ID: 1083992884

View in Genome Browser
Species Human (GRCh38)
Location 11:66257760-66257782
Sequence GGGCTGCTGGGAAGGCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 513}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992871_1083992884 11 Left 1083992871 11:66257726-66257748 CCGAGGTAGCGGCTTCACCTTTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513
1083992866_1083992884 24 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513
1083992864_1083992884 26 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513
1083992870_1083992884 14 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513
1083992869_1083992884 20 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513
1083992867_1083992884 23 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513
1083992865_1083992884 25 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513
1083992878_1083992884 -6 Left 1083992878 11:66257743-66257765 CCTTTAAGGCGGCGCGGGGGCTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG 0: 1
1: 0
2: 4
3: 53
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992884 Original CRISPR GGGCTGCTGGGAAGGCCGGC GGG Intronic
900031126 1:373862-373884 GGGAGGCAGGGGAGGCCGGCTGG - Intergenic
900038839 1:440156-440178 GGGCTTCTGGATAGGCAGGCAGG - Intergenic
900060272 1:675132-675154 GGGCTTCTGGATAGGCAGGCAGG - Intergenic
900121033 1:1048837-1048859 GGGCGACCGGGAGGGCCGGCTGG - Intronic
900287394 1:1908343-1908365 GGGCTGCTGGAGAGGCCGCAGGG - Intergenic
900384471 1:2403484-2403506 CGGCTGCTGGGGAAGGCGGCTGG - Exonic
900436588 1:2633977-2633999 GGGCTGCTAGGACAGCCAGCGGG - Intergenic
900614164 1:3556991-3557013 GGGATGCGGGGAAGGCAGGAGGG + Intronic
900989800 1:6093114-6093136 GGGCTGATGGGAAGGAAGGAAGG - Intronic
901020803 1:6254427-6254449 GGCATGCTGGGAGGGCAGGCAGG - Intronic
901059203 1:6464334-6464356 GGGATGGAGGGAAGGGCGGCTGG - Intronic
901696635 1:11012713-11012735 CCGCTGCTGGGAAGCCCGACAGG - Exonic
901796832 1:11684413-11684435 GGGCGGCTGGGAAGGAAGGATGG + Intronic
902571923 1:17352509-17352531 GGGATGCTGGGAGTGCAGGCAGG + Intronic
902663510 1:17921696-17921718 GGGCTGCTGGAAAGACAGGGAGG - Intergenic
902684606 1:18067780-18067802 GGGCTCATGGGAAGGCCAGAGGG - Intergenic
902820074 1:18938331-18938353 CAGCTGCTGGGAAGGCTGGGAGG + Intronic
903184612 1:21622263-21622285 CGACTGCTGGGGAGCCCGGCCGG - Intronic
903469101 1:23573001-23573023 GGGATGCTGGGAAAGCCTCCTGG + Intergenic
903658533 1:24963347-24963369 GGGCTGGAGGGTAGGCAGGCAGG + Intronic
904121136 1:28198600-28198622 TGCCTGCTGGAAAGGCCGGGTGG - Intergenic
904537324 1:31208523-31208545 GGGGTGCTGTGAAGGCAGGTAGG - Intronic
904586018 1:31581074-31581096 TGGCTCGTGGGAAGGCCGGGAGG + Intronic
904792823 1:33036608-33036630 GGCCTGCGGGGAACGCTGGCCGG - Intronic
905795840 1:40816166-40816188 GGACATCTGGGAAGGCTGGCGGG + Intronic
905798918 1:40831067-40831089 CGGCTGCTGGCAGGGCAGGCAGG - Exonic
906246171 1:44275828-44275850 GGGCTTCTGGGGAAGCAGGCAGG - Intronic
906495412 1:46301824-46301846 GGCCTGCTGGGGAGGGGGGCAGG - Intronic
906680632 1:47723466-47723488 GGGCTGAGGGGAAGAGCGGCAGG + Intergenic
908152177 1:61313328-61313350 GGGCTTCTGGGAAGGCCTCAGGG + Intronic
908581114 1:65518357-65518379 GGTCTGCTGAGAAGGCCGAGGGG + Intronic
910516774 1:88070150-88070172 GAGCTGCTGGGAAAGCCAGCTGG + Intergenic
911087326 1:93989794-93989816 GGGCTGCAGGGAAGGCTGGATGG + Intergenic
912380656 1:109246449-109246471 GGCCTGCTGGGAAGGAGGGGTGG - Intergenic
912414393 1:109498241-109498263 GGGCTGGTGGGCGGGCGGGCAGG + Intronic
913599180 1:120406271-120406293 GGACTCCTGGGAAAGCCAGCAGG - Intergenic
913959510 1:143327773-143327795 GGGCTCCAGGGGAGGCCGGGTGG + Intergenic
914048103 1:144106619-144106641 GGGCGGCTGGGCTGGCTGGCTGG + Intergenic
914053869 1:144153346-144153368 GGGCTCCAGGGGAGGCCGGGTGG + Intergenic
914088197 1:144473349-144473371 GGACTCCTGGGAAAGCCAGCAGG + Intergenic
914125277 1:144813019-144813041 GGGCTCCAGGGGAGGCCGGGTGG - Intergenic
914131080 1:144858829-144858851 GGGCGGCTGGGCTGGCTGGCTGG - Intergenic
914310414 1:146460861-146460883 GGACTCCTGGGAAAGCCAGCAGG - Intergenic
914314770 1:146499894-146499916 GGACTCCTGGGAAAGCCAGCAGG + Intergenic
914499581 1:148233494-148233516 GGACTCCTGGGAAAGCCAGCAGG - Intergenic
914591695 1:149112281-149112303 GGACTCCTGGGAAAGCCAGCAGG + Intergenic
914681159 1:149939176-149939198 AGGCTGCTGGGAGGGGCAGCCGG + Exonic
915334073 1:155130385-155130407 GGGCTGGTGGGCAGTCAGGCTGG + Intronic
915345161 1:155193491-155193513 AGGCTGCTGGAAAGTCCGGCTGG - Intergenic
915522682 1:156457027-156457049 GGACTGCTGCGTAGGGCGGCGGG + Intergenic
915935756 1:160089442-160089464 GGGCTCCTGGGGAGGTCGGGGGG + Exonic
917468598 1:175306854-175306876 GTGCAGCTGGGAAGGACGGCAGG - Intergenic
918014319 1:180618213-180618235 GGACTAATGGGAAGGCGGGCAGG - Intergenic
918082715 1:181220138-181220160 AGACTGCTGGGGAGGCAGGCAGG - Intergenic
918356516 1:183710244-183710266 GGGGTGCGGGGGAGGCAGGCAGG - Intronic
920429908 1:205911858-205911880 GGGCTCCTGGGAAGGACTGGCGG + Intergenic
922171594 1:223160047-223160069 GGGCAGCTGGGCAGGACAGCAGG - Intergenic
922706646 1:227793965-227793987 GGACTCCTGGGAAGTGCGGCTGG - Intergenic
922720298 1:227896827-227896849 GGGCTGTTGCGAAGCCTGGCAGG - Intergenic
923630875 1:235649171-235649193 GGGCTGCTGGGGAGCCAGGAGGG + Intronic
923651149 1:235875205-235875227 ATGATGCTGGGAAGGCAGGCAGG + Intronic
1062854662 10:773904-773926 GCCCTGCTGGGGAGGGCGGCAGG + Intergenic
1063019595 10:2114510-2114532 GGGCTGCAGGAAAGGGGGGCAGG - Intergenic
1063133484 10:3197431-3197453 GGACTGCTGGGAAAGCGGCCGGG - Intergenic
1063371537 10:5525709-5525731 GAGCAGGTGGGAAGGTCGGCAGG - Exonic
1063622568 10:7662537-7662559 TAGCTGCTGGGAATGCCAGCCGG - Intronic
1064179247 10:13100387-13100409 GGGCCGCGGGGCAGGGCGGCGGG - Intronic
1064785972 10:18894749-18894771 GGCCTGCTGGGGAGGGTGGCAGG + Intergenic
1065069097 10:22003620-22003642 GGGCGGGTGGGTAGGCGGGCGGG + Exonic
1065204395 10:23343861-23343883 GGGCTCCGGGGCGGGCCGGCGGG + Intronic
1066250799 10:33631006-33631028 GGGGTGCTGGAAAAGCCGGAGGG + Intergenic
1067977489 10:51042665-51042687 GGACTGGTGGCAAGGCAGGCTGG - Intronic
1068779395 10:60903301-60903323 AGGAGGCTGGGAAGGCAGGCTGG + Intronic
1069664606 10:70146203-70146225 GGGCTGCAGGGGACGCCCGCGGG + Exonic
1069718413 10:70535089-70535111 GGGCTGCTGGCCAGGGCTGCAGG + Intronic
1069862510 10:71480463-71480485 AGGCTGCTCTGAAGGCCTGCTGG + Intronic
1069893452 10:71666194-71666216 GTGCTACTGGGAAGGGGGGCTGG - Intronic
1070002746 10:72393073-72393095 GGGCTGCTGGGAAGGGTAGAAGG + Intronic
1070780703 10:79135970-79135992 GGGAAGCTGGGAAGGCCGCTGGG + Intronic
1070808686 10:79286357-79286379 GGGCTGCTGTGGGGGCCTGCGGG + Intronic
1070814040 10:79312243-79312265 GGGCTGGTGGGAAGGCGGGAAGG - Intronic
1072615938 10:97048929-97048951 GGGCAGGTGGGCAGGCGGGCAGG + Intronic
1074232318 10:111549720-111549742 ATGCTGCTGGGAAGGCCTGAAGG - Intergenic
1074850379 10:117434665-117434687 AGGCTGCTGGGAGTGCCGCCAGG - Intergenic
1075102091 10:119513624-119513646 GAGCTGTTGGGCAGGCGGGCTGG + Intronic
1075200719 10:120401534-120401556 GGGCTGATGAGAAGGCAGACAGG + Intergenic
1075244676 10:120810592-120810614 GAGCTGTTGGGAAGGGCTGCAGG - Intergenic
1075556241 10:123434586-123434608 GGGTGGCTGGGAAGGCATGCGGG + Intergenic
1075615929 10:123891176-123891198 GGGAAGCTGGGCGGGCCGGCAGG + Intronic
1076064996 10:127441735-127441757 GGGGTGCAGGGGAGGCCCGCAGG - Intronic
1076304386 10:129454077-129454099 GGGCTGCTATGAAGGCCGGTGGG + Intergenic
1076675959 10:132147839-132147861 TGGCTGCCGGGGAGGCCGGCTGG - Intronic
1076683136 10:132185619-132185641 TGGGCGCTGGGAAGGCCGGGCGG - Intergenic
1076758949 10:132590421-132590443 GGGAGGCTGGGAAGTCAGGCTGG + Intronic
1076804242 10:132847222-132847244 GGGCTGCCCTGGAGGCCGGCGGG + Exonic
1077026722 11:442950-442972 GGGCTGCTGGGCTTGCCGGGGGG - Intergenic
1077100409 11:819934-819956 GGGCTGGCGGGAAGGCCGTGCGG + Intronic
1077164227 11:1127910-1127932 GGGCTGCTGTGAAGTGGGGCAGG - Intergenic
1077268861 11:1665834-1665856 GGGCAGAGGGAAAGGCCGGCAGG + Intergenic
1077271890 11:1685346-1685368 GGGCAGAGGGGAAGGCGGGCAGG - Intergenic
1077366223 11:2162403-2162425 GGGGAGCTGGGAGGGCCGGAGGG - Intergenic
1077442475 11:2575109-2575131 GGGCGGCTGGGAAGGCAGGCAGG - Intronic
1077483277 11:2826546-2826568 GGTCTGCTGGGGAGGCCTTCGGG - Intronic
1077505656 11:2928924-2928946 GGGCTGCGGGGATGGCCTGGAGG + Exonic
1078225234 11:9385264-9385286 GGGCTCCTGGGAATGCCGGCTGG + Intronic
1078758676 11:14234394-14234416 GGGCTGGTGGGATGGGAGGCAGG + Intronic
1079476874 11:20840461-20840483 GGACAGCTGGGCAGGCCAGCTGG + Intronic
1080407016 11:31988297-31988319 TGGCTGGTGGGAAGGCAGGGTGG + Intronic
1081595080 11:44453438-44453460 GGGCTGCTAGGAAGCCAGCCTGG + Intergenic
1081805505 11:45887831-45887853 GAGCAGCGGGGCAGGCCGGCAGG - Intronic
1081867502 11:46367590-46367612 GGGCTGATGGGAGGGAGGGCTGG + Intronic
1083644901 11:64166371-64166393 GGGCTGCGTGGAAGGCCCGGGGG - Intergenic
1083992884 11:66257760-66257782 GGGCTGCTGGGAAGGCCGGCGGG + Intronic
1084378118 11:68792381-68792403 GGGCTGCTTGGGAAGCTGGCTGG - Intronic
1084472622 11:69372052-69372074 GGGCGGCTGGGAAGGCCATCCGG + Intergenic
1084516506 11:69640769-69640791 GGACAACTAGGAAGGCCGGCAGG - Intergenic
1084900481 11:72306422-72306444 TGGATGCTGGGAAGGCTGGTAGG + Intronic
1085011747 11:73146166-73146188 GGGCTCCTGGGAAAACTGGCAGG + Intergenic
1089096378 11:115923233-115923255 GGGCTGCTGTAAAGGCAGGATGG - Intergenic
1089198615 11:116710197-116710219 GGGCAGCTGGGAAGCCCTGCGGG - Intergenic
1089555306 11:119312711-119312733 GGGCTGCTGGAAACTCCTGCTGG - Intronic
1090206568 11:124887559-124887581 GGGCTGGTGGGCAGGCCGGCAGG - Intronic
1090235142 11:125141474-125141496 AGGAGGCTGGGAAGCCCGGCCGG - Intergenic
1090257046 11:125292155-125292177 GGCCTGCTGGGGAGGCGGACTGG - Intronic
1090551234 11:127822192-127822214 TGGCTGCTGGAAAGCCCTGCTGG + Intergenic
1090773955 11:129946979-129947001 GGGCTGCAGTGAAGGCCAGGTGG + Intronic
1091126464 11:133103714-133103736 TGGCTGCTAGGAAGGCCTGTAGG - Intronic
1091178019 11:133579313-133579335 TGGAAGCTGGGAAGGCCGGGAGG + Intergenic
1091207745 11:133832998-133833020 GGACTGCGGGGAGGGGCGGCGGG + Intergenic
1091384418 12:83683-83705 AGGTTGATGGGAAGGCGGGCGGG + Intronic
1091780109 12:3208306-3208328 GGGCAGCTGGGAGGGCCAGGGGG + Intronic
1091874080 12:3919250-3919272 GGGCAGCAGGGAAGGACTGCAGG - Intergenic
1093536437 12:20229238-20229260 AGCCTGCTGGGCAGGCAGGCAGG - Intergenic
1094028679 12:25986146-25986168 GGGATGCTGGGAAGCTCGACTGG - Intronic
1094830928 12:34299925-34299947 GGGCTGCTGGGAAGGCACTTTGG - Intergenic
1096520351 12:52181382-52181404 GGGCTGCAGGGAAGGCATGGAGG - Intronic
1096682959 12:53269042-53269064 CGGCTGCTGGGAAAACCAGCTGG - Exonic
1097046165 12:56189224-56189246 GGGCTGCTTGGGAGGCCGCGGGG + Intronic
1100407752 12:94285885-94285907 GGGATGCTGAGAAGCCTGGCAGG - Intronic
1102029620 12:109732451-109732473 GGGCTGCTGGGCAGGCGGCCGGG - Intronic
1102220878 12:111193685-111193707 GGGCTGCGGGGGCTGCCGGCTGG + Intronic
1102933304 12:116878666-116878688 GTGCTGCTGGGAAGCCGAGCGGG + Intronic
1103363874 12:120368944-120368966 GGGCTCCGGGGAGGCCCGGCCGG + Intronic
1103393751 12:120592237-120592259 GGGTTGCTGGGATGGCAGGAAGG + Intergenic
1103486629 12:121287493-121287515 GGGCTGCAGGGCAGGCCACCTGG - Intronic
1103557619 12:121775771-121775793 GGGCTGCTGGGAAGGAGCCCGGG - Exonic
1103611444 12:122126602-122126624 GGGCTGGTGGCAAAGCAGGCAGG + Intronic
1103722913 12:122984122-122984144 TGGCGGCTGGGCAGGCAGGCGGG + Exonic
1103779272 12:123388748-123388770 GGGCTGGCGGGAGGGCGGGCGGG + Intronic
1103933877 12:124465144-124465166 AGGCAGCTGGGAAGGGTGGCTGG + Intronic
1104296832 12:127523510-127523532 GTGCTGCTGGGCTGGCCAGCTGG - Intergenic
1104656721 12:130579162-130579184 GGGCTGATTGCAAGCCCGGCTGG + Intronic
1104676353 12:130714718-130714740 GGTGTGAGGGGAAGGCCGGCGGG - Intronic
1104966066 12:132509314-132509336 TGGCCGCTGGGAGGGCTGGCAGG - Intronic
1105473475 13:20712097-20712119 GGGCTGGTGGGCAGGCCCCCTGG + Intronic
1105543970 13:21338664-21338686 GGGCTGATGGGAAGACAGGAGGG - Intergenic
1106942905 13:34796679-34796701 GGACTGTTGGGAAGGCAGGGAGG + Intergenic
1107657144 13:42603354-42603376 GGGAGGCTGGGAAAGCTGGCAGG + Intronic
1108448636 13:50536554-50536576 GGGTTGCTGGGCTGGCTGGCAGG + Intronic
1113951805 13:114076026-114076048 GTGCTGCTGGGAACGCCTGCCGG - Intronic
1114318353 14:21526382-21526404 GAGCTGCTGGGGAGGGAGGCGGG + Intronic
1115876881 14:37870843-37870865 GGGCTGCTGAGAAGGGGGGAAGG - Intronic
1116425406 14:44784505-44784527 GGGCTGCTAGGAAGGCCTCCTGG + Intergenic
1116426510 14:44798687-44798709 GGGCTGGCGGGGCGGCCGGCCGG - Intergenic
1118894080 14:69931327-69931349 GGGCAGCTGGGAAGACTGCCCGG - Intronic
1119265598 14:73261855-73261877 GGGCTGCTGGAATGGCAGGCTGG + Intronic
1120356181 14:83436810-83436832 GGCATGCTGGCAAGGCAGGCAGG + Intergenic
1121472114 14:94164112-94164134 GGGCTGCTGGGAAGGCGAGAGGG + Intronic
1121732629 14:96197239-96197261 GGGCTACTGGGATGGCCAGGTGG - Intergenic
1122388400 14:101364264-101364286 CGTTTGCTGGGAAGGCAGGCGGG - Intergenic
1122393548 14:101407145-101407167 GGGGTGCCGGGAAGGCAGGCTGG - Intergenic
1122405214 14:101496696-101496718 AGCCCGCTGGGAAGGACGGCTGG - Intergenic
1122716702 14:103700484-103700506 GAGCTGCTGGCAAGGCCCGTGGG - Intronic
1124713062 15:32030811-32030833 GGGCGGCGGGGGACGCCGGCAGG + Intronic
1125525180 15:40369889-40369911 GGGCTTCTGGTGAGGCTGGCAGG - Exonic
1125600362 15:40912354-40912376 GGGCTGCTGGGCGGGCCTGGTGG - Intergenic
1127060525 15:55178362-55178384 GTGCTGTTGGGAAGGCTTGCTGG - Intergenic
1127931367 15:63599687-63599709 GAGCTGCGGGGGAGGCTGGCAGG + Intronic
1128525658 15:68410660-68410682 GGGCAGAAGGGAAGGCTGGCTGG - Intronic
1128766175 15:70252536-70252558 GGGCTCCAGGGAGGCCCGGCAGG - Intergenic
1128788478 15:70415479-70415501 TGGCAGCTGGGAGGGCCGGGCGG - Intergenic
1131108585 15:89750601-89750623 GGGCTCCGGGGCAGGCAGGCGGG + Exonic
1131117530 15:89804152-89804174 GGGCTGCTGAGAAGGGAGGAGGG - Intronic
1132096072 15:98985889-98985911 GGGTAGCTGGGAAGGCTGCCTGG - Intronic
1132551534 16:555739-555761 GGGCTGCTGCGGAGGCCTGGAGG + Intergenic
1132553899 16:564442-564464 GGGCGGCTGGGCATGGCGGCTGG + Intronic
1132585884 16:705605-705627 GGGGTGCTGGACTGGCCGGCAGG + Exonic
1132621379 16:869769-869791 GGGCTGGTGGGGAGGGAGGCTGG - Intronic
1132633076 16:929142-929164 GGGCAGCTGGGAGGGATGGCTGG - Intronic
1132854752 16:2039698-2039720 GGGCTGCCTGGGAGGCCGGCTGG - Intergenic
1132883198 16:2171362-2171384 GGGGGGCTGGGAAGGGCGGCGGG - Intronic
1133415448 16:5603447-5603469 GAGCTGAGGGGAAGGCCAGCAGG + Intergenic
1133525617 16:6602570-6602592 GTGCTGCTGGGAGGCCAGGCGGG + Intronic
1133623147 16:7545478-7545500 AGGCTGCAGGGAAGGTCGGGGGG - Intronic
1134684734 16:16150541-16150563 GGGCTGCTGTGAGGTCAGGCCGG + Intronic
1135521456 16:23181801-23181823 GGGCGGGCGGGAAGGCAGGCAGG + Intergenic
1136448047 16:30335899-30335921 GCGCTGCTGGGTAGACAGGCTGG - Intergenic
1136542399 16:30935465-30935487 GGGCAGCAGGGAAGGCGTGCAGG + Intronic
1136551541 16:30984947-30984969 GGCCTCCTGGGAAGCCCAGCAGG + Exonic
1136567861 16:31080694-31080716 GGGGTGCAGGGAAGGCAGGTGGG + Exonic
1137033131 16:35543699-35543721 GGGGCGCTGGGGAGGCAGGCGGG - Intergenic
1137442902 16:48511242-48511264 GAGCTGCTGGGAACGCTGTCTGG + Intergenic
1137842255 16:51651327-51651349 GAGCTGCTGGCAAGGCTGCCAGG - Intergenic
1138112743 16:54337545-54337567 GGGATGCTGGGAAAGACAGCAGG - Intergenic
1138450922 16:57093006-57093028 GGACTGCGGGGAAGGGCGGGCGG + Intronic
1138519873 16:57564873-57564895 GGGAGGCTGGGAAGGCTGGGAGG + Intronic
1138591038 16:58000099-58000121 GGCCTGCAGGCAGGGCCGGCGGG - Intronic
1139443173 16:66979282-66979304 GGGGTGATGGGAAGGAAGGCAGG - Intergenic
1139750456 16:69106498-69106520 GGGCTGCAGGAACGGCCGCCGGG - Intronic
1139819836 16:69712549-69712571 AGGCACCTGGGAAGGCAGGCAGG + Intronic
1139940451 16:70601729-70601751 GGGCTGCTGGGAAACCCAGCAGG - Intronic
1139952204 16:70677941-70677963 GGGGCGCTGGGCAGGCGGGCAGG - Intronic
1140343468 16:74188614-74188636 GGGCTTCTGGGGAGGCCCCCAGG - Intergenic
1141285345 16:82666825-82666847 TGGATGGTGGGAAGGCAGGCTGG - Intronic
1141402731 16:83764659-83764681 GGGCCTCAGGGAAGGCAGGCAGG - Intronic
1141402745 16:83764729-83764751 GGGCCTCAGGGAAGGCAGGCAGG - Intronic
1141402758 16:83764799-83764821 GGGCTTCAGGGAAGGCAGGCAGG - Intronic
1141660860 16:85440806-85440828 GGGCTGCAGTGAAGCCAGGCAGG + Intergenic
1142173720 16:88635474-88635496 GGGCTGCAGGCCAGGCCGGGTGG - Intergenic
1142184361 16:88687386-88687408 GCCCTGCTGGGGAGGCAGGCCGG - Intergenic
1142224920 16:88872659-88872681 GGGCTGGCGGGAGAGCCGGCGGG - Intergenic
1142624979 17:1186283-1186305 TGGCTGCTGGAAAAGCCGGGAGG - Intronic
1142638396 17:1271292-1271314 GGGCTGCAGGGAGGCCGGGCTGG + Exonic
1142810902 17:2395106-2395128 GGCCTGCTGGGCAGGGGGGCAGG + Exonic
1142847352 17:2688601-2688623 GGGCTGCTGGGAAGTCTGAGAGG + Intergenic
1142851788 17:2707974-2707996 GGGCTGCTGGGAAGGGAAGATGG - Intronic
1143012488 17:3873529-3873551 GGGCTGCAGGAGAGGCCTGCAGG + Intronic
1143164572 17:4891542-4891564 GGGAGGCTGGGAAGGCAGCCAGG - Exonic
1143539253 17:7559552-7559574 GGAGGGCTGGGAAGGCAGGCTGG + Intronic
1143973260 17:10811302-10811324 GGGCTTATGGGAAGGCAGTCTGG - Intergenic
1144813920 17:18019933-18019955 GGGCTGGTGGGAAGCCAGTCTGG - Intronic
1144967976 17:19089596-19089618 GGGCGGGCGGGCAGGCCGGCAGG + Intergenic
1144979941 17:19162467-19162489 GGGCGGGCGGGCAGGCCGGCAGG - Intergenic
1144988281 17:19215765-19215787 GGGCGGGCGGGCAGGCCGGCAGG + Intronic
1146058838 17:29593990-29594012 GGGCTGCAGGGAGGGGCTGCGGG + Intronic
1146728638 17:35175425-35175447 GGGCAGCTGGTAAGGCCTCCTGG + Intronic
1147187792 17:38722082-38722104 GGGCTGTTGGGGGGGCTGGCAGG + Exonic
1147360601 17:39927402-39927424 GGGCTGCTGGGGAGGCGCCCCGG - Intronic
1147958116 17:44148939-44148961 GGGCTGCTGGGGTGTCCGGCTGG - Exonic
1147969454 17:44211819-44211841 GGGCAGCTGGGAAGTTGGGCTGG - Intronic
1148550085 17:48544933-48544955 GGGCTGCTGGGGGGGGCGTCAGG + Exonic
1148636095 17:49150309-49150331 GGGCTGCTGGCCAGGCGGGGGGG - Intronic
1148765424 17:50035983-50036005 GGACATCTGGGAAGGCTGGCTGG - Intergenic
1148865459 17:50626055-50626077 GGGCAGCCGGGAAGACCTGCTGG + Exonic
1149554729 17:57565305-57565327 GTGAGGCTGGGAAGGCCGGCTGG - Intronic
1149868211 17:60162134-60162156 GGGCCGCAGGGAGGGCAGGCAGG - Intronic
1150137463 17:62703746-62703768 GAGCAGCAGGGAAGGGCGGCAGG + Intronic
1150314665 17:64158426-64158448 GGGCTGCAGGGAGAGCCTGCAGG + Intronic
1150983306 17:70168653-70168675 TGGCTGCTGGGAAGGAGGGCTGG + Intronic
1151208388 17:72525354-72525376 AGGATGCTGGGGAGGCCCGCTGG - Intergenic
1151545252 17:74788921-74788943 GGGCTGCTGAGACCGCCTGCTGG - Intronic
1151718426 17:75843071-75843093 GGCCTGGTGGGGAGGCAGGCGGG + Exonic
1151928028 17:77213092-77213114 CGGGTGCTGGGAAGCCCGGAGGG - Intronic
1152118600 17:78404193-78404215 GGGCTGCTGGGAAGGTAGGAAGG - Intronic
1152376615 17:79921923-79921945 GTGCTGCGGGGAGGGCCGGCGGG - Intergenic
1152376667 17:79922205-79922227 GGGCTGGCGGGAAGGGCGGGGGG - Intergenic
1152574902 17:81135684-81135706 GGGCATCTGGGAAGGCTGCCTGG + Intronic
1152609388 17:81308181-81308203 GGGGTGCTGGGAGGGCCCGAGGG - Intergenic
1152700273 17:81815150-81815172 GAGCTGCTGGGAAGTGCTGCTGG + Intergenic
1152748574 17:82052183-82052205 GAGCTGCTGGGAGGGGAGGCGGG - Exonic
1152852917 17:82648223-82648245 GGGCTGCGGGAAGGCCCGGCCGG + Intronic
1153682309 18:7512107-7512129 CGGCTCCTGGGAACGCTGGCAGG + Intergenic
1154032768 18:10767751-10767773 AGGCTGCGGGGAAGGCTGTCTGG + Intronic
1154206674 18:12343423-12343445 GGGCTGCTGGGAATTGAGGCGGG - Intronic
1154954808 18:21242849-21242871 GGGGTGCCGGGCAGGCGGGCGGG + Intronic
1157591986 18:48841665-48841687 AGGCTGGTGGGCAGGCAGGCGGG + Intronic
1158435941 18:57435666-57435688 GGGCGGCGGGGGCGGCCGGCGGG - Exonic
1158443751 18:57500932-57500954 GGACTGCTGGGAAGGCCATCTGG + Intergenic
1158870936 18:61687536-61687558 GGGATTCTGGGAGGGCAGGCAGG - Intergenic
1160150172 18:76392486-76392508 GGCCAGCTGGGAAGGCAGGTGGG + Intronic
1160541502 18:79626336-79626358 GGGCTGGTGGGACGGCTGCCGGG + Intergenic
1160685892 19:436471-436493 GGGCAGCTGGGAATCCCGGTGGG - Intronic
1160693385 19:470664-470686 GGCCTGCTGGGAGGGGCGGCTGG - Intronic
1160708932 19:541885-541907 GCGCTGCTGGGAACGTGGGCGGG + Exonic
1160739607 19:679891-679913 GCTCTTCTGGGAAGGCCGGAGGG - Intronic
1160784447 19:892941-892963 AGGCTGCTGGGTAGGCGGCCTGG - Intronic
1160853721 19:1206564-1206586 GGGACCCTGGGGAGGCCGGCCGG - Exonic
1160930208 19:1566835-1566857 AGCCTGCTGGGCAGGCCGGCGGG - Intronic
1160949532 19:1658767-1658789 GGGCTGCAGGGATGGCTGCCTGG + Intergenic
1161032562 19:2064944-2064966 CTGCTCCCGGGAAGGCCGGCAGG - Intergenic
1161210301 19:3062252-3062274 GGGCTGCTGGGGGCGCCGGGCGG + Intronic
1161355851 19:3819285-3819307 GGAGTGCTGGGCAGGCGGGCAGG + Intronic
1161459013 19:4385532-4385554 GTGCTGCTGGGAGGGAGGGCAGG - Intronic
1161495357 19:4583434-4583456 GGGATGCTGGGGCGGCCGGAAGG - Intergenic
1161975619 19:7606517-7606539 GGGCTGCTGGAGAGGCTCGCTGG - Exonic
1161980569 19:7628115-7628137 GGGCTGGTGGGCAGGGCAGCTGG + Intronic
1162128150 19:8510613-8510635 GGