGGCGGCTGGGGAGGCCGGGGG - Exonic
1175853683 20:62107416-62107438 GGGGCTCCTGGGAAGGCAGGGGG + Intergenic
1176137285 20:63529807-63529829 GAGGCTGCGGGGAAGGCCCCAGG - Intronic
1176326984 21:5509683-5509705 GGGGCTGCTGGGGAGGCTGAGGG - Intergenic
1176330724 21:5546528-5546550 AGGGCTGCTGGGGAGGCTGAAGG + Intergenic
1176348184 21:5770413-5770435 GGGGCGGCTGGCCAGGCTGGGGG + Intergenic
1176354998 21:5890997-5891019 GGGGCGGCTGGCCAGGCTGGGGG + Intergenic
1176397033 21:6274423-6274445 AGGGCTGCTGGGGAGGCTGAAGG - Intergenic
1176400773 21:6311268-6311290 GGGGCTGCTGGGGAGGCTGAGGG + Intergenic
1176436384 21:6677836-6677858 GGGGCTGCTGGGGAGGCTGAGGG - Intergenic
1176440124 21:6714681-6714703 AGGGCTGCTGGGGAGGCTGAAGG + Intergenic
1176460646 21:7004906-7004928 GGGGCTGCTGGGGAGGCTGAGGG - Intergenic
1176464386 21:7041750-7041772 AGGGCTGCTGGGGAGGCTGAAGG + Intergenic
1176484207 21:7386684-7386706 GGGGCTGCTGGGGAGGCTGAGGG - Intergenic
1176487947 21:7423529-7423551 AGGGCTGCTGGGGAGGCTGAAGG + Intergenic
1176496643 21:7554042-7554064 GGGGCGGCTGGCCAGGCTGGGGG - Intergenic
1176542505 21:8168483-8168505 GGGGCGGCTGGCCAGGCTGGGGG + Intergenic
1176561456 21:8351528-8351550 GGGGCGGCTGGCCAGGCTGGGGG + Intergenic
1176568273 21:8397645-8397667 GGGACGGCTGGGAAGGCCGGCGG + Intergenic
1176663208 21:9660130-9660152 GGGGCTTGTGGGCAGGCTGGCGG - Intergenic
1177177911 21:17719251-17719273 GGGGCTGCTGGCCGGGCAGGGGG + Intergenic
1177178143 21:17719785-17719807 GGGGCTGCTGGCCGGGCAGGGGG + Intergenic
1177178469 21:17720516-17720538 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1177839231 21:26218032-26218054 GGGGCTGCTGTGAAGACCTCTGG - Intergenic
1178075706 21:29011903-29011925 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1178414517 21:32393057-32393079 GGGGCTCGGGGAAAGGCCGGCGG + Intergenic
1178534816 21:33403114-33403136 GGGGCTCCAGGGAAAGCCCGGGG + Exonic
1178881028 21:36450208-36450230 GGGGATGCAGGGAAGGCAGGAGG - Intergenic
1178914739 21:36699944-36699966 GGGGACGCTGGGGAGCCCGGCGG + Intronic
1179440188 21:41388107-41388129 GGTGCTGCCGGGAAGGGCAGAGG - Intronic
1179460825 21:41533810-41533832 GGGGCTGCTGGGCATGGTGGGGG + Intergenic
1179616162 21:42584569-42584591 TGGACTGCTGGGAAGGACAGTGG + Intergenic
1179898772 21:44378074-44378096 GGACCTGCTGGGGAGGCTGGGGG + Intronic
1180039557 21:45268921-45268943 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1180039608 21:45269048-45269070 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1180125187 21:45785476-45785498 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1180739222 22:18041520-18041542 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1180898092 22:19351952-19351974 AGGGCTGCTAGAAAGGCTGGAGG + Intronic
1180955798 22:19740703-19740725 GGGCCCGCTGGGCAGGCGGGAGG - Intergenic
1181085579 22:20437964-20437986 GGGGCTGCGCGGAGGGGCGGTGG - Intronic
1181107265 22:20582691-20582713 CGGGCTGCGGGGACGGCTGGGGG - Exonic
1181301454 22:21883769-21883791 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1181301505 22:21883896-21883918 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1181315861 22:21970581-21970603 AGGGCTTCTGGAAAGGCAGGGGG - Intronic
1181511756 22:23392537-23392559 GGGGTTGCAGGGAAGGATGGAGG + Intergenic
1181538664 22:23561231-23561253 GGGGCGGCTGGCTGGGCCGGGGG + Intergenic
1181586239 22:23854918-23854940 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1181586368 22:23855193-23855215 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1181624767 22:24115793-24115815 GGGTGTGCTGGGAAGGCAAGTGG - Intronic
1181631794 22:24155563-24155585 GGGGCTGCAGTGAAGACCGCTGG - Intronic
1181657842 22:24317289-24317311 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1181657991 22:24317637-24317659 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1181792286 22:25277740-25277762 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1181804439 22:25366442-25366464 GGAGGGGCTGGGGAGGCCGGGGG + Intronic
1182343581 22:29643995-29644017 GGGGCGGCTGGCCTGGCCGGGGG + Intronic
1182417556 22:30231214-30231236 AGGGCTGCTGGGAAGACAGATGG - Intergenic
1182424437 22:30264651-30264673 GGGGCTGGTGGGATGCCCGTGGG + Intronic
1182539099 22:31027562-31027584 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1182616686 22:31592834-31592856 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1182796411 22:32994473-32994495 GGGGTTTCTGGGATGGCTGGAGG - Intronic
1182908319 22:33957707-33957729 TGGGCTTCTGGGAAGGCCCCAGG - Intergenic
1182982369 22:34684297-34684319 GGGGTGGCTGGCCAGGCCGGGGG + Intergenic
1183326742 22:37198698-37198720 CGGGCTGGTGGGACGGGCGGGGG - Intronic
1183373671 22:37449853-37449875 GGGGCTGCTAGGAAACCCCGTGG - Intergenic
1183379831 22:37485376-37485398 GGGGCTATCGGGAAGGCCGAAGG + Intronic
1183406010 22:37631020-37631042 CGGGCTGCTGCGGAGGCCTGGGG - Exonic
1183474900 22:38030795-38030817 GGTTGTGCTGGGAAGGCCTGGGG + Intronic
1183486357 22:38089381-38089403 GGGGCGGAAGGGCAGGCCGGGGG + Intronic
1183596926 22:38818398-38818420 GGGGGTGCTGGGCAGGAAGGAGG - Intergenic
1183638908 22:39081688-39081710 GGGGCAGGAGGGAAGGCAGGAGG - Intronic
1183720654 22:39559745-39559767 GGGGCTGCTGGCCTGGCTGGAGG + Intergenic
1183841426 22:40502008-40502030 GGGGCAGCTGGCCAGGCGGGGGG + Intronic
1183845587 22:40537779-40537801 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1183871470 22:40745013-40745035 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1183871570 22:40745210-40745232 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1183871623 22:40745337-40745359 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1183982969 22:41553310-41553332 GGGGCTGCTGCGATGGCCCGGGG - Intergenic
1183995651 22:41631118-41631140 GGGGCGGCTGGCAGGGCGGGGGG + Intronic
1184128139 22:42501785-42501807 GGGGCTGAAGGGAAGGCCAGGGG + Intergenic
1184136929 22:42555098-42555120 GGGGCTGAAGGGAAGGCCAGGGG + Intronic
1184202872 22:42981883-42981905 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1184333586 22:43840683-43840705 GCTGCTGATGGGAAGGCCCGAGG - Intronic
1184452301 22:44590482-44590504 GGGGCTGCGGGCAAGGCGGCTGG + Intergenic
1184671334 22:46013643-46013665 GGGGCCTCTGGGAAGGCGGAGGG - Intergenic
1184759972 22:46538339-46538361 CGGGTTGCGGGGAAGGCGGGGGG + Intergenic
1184988732 22:48153501-48153523 GGAGCTGGTGGCAAAGCCGGGGG + Intergenic
1185020847 22:48374028-48374050 GGGGATGCTGGGAAGCGTGGAGG - Intergenic
1185100336 22:48836879-48836901 GCGGCAGGTGGGAAGGGCGGGGG + Intronic
1185330515 22:50250186-50250208 AGGGCAGCAGGGAAGGCAGGGGG - Intronic
1203247445 22_KI270733v1_random:84901-84923 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1203247562 22_KI270733v1_random:85178-85200 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
949665271 3:6331742-6331764 GGGGCTGCTGGAAAGACCTCTGG - Intergenic
950047213 3:9955978-9956000 GGGGCCGCCTGGAAGGCCTGGGG - Intergenic
950092381 3:10305051-10305073 GGTGCTGGTGGGCAGGCCGATGG + Exonic
950183795 3:10932935-10932957 GGGGCTGCTGGGACCGCAGATGG - Intronic
950912089 3:16605275-16605297 GGGGCTGCTGTGAGGTCCGCTGG + Intronic
951013270 3:17704627-17704649 GGGGCTGCTGGCCAGGCGGGGGG + Intronic
951013444 3:17705028-17705050 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
951013489 3:17705125-17705147 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
951329366 3:21347393-21347415 GTGCCTGCTGGGAAGTCAGGTGG - Intergenic
952268084 3:31806212-31806234 GAGGCTGCTGGGAGGGCTGAGGG - Intronic
952435303 3:33267333-33267355 GGGGCTGCTGTGAAGACCTATGG + Intergenic
953526239 3:43691634-43691656 GGGGGTGCCGGGAAGGAGGGAGG + Intronic
953662080 3:44898776-44898798 GGGGCTGATGGGATTACCGGGGG + Intronic
954059487 3:48056450-48056472 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
954080826 3:48211774-48211796 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
954162927 3:48734747-48734769 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
954265127 3:49465753-49465775 CTGGCTTCTGGGAAGGCTGGTGG + Intergenic
954355984 3:50084381-50084403 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
954389312 3:50260491-50260513 GGGGCAGCAGGAAAGGCCCGAGG - Intergenic
954399282 3:50311420-50311442 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
954399457 3:50311823-50311845 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
954399603 3:50312144-50312166 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
954464558 3:50646872-50646894 GGGGCTGCCGGGCAGGAGGGTGG + Intronic
954483489 3:50823772-50823794 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
954599884 3:51859039-51859061 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
955297446 3:57747691-57747713 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
955405413 3:58622753-58622775 GAGGCTGCTGGGCAGGAGGGGGG + Intronic
956270392 3:67444022-67444044 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
956270531 3:67444346-67444368 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
957080358 3:75631522-75631544 CGGGCTGCTGGGGAGGCTGAGGG + Intergenic
957215727 3:77317660-77317682 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215755 3:77317729-77317751 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215784 3:77317798-77317820 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957215809 3:77317854-77317876 GGGGCTGCTGGGGGGGCTGCTGG + Intronic
957316764 3:78583412-78583434 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
957771095 3:84693226-84693248 GGGACTGCTGGGAGGCCAGGAGG - Intergenic
957906394 3:86561770-86561792 GGGCCTGCTGGGGAGGTGGGGGG - Intergenic
958013799 3:87914661-87914683 GGGGCTGCTGTGGAGGATGGGGG - Intergenic
959042790 3:101439735-101439757 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
959381094 3:105641921-105641943 GGGGCTGCTGTGAAGACCTCTGG + Intergenic
959415303 3:106073941-106073963 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
959415671 3:106074776-106074798 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
960019419 3:112932542-112932564 GGGGCTGCTGGGGAGGCCTGGGG - Intronic
960030018 3:113046521-113046543 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
960030066 3:113046648-113046670 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
960111498 3:113849899-113849921 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
960638966 3:119809542-119809564 GGGGGTGGGGGGAAGGCGGGGGG + Intronic
960862170 3:122164892-122164914 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
960893852 3:122480338-122480360 GGGGATGCTGACAATGCCGGAGG + Intronic
960937495 3:122912754-122912776 GGGGTTCCTGGGTAGGCCTGGGG + Intronic
961120397 3:124367439-124367461 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
961120677 3:124368068-124368090 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
961120700 3:124368117-124368139 GGGGCAGCTGGCCAGGCGGGGGG + Intronic
961163671 3:124750046-124750068 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
961163753 3:124750237-124750259 GGGGCAGCTGGCCAGGCGGGGGG + Intergenic
961222553 3:125212238-125212260 TGGGAAGCTGGGAAGGCTGGGGG + Intronic
961772493 3:129260268-129260290 TGGGCAGCTGGGAAAACCGGGGG - Intronic
961784453 3:129339868-129339890 GGGGCGGCTGGCAGGGCGGGGGG + Intergenic
961788664 3:129362432-129362454 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
961788944 3:129363112-129363134 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
961962535 3:130868385-130868407 TGGGCGGCTGGCCAGGCCGGGGG - Intronic
961962556 3:130868433-130868455 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
961962609 3:130868559-130868581 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
962023814 3:131526997-131527019 GGGGCTCCTGGGAAGGAGGCGGG - Intergenic
962112902 3:132471044-132471066 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
962244984 3:133784958-133784980 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
963089701 3:141471691-141471713 CTGGCTGCGGGGATGGCCGGGGG - Intergenic
963244484 3:143047151-143047173 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
963742656 3:149096124-149096146 GGGGCTGCTGGGGTGGGTGGTGG - Intergenic
963911284 3:150820304-150820326 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
963911356 3:150820451-150820473 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
963911479 3:150820725-150820747 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
965417925 3:168420420-168420442 GGGTCTTCTGGGAAGACAGGTGG + Intergenic
966015193 3:175132064-175132086 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
966414351 3:179673702-179673724 GGGGCTGCTGTGAAGGCTGCAGG + Intronic
966532428 3:180995769-180995791 GGGGATGCTGGGAAGCCAGAAGG + Intergenic
966783972 3:183608404-183608426 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
966784174 3:183608853-183608875 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
967176176 3:186864545-186864567 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
967912105 3:194550900-194550922 GGGGCTGCTGGGGAAGCCCTGGG + Intergenic
968130279 3:196189081-196189103 TGGGCTGCTGGGAGGGCCCGAGG + Intergenic
968276662 3:197445612-197445634 GGGCCTGCTGGGTAGGCAGAGGG - Intergenic
968392384 4:204195-204217 GGGACTGTTGGGAAGGCATGTGG + Intergenic
968411678 4:395835-395857 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
968411750 4:396010-396032 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
968411774 4:396059-396081 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
968599504 4:1502418-1502440 GGGGCTGCTGGGACTGCAGTGGG - Intergenic
968673008 4:1862509-1862531 GGGGCTGCGGGGGCGGCAGGAGG + Intergenic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968775348 4:2536732-2536754 GGAGCTGCGGGGCAGGCCGCTGG - Intronic
968803126 4:2756043-2756065 GGAGCAGCTGCGAAGGCAGGAGG - Exonic
968804504 4:2763639-2763661 GGAGCTGCGGGGAAGGGCAGCGG - Intergenic
968817492 4:2829507-2829529 GGGGGTGGTGGGTAAGCCGGTGG - Exonic
969056998 4:4408289-4408311 CAGGCTGCTGGGAGGGGCGGTGG + Intronic
969374795 4:6755997-6756019 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
969404211 4:6978079-6978101 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
970409562 4:15791686-15791708 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
970472588 4:16393187-16393209 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
970593711 4:17580585-17580607 GAGGCTGGTGGGAAGGCAGCTGG - Intronic
971300029 4:25434253-25434275 GGGGCAGCTGGGGAGGGAGGAGG + Intergenic
971743564 4:30551247-30551269 GGGGCTGCTGTGAAGGTCTCTGG - Intergenic
972265950 4:37459988-37460010 GGGGCTGTAGGGAGGGCAGGGGG - Intronic
972288291 4:37669017-37669039 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
972288315 4:37669066-37669088 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
972288371 4:37669197-37669219 GGGGCGGCTGGCCAGGCAGGGGG - Intronic
972538667 4:40020426-40020448 CTGGCTGCTGGGATGGCCGGGGG + Intergenic
973281371 4:48363723-48363745 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
973593675 4:52465517-52465539 GGGGTTGCTGGCCAGGCGGGGGG - Intergenic
974021169 4:56693464-56693486 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
974076618 4:57173376-57173398 GGGGCTGCTGGCCAGGCGGGGGG - Intergenic
974110842 4:57523788-57523810 GGGGCTGCTGGGAAGACCTCTGG - Intergenic
975042479 4:69762199-69762221 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
975042532 4:69762327-69762349 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
975254026 4:72213299-72213321 GGGGCTGCTATGAAGGTCTGTGG + Intergenic
975685939 4:76917681-76917703 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
975685992 4:76917808-76917830 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
975686063 4:76917956-76917978 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
975793631 4:77983821-77983843 GGGGCAGCTGGCCAGGCAGGGGG + Intergenic
976087844 4:81424501-81424523 GGGACTGCTGGGAAGGTGGGGGG - Intergenic
976246780 4:83012747-83012769 GGGGCTCCTGGGCGGGCTGGCGG - Intronic
976265692 4:83185507-83185529 GGGGCGGCTGGTCAGGCGGGGGG + Intergenic
976265812 4:83185779-83185801 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
976711372 4:88074923-88074945 GGAGGTGCTGGGAAGGCTGTTGG + Exonic
977556973 4:98496613-98496635 GTAGCTGCTGGGGAGGCCAGCGG + Intronic
977659244 4:99563709-99563731 GGAGCAGCTGGGTAGGCCGCGGG + Intronic
978123573 4:105110325-105110347 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
978774851 4:112495602-112495624 ATGGCTGCAGGGAAGGCAGGGGG - Intergenic
978875876 4:113639586-113639608 GGGGCATCAGGGAAGGCTGGGGG + Intronic
978947317 4:114515640-114515662 GGGGCTGGTGGGAAATCTGGAGG - Intergenic
979248307 4:118535339-118535361 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
981524300 4:145694609-145694631 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
982026045 4:151254927-151254949 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
982279092 4:153665833-153665855 GGGGCTGCTGTGAAGACCTCTGG - Intergenic
982370838 4:154631166-154631188 GGGGCTGCTGGGGAGGCAGCAGG - Intronic
982615698 4:157636611-157636633 GGGGCTGCTGGCCGGGCGGGGGG + Intergenic
982702383 4:158671561-158671583 GGCGCCTCTGGGAAGACCGGCGG - Intronic
982709572 4:158746392-158746414 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
982784483 4:159523943-159523965 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
982784753 4:159524565-159524587 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
983190317 4:164747406-164747428 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
983431837 4:167660140-167660162 GGGGCTGCTGTGAAGTCCTCTGG + Intergenic
983542865 4:168931383-168931405 AGGGCTGCTGGGAAGGTCTAGGG - Intronic
984695488 4:182775312-182775334 GGTGCAGCTGGGGAGGCTGGAGG + Intronic
984804032 4:183736485-183736507 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
984804157 4:183736778-183736800 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
985318865 4:188686915-188686937 AGAGCTGCTGTGAAGGCCGCAGG - Intergenic
985412115 4:189695919-189695941 GGGGCTTGTGGGCAGGCTGGTGG + Intergenic
985450562 4:190059693-190059715 CGGGCTGCTGGGGAGGCTGAGGG - Intergenic
985541314 5:488897-488919 GGGGCAGGTGGGAGGGCCGTTGG + Intronic
985614384 5:910781-910803 GGGGCTGCAGGAAGGGCCAGAGG - Intronic
985736540 5:1586468-1586490 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
985852357 5:2397964-2397986 GAGCCTGTTGGGGAGGCCGGGGG + Intergenic
986473363 5:8097723-8097745 AGGCCTGCTGGGAGGGCTGGCGG + Intergenic
986741885 5:10711966-10711988 TGTGTTGCTGGGAAGGACGGGGG - Intronic
987142466 5:14960127-14960149 GCGCCTGCTGGAAAGGCCTGAGG - Intergenic
987283714 5:16436278-16436300 GGGCCGGCAGGGATGGCCGGAGG - Intergenic
988004324 5:25388286-25388308 GGGGCTGCTGGTAATGCCCATGG + Intergenic
988544461 5:32142710-32142732 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
988552150 5:32208436-32208458 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
988589522 5:32536792-32536814 GGGGCAGCAGGGAAGGGGGGGGG - Intronic
988993455 5:36693027-36693049 GGGGCCGCTGGGAGAGCCCGCGG - Intergenic
989021411 5:37013147-37013169 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
989021460 5:37013274-37013296 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
989048471 5:37295887-37295909 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
989061457 5:37415437-37415459 GGGGCGGCTGGCCGGGCCGGGGG + Intronic
989282899 5:39665436-39665458 GGGGTTGCGGGGAACGCGGGGGG - Intergenic
989379752 5:40800656-40800678 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
989587608 5:43087428-43087450 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
989587732 5:43087701-43087723 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
989587884 5:43088051-43088073 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
990207640 5:53446839-53446861 GGGGCTGGGGGGAGGGGCGGCGG + Intergenic
990426981 5:55696677-55696699 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
991438042 5:66616274-66616296 GGGGCTGCTTGGGAGGTAGGGGG - Intronic
991907322 5:71525712-71525734 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
991910039 5:71551880-71551902 GGGGCAGCTGGCCAGGCGGGGGG + Intronic
992374008 5:76171947-76171969 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
992574681 5:78097296-78097318 GGGGCTGCTGGCCGGGCGGGGGG - Intronic
992978122 5:82139901-82139923 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
995123597 5:108559285-108559307 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
995193364 5:109341611-109341633 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
995193464 5:109341836-109341858 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
995193840 5:109342663-109342685 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
997874861 5:137538035-137538057 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
997892290 5:137687131-137687153 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
997930781 5:138070430-138070452 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
998012921 5:138709598-138709620 GGTGCTGCTGGGTGGGCTGGGGG + Intronic
998021737 5:138776778-138776800 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
998053729 5:139056656-139056678 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
998158062 5:139797192-139797214 GGGGCTGCTGGGAGGACAGCAGG - Intronic
998239277 5:140427349-140427371 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
998431616 5:142075256-142075278 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
998432031 5:142076140-142076162 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1000342577 5:160289145-160289167 GAGGCTGCTGGGTAGGAGGGAGG - Intronic
1000846921 5:166293144-166293166 GGGCCTGTGGGGAAGGCAGGGGG - Intergenic
1000985468 5:167859568-167859590 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1001109260 5:168882212-168882234 GGGGCTGCAGAGAAGGCTGCTGG + Intronic
1001393965 5:171403664-171403686 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1001773368 5:174311843-174311865 GGGGCTGCTGGAGGGGCGGGTGG + Intergenic
1001837751 5:174846007-174846029 TGAGCACCTGGGAAGGCCGGAGG - Intergenic
1002013864 5:176305542-176305564 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1002050679 5:176568855-176568877 GGGGGTGCTGGGAGGGCCCTGGG + Intronic
1002061299 5:176627514-176627536 GGGGCCGCTGGGAAGGCCAGAGG + Intronic
1002091763 5:176810417-176810439 GCGGCGGCTGGGAGGGGCGGGGG - Intergenic
1002093326 5:176817281-176817303 GGGGGTGGGGGGAAGGCCGGGGG + Intronic
1002309566 5:178306421-178306443 TGGGCTGCAGGGAAGGGAGGTGG + Intronic
1002373008 5:178769645-178769667 GGAGCCGCTGTGAAGGCTGGCGG + Intergenic
1002491031 5:179577579-179577601 GGGGCTGGAGGGGAGGGCGGGGG + Intronic
1002491050 5:179577631-179577653 GGGGCTGGAGGGGAGGGCGGGGG + Intronic
1002590985 5:180291741-180291763 GGGGCTTCGGGGCGGGCCGGGGG - Intronic
1003338137 6:5194345-5194367 GGGGATGCTGGGAGGGACTGTGG - Intronic
1003408112 6:5839716-5839738 GGGGCTCATGGGAAGACCGGAGG + Intergenic
1003854518 6:10259382-10259404 GAGGCTGCAGGGAAGGGCAGAGG + Intergenic
1004388145 6:15189147-15189169 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1004414848 6:15415572-15415594 GGGGCTGCTGGCCGGGCGGGGGG + Intronic
1004448704 6:15726212-15726234 AGGGCGGCTGGCCAGGCCGGGGG + Intergenic
1004565295 6:16790314-16790336 TTGGCTGCTGGGAAGGCCTCAGG + Intergenic
1005069580 6:21851504-21851526 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1005069721 6:21851825-21851847 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1005158804 6:22836663-22836685 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1005158856 6:22836791-22836813 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1005158982 6:22837095-22837117 GGGGCAGCTGGCCAGGCGGGGGG - Intergenic
1005837435 6:29719220-29719242 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1005837511 6:29719395-29719417 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1005920728 6:30398176-30398198 GGAGGTGCTTGGGAGGCCGGAGG - Intergenic
1005971332 6:30764156-30764178 GGGGCAGCTGAGAAGCCAGGTGG + Intergenic
1006039737 6:31244091-31244113 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006393322 6:33771621-33771643 GGAGCTGGCGGGAGGGCCGGTGG + Exonic
1006440961 6:34053406-34053428 GGGGCTGCTGGGAATGTTTGTGG - Intronic
1006492439 6:34397933-34397955 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1006623602 6:35383951-35383973 GGGGCTGCTGGCCTGGCGGGGGG - Intronic
1006623908 6:35384671-35384693 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1006623984 6:35384846-35384868 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1006839796 6:37021506-37021528 ATGGCTGCTTGGAAGGCCTGGGG - Exonic
1007174868 6:39888810-39888832 GGGGCTGTTGGGAAGGGGCGTGG - Intronic
1007285442 6:40744218-40744240 GGTCCTGCTGGGGAGGCCTGGGG + Intergenic
1007403180 6:41616452-41616474 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1007693622 6:43718237-43718259 GGGCAAGCTGGGCAGGCCGGAGG - Intergenic
1007834822 6:44666341-44666363 GGGCCTGGTGGGGAGGCTGGAGG + Intergenic
1008109594 6:47477997-47478019 GTGGCTCCTGGGGAGGCCAGGGG + Exonic
1008926291 6:56894459-56894481 GGGGCGGCTGGCCAGGCAGGGGG + Intronic
1008926464 6:56894832-56894854 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1008926517 6:56894959-56894981 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1010030342 6:71266241-71266263 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1010513328 6:76744885-76744907 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1011536906 6:88385578-88385600 GAGGCTGTTGGGGAGGCAGGGGG + Intergenic
1011557603 6:88586796-88586818 CAGGCAGCTGGGAAGGGCGGGGG - Intergenic
1011588398 6:88948320-88948342 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1012550961 6:100464572-100464594 GGGGCTGCTGGGCGGGCGCGGGG + Intronic
1012947833 6:105486825-105486847 TGGGGTGCTGGGAAGGACTGAGG - Intergenic
1013667387 6:112362518-112362540 CTGGCTGCCGGGATGGCCGGGGG - Intergenic
1014407415 6:121068882-121068904 GGGGCTGCTGTGAAGGTCTCTGG - Intergenic
1014556973 6:122849106-122849128 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1014763906 6:125388547-125388569 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1014763983 6:125388723-125388745 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1014764086 6:125388948-125388970 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1015476819 6:133665168-133665190 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1017215068 6:151899327-151899349 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1017660726 6:156670503-156670525 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1017843933 6:158240674-158240696 GGGGCAGCTGGCCAGGCGGGGGG + Intronic
1018240567 6:161770201-161770223 AGGGCTTTTGGGAAGGCTGGAGG + Intronic
1018762889 6:166906462-166906484 GGGGATGATGGGAAGGCAGTGGG - Intronic
1018828436 6:167424127-167424149 GGGGCTCCTGGGGAGGGCCGTGG + Intergenic
1018962086 6:168456336-168456358 GGGGCTGCAGGGCTGGCAGGTGG + Intronic
1019119646 6:169792778-169792800 GGGGAGGCCCGGAAGGCCGGGGG + Intergenic
1019309084 7:351438-351460 GGGGCTGCAGAGGAAGCCGGCGG + Intergenic
1019319893 7:410864-410886 GGGGCTGCAGGGAGGGCCATGGG - Intergenic
1019354221 7:570520-570542 GGGACTGCTGGGCAGGCAGTGGG - Intronic
1019361797 7:608741-608763 AGGGCTGTAGGGAAGGCTGGGGG + Intronic
1019361821 7:608806-608828 AGGGCTGTAGGGAGGGCCGGGGG + Intronic
1019361845 7:608871-608893 AGGGCTGTAGGGAAGGCCGGGGG + Intronic
1019361870 7:608936-608958 AGGGCTGTAGGGAGGGCCGGGGG + Intronic
1019361895 7:609001-609023 AGGGCTGTAGGGAGGGCCGGGGG + Intronic
1019408097 7:894424-894446 GGTGACGCTGGGAAGGCAGGCGG - Intronic
1019439286 7:1038492-1038514 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1019458804 7:1146390-1146412 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1019458933 7:1146687-1146709 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1019486931 7:1293652-1293674 GGGGCTGCGGGGACCTCCGGCGG + Intergenic
1019529914 7:1498324-1498346 GTGGCGTCTGGGGAGGCCGGTGG - Intronic
1019637883 7:2086104-2086126 GGGGCTGCTGGCCAGGAGGGAGG - Intronic
1019669034 7:2268126-2268148 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1019669345 7:2268917-2268939 GGGGCGGCTGGCCAGGCAGGGGG - Intronic
1019714878 7:2534177-2534199 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1019934267 7:4244141-4244163 GACTCTGCTGGGAAGGCTGGAGG - Intronic
1019981418 7:4624288-4624310 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
1019995517 7:4722053-4722075 GAGGCTGCTGGGATGGGTGGAGG - Intronic
1020616357 7:10465633-10465655 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1021567897 7:22032588-22032610 GGGCCGGCGGGGCAGGCCGGCGG + Intergenic
1021571974 7:22075119-22075141 GGGGATGCTGGGAAGGGTGTGGG + Intergenic
1021597234 7:22330269-22330291 GGGTCTGCTGGGAAGGATGTTGG + Intronic
1021672342 7:23046256-23046278 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1021735589 7:23637315-23637337 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1021735689 7:23637540-23637562 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1021872602 7:25019247-25019269 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1022028248 7:26468301-26468323 GGGGCTGCAAGGGAGGCCGGGGG + Intergenic
1022507679 7:30916689-30916711 GGAGCTGCTGGAAGGGCCGGGGG - Intronic
1022663482 7:32387607-32387629 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1023000458 7:35801924-35801946 GGCGCAGCCCGGAAGGCCGGTGG + Intronic
1023530644 7:41149824-41149846 GGGGCTGCTGGGTAGGGCTCCGG + Intergenic
1024300520 7:47884171-47884193 GGGGTTGGGGGGAAGGCGGGGGG + Intronic
1024538739 7:50459843-50459865 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1024972426 7:55082892-55082914 AGGGCTGCTGGGAACACCAGAGG - Intronic
1025103252 7:56151465-56151487 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1025103428 7:56151867-56151889 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1025502693 7:61324523-61324545 GGGGCTGGGGGGAAGGGTGGTGG + Intergenic
1025517563 7:61670745-61670767 GGGGCTGGGGGGAAGGGTGGTGG + Intergenic
1025541886 7:62099395-62099417 GGGGCTGGGGGGAAGGGTGGTGG + Intergenic
1025821585 7:64968169-64968191 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1025853026 7:65258656-65258678 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1025853210 7:65259057-65259079 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1025979291 7:66393757-66393779 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1025979339 7:66393855-66393877 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1026789809 7:73324348-73324370 GGGGCGGCTGGAGAGGCCCGCGG - Intronic
1026817200 7:73522145-73522167 GGGGCTGCTGGGAGGCGCGGCGG - Exonic
1026889589 7:73974189-73974211 TGGCCTGGTGGGCAGGCCGGGGG + Intergenic
1026894269 7:74000863-74000885 GGGGCTGCAGGGGAGGACGCTGG + Intergenic
1026941385 7:74289738-74289760 GGGGCTGCTGGAGGGGCCGAGGG + Intronic
1026983574 7:74540469-74540491 GTGGCTCCTGGGAAGGACGCTGG - Intronic
1027371247 7:77509614-77509636 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1027586534 7:80065595-80065617 GAGGCATCTGGGAAGGCCGCAGG + Intergenic
1028430738 7:90744617-90744639 GGGGCGGCTGGCTGGGCCGGGGG + Intronic
1028753448 7:94408791-94408813 GGGGCACCTGGGAAGCCTGGAGG - Exonic
1029112220 7:98218152-98218174 GAAGCTGCTGGGGAGGCAGGAGG + Intronic
1029113990 7:98228100-98228122 GGTGCTGCTGGCCAGGCCTGTGG + Exonic
1029429846 7:100523125-100523147 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1029549981 7:101232512-101232534 GGCGCTGCGGGGAGGGCCCGGGG + Exonic
1029568943 7:101358604-101358626 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1029569270 7:101359370-101359392 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1029611023 7:101626668-101626690 GGGCCCCCTGGGAGGGCCGGGGG - Intronic
1029692380 7:102190879-102190901 GGGGCTGATGGGACAGCAGGAGG - Intronic
1029834812 7:103297699-103297721 GGGGCTGCTGAACTGGCCGGGGG + Intronic
1029896609 7:103990058-103990080 GGGGCGGCAGGGACGGCCGCTGG + Intergenic
1030061063 7:105621740-105621762 GGAGCTGCTGGGAGGCCTGGAGG - Intronic
1030072831 7:105712250-105712272 GGGGCTGCTGTGAAGGTCTCTGG + Intronic
1030121248 7:106112414-106112436 GGGGCGGCTGGGGAGGCGAGGGG + Intronic
1030798901 7:113825045-113825067 GGGGCTGCAGGTAGGGCAGGAGG - Intergenic
1031528543 7:122850266-122850288 GAGGCTGCTGGGGAGTCCTGGGG - Intronic
1032084147 7:128874757-128874779 GGGGCTGCAGGGGAGCCCTGAGG + Intronic
1032482905 7:132261207-132261229 GGGGCTGCTGCAAAGGCTGAGGG + Intronic
1032569832 7:132985514-132985536 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1033237319 7:139648674-139648696 GGGGCTGATGAGAAGGGTGGGGG - Intronic
1033287706 7:140056843-140056865 GGGACTTCTGGTAAGGCTGGTGG - Exonic
1033323954 7:140362786-140362808 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1033808272 7:144979031-144979053 GGGGCTGAGGGGTAGGCAGGAGG + Intergenic
1034263936 7:149772629-149772651 GGAGCTGCTTGGGAGGGCGGCGG - Intronic
1034264023 7:149772863-149772885 GGGGCTGGAGGGAAGGGCGGGGG - Intronic
1034292716 7:149945593-149945615 GGGGCTGCTGAGAAGGTCTAGGG + Intergenic
1034638547 7:152585733-152585755 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1034638650 7:152585959-152585981 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1034813349 7:154151279-154151301 GGGGCTGCTGAGAAGGTCTAGGG - Intronic
1034961677 7:155367420-155367442 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1034961751 7:155367594-155367616 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1035157475 7:156925923-156925945 GGGGCCCCTGGCAAGGCCTGTGG + Intergenic
1035157488 7:156925962-156925984 GGGGCCCCTGGCAAGGCCTGTGG + Intergenic
1035157501 7:156926001-156926023 GGGGCCCCTGGCAAGGCCTGTGG + Intergenic
1035286334 7:157809682-157809704 GTGGCTCCTGGCAATGCCGGGGG - Intronic
1035726809 8:1829834-1829856 GAGGCTGCTGGGACGGCGGCAGG + Intronic
1036176259 8:6541094-6541116 GGGGTTTGTGGGAAGGCCTGAGG + Intronic
1038293737 8:26272276-26272298 GGGGCTCTTGGGAAGCCCTGTGG - Intergenic
1038595215 8:28881312-28881334 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1038595347 8:28881588-28881610 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1038704435 8:29880569-29880591 GGGCCTGCTGGGATGGGCAGTGG + Intergenic
1038744697 8:30246659-30246681 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1040069808 8:43179815-43179837 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1040296603 8:46152158-46152180 GGGGCTTCTGGGAAGGGAGAGGG + Intergenic
1040797351 8:51300402-51300424 GGGGCTGCTGTGAAGGTCTCTGG + Intergenic
1040818897 8:51534855-51534877 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1041070797 8:54125454-54125476 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1041676797 8:60547631-60547653 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1042049251 8:64686416-64686438 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1042303782 8:67311475-67311497 GGGGCGGCTGGCCAGGCGGGTGG - Intronic
1044833913 8:96277396-96277418 TGGGCTCCTGGGGAGGCCTGTGG - Intronic
1045325797 8:101116770-101116792 GGGACTGCTGGGTAGGTCAGTGG + Intergenic
1045991439 8:108313570-108313592 GAGGGTGCTGGGATGGCTGGAGG + Intronic
1046636541 8:116679420-116679442 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1046636642 8:116679645-116679667 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1046636839 8:116680087-116680109 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1047407257 8:124595925-124595947 GAGGCTGCTGGGGAGGCCTCTGG + Intronic
1047515122 8:125547198-125547220 GGGCCTGCTTAGAAGGCCGATGG + Intergenic
1047687557 8:127317092-127317114 GGGGCAGCTGGCCAGGCAGGGGG - Intergenic
1047782104 8:128118853-128118875 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1047847984 8:128826262-128826284 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1048276589 8:133070741-133070763 GGGTCTGCTGGCAAGACCAGAGG + Intronic
1048368540 8:133758053-133758075 GGGGCGGCTGGCCAGGCAGGGGG - Intergenic
1048881708 8:138877247-138877269 TGGGCTGCTGGGAAGAGCCGAGG + Intronic
1049009455 8:139877556-139877578 GGGTCTGATGGCAAGGCAGGAGG - Intronic
1049173248 8:141175020-141175042 TGGGCTGCAGGGAAGGCCCTGGG + Intronic
1049190048 8:141282291-141282313 GGGCCACCTGGGAAGGCAGGAGG - Intronic
1049326892 8:142026251-142026273 GAGGCTGGTGGGAAGGACTGGGG - Intergenic
1049367692 8:142248689-142248711 GGAGCTACTGAGAAGCCCGGAGG + Intronic
1049639344 8:143707606-143707628 GGGGCTGGTGGCCGGGCCGGGGG - Intronic
1049689979 8:143954085-143954107 GGGGCTGTGGGGTGGGCCGGGGG - Intronic
1049761736 8:144334722-144334744 GGAGGTGCTGGTGAGGCCGGAGG - Intronic
1051170639 9:14315534-14315556 GGGGCTGCGGGGCGGGCCGGCGG + Intronic
1051276908 9:15406747-15406769 GGGGCTGCTGGCCTGGCGGGGGG - Intergenic
1051822415 9:21182985-21183007 GGGGAGGCTGGGCAGGCTGGAGG + Intergenic
1051823651 9:21195040-21195062 GGGGAGGCTGGGCAGGCTGGAGG + Intergenic
1051825469 9:21213576-21213598 GGGGAGGCTGGGCAGGCTGGAGG + Intronic
1051827453 9:21235638-21235660 GGGGAGGCTGGGCAGGCTGGAGG + Intronic
1052492598 9:29188680-29188702 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1052492646 9:29188807-29188829 AGGGCGGCTGGCCAGGCCGGGGG + Intergenic
1052781206 9:32783373-32783395 GGGGCTGCTGGGAGCGGCCGGGG - Intergenic
1052858666 9:33423505-33423527 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1053161805 9:35818606-35818628 GTGGGAGCTGGGAAGGCCAGAGG + Intronic
1053162311 9:35821679-35821701 AGGCCTGCTCGGAGGGCCGGGGG + Intronic
1053457348 9:38242426-38242448 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1055137116 9:72840586-72840608 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1055137412 9:72841260-72841282 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1055138632 9:72851209-72851231 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1055138683 9:72851335-72851357 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1055242186 9:74197886-74197908 GGGGCGGCTGGCAGGGCGGGGGG - Intergenic
1055414167 9:76064161-76064183 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1055586156 9:77761285-77761307 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1055586403 9:77761861-77761883 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1055586504 9:77762085-77762107 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1055586579 9:77762260-77762282 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1055586656 9:77762436-77762458 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1055586680 9:77762485-77762507 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1055948431 9:81710700-81710722 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1056152729 9:83804584-83804606 GGGGCGGCTGGCCGGGCCGGGGG - Intronic
1056152753 9:83804634-83804656 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1056663540 9:88562318-88562340 GGGGCGGCTGGGAGTGCTGGAGG + Intronic
1056805910 9:89728818-89728840 GGAGCTGCCGGGAAGGCTGTAGG + Intergenic
1057154771 9:92830888-92830910 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1057154795 9:92830937-92830959 GGGGCGGCTGGCCGGGCCGGGGG + Intergenic
1057397053 9:94689665-94689687 GGGGCTGGTGGGAAGGCGGGAGG - Intergenic
1057909388 9:99005878-99005900 GGGTCTGCAGGGAAGGGCGATGG - Intronic
1058659787 9:107257306-107257328 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1059120973 9:111641188-111641210 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1059391893 9:114004479-114004501 GGGGCTGCTGGAGAGGCCAGGGG - Intronic
1059753668 9:117272389-117272411 GGGGCTGCTGTGAAGGTCTCTGG + Intronic
1060065085 9:120495990-120496012 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1060147886 9:121268065-121268087 GGGGCGGCCGGGCAGGCGGGTGG - Intronic
1060350138 9:122852417-122852439 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1060350283 9:122852769-122852791 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1060594579 9:124840514-124840536 GGGACAGCTGGGAGGGCAGGTGG + Intergenic
1060661687 9:125408454-125408476 CGCGCGGCTGGGAAGGCCCGAGG - Intergenic
1060682441 9:125577574-125577596 GGGGCGGCTGGCAGGGCGGGGGG - Intronic
1060687217 9:125623994-125624016 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1060960350 9:127676401-127676423 GGGGTTGCTGAGAAGCCGGGGGG + Intronic
1061150798 9:128826966-128826988 GGGGCTGCCGGGATGGGCCGAGG - Intronic
1061427128 9:130506550-130506572 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1061497461 9:130983130-130983152 GGAGCTGCTGCGAGGGCCGAGGG - Intergenic
1061579964 9:131530742-131530764 GGGTATGCTCGGAAGGCGGGAGG + Intronic
1061591341 9:131599633-131599655 GGGGAAGGTGGGACGGCCGGGGG + Intronic
1061908209 9:133709441-133709463 CGGGGTGCTGGGAAAGCCGGGGG - Intronic
1062289210 9:135787058-135787080 CTGGCTGCTGGGAGGGCTGGGGG - Intronic
1062494892 9:136827024-136827046 GGGGCTGGTGTGGAGGCCTGTGG + Intronic
1062507888 9:136887139-136887161 CTGGCTGCTGGGAGGGTCGGGGG + Intronic
1203431371 Un_GL000195v1:93798-93820 AGGGCTGCTGGGGAGGCTGAAGG - Intergenic
1203435133 Un_GL000195v1:130825-130847 GGGGCTGCTGGGGAGGCTGAGGG + Intergenic
1203463777 Un_GL000220v1:67961-67983 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1203463968 Un_GL000220v1:68413-68435 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1203662891 Un_KI270753v1:61635-61657 GGGGCTTGTGGGCAGGCTGGCGG + Intergenic
1203670479 Un_KI270755v1:7062-7084 GGGGCTTGTGGGCAGGCTGGTGG - Intergenic
1185578274 X:1190971-1190993 GGGGCTGGTGGGGAAGCTGGAGG + Exonic
1185777908 X:2820424-2820446 AGAGCTGGTGGGAAGGCTGGGGG + Intergenic
1186554311 X:10541333-10541355 GGGGGTGGTGGGAGGGCAGGGGG - Intronic
1186863036 X:13691845-13691867 GGTGCTGATGAGAAGGGCGGTGG + Intronic
1187449143 X:19381523-19381545 GGTCCTGCTGCGAAGGCTGGAGG + Intronic
1187997651 X:24946066-24946088 AGGGCTGCTGGGGAGGATGGGGG + Intronic
1188099692 X:26069309-26069331 GGGTCTGCTGGGGAGGACAGGGG - Intergenic
1188367555 X:29333510-29333532 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1188367577 X:29333559-29333581 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1188367728 X:29333903-29333925 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1188477252 X:30602686-30602708 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1189179891 X:38993648-38993670 GGGGCTGAAGGTAAGGCAGGAGG - Intergenic
1189210415 X:39278174-39278196 GGGGCGGCTGGCCGGGCCGGGGG - Intergenic
1189506094 X:41613019-41613041 GGGGCAGCTGGCCAGGCGGGGGG - Intronic
1189569982 X:42285689-42285711 GGGGCGGCTGGCCAGGGCGGGGG + Intergenic
1189837640 X:45040474-45040496 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1189837693 X:45040601-45040623 GGGGCGGCTGGCCAGGCGGGGGG + Intronic
1190108505 X:47574724-47574746 CGGGCTGCTGGGAGGTCTGGCGG + Exonic
1190680856 X:52826842-52826864 GGGGCGGCTGGCCAGGCGGGGGG + Intergenic
1190779139 X:53578689-53578711 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1190779240 X:53578914-53578936 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1191009935 X:55748795-55748817 GGGGCAGCTGGCCAGGCGGGGGG - Intronic
1191010105 X:55749198-55749220 GGGGCGGCTGGCCAGGCGGGGGG - Intronic
1191253330 X:58269493-58269515 GGGGCTGCCGGGAAGGCACTGGG + Intergenic
1191637416 X:63393364-63393386 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1192107091 X:68326915-68326937 GGGGCGGCTGGCCAGGCAGGGGG - Intronic
1192567776 X:72178922-72178944 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1192567848 X:72179069-72179091 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1192768707 X:74166966-74166988 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1193066334 X:77264626-77264648 GGGGCTGCTGTGAAGGTCAGTGG - Intergenic
1193234070 X:79085187-79085209 GGGGCCCCTGGAAAGGCCAGTGG - Intergenic
1194991858 X:100555489-100555511 GGGGCGGCTGGCCAGGCGGGGGG - Intergenic
1195094784 X:101492799-101492821 GGGGCTGGTGGCCAGGCTGGTGG + Exonic
1195217110 X:102712924-102712946 GGGGCGCCCGGGAAGGCCGTTGG + Intronic
1195221246 X:102746536-102746558 GGGGCTCCCGGGAAGGCCGGGGG + Intronic
1196004811 X:110824142-110824164 AAGGCTGCTGGGAAGGGAGGAGG + Intergenic
1196404258 X:115347235-115347257 GGGGCGGCTGGCCAGGCAGGGGG + Intergenic
1196888577 X:120270798-120270820 GGGTCTGCAGGGAGGCCCGGGGG - Intronic
1197736048 X:129850885-129850907 GGGGCTGCTGGCCGGGCGGGGGG - Intergenic
1198218603 X:134579317-134579339 TGGGCTGGTGGAAAGGCCTGAGG - Intronic
1198259573 X:134953760-134953782 GGGCCTGCTGGGGTGGCAGGGGG + Intergenic
1198458160 X:136837827-136837849 GGGGCTGATGGGAGGGCTTGGGG + Intergenic
1199515887 X:148675069-148675091 GGGGGTGCTGAGAAAGCCAGTGG + Intronic
1199772655 X:150984174-150984196 CGGGCGGCTCGGAGGGCCGGGGG + Intronic
1199992064 X:152993010-152993032 GGGGCTGCTGGTAGGGCAGAAGG + Intronic
1200090309 X:153632883-153632905 GGCTGGGCTGGGAAGGCCGGAGG + Intergenic
1200110582 X:153738781-153738803 GGGGCTCCTGGGAAGACTTGAGG - Intronic
1200137623 X:153882742-153882764 GGGGCAGCTGCGAGGGCCAGGGG - Intronic
1200146978 X:153931426-153931448 GGGACTGTTGGGAAGGGCGGTGG - Intronic
1200236978 X:154472462-154472484 GGGGCTGCGGGGGAGGACGGAGG + Intronic
1200346186 X:155451832-155451854 GGGGCTGCTGTGAAGACTGCTGG - Intergenic
1200742391 Y:6868228-6868250 AGGGCTGCTGGGCAGGCAGAGGG + Exonic
1200829455 Y:7676968-7676990 GGGGCTGGTGGCAGGGCCCGAGG - Intergenic
1201799152 Y:17935733-17935755 GGGGCTGCTGGACAGGGTGGCGG - Intergenic
1201802401 Y:17970223-17970245 GGGGCTGCTGGACAGGGTGGCGG + Intergenic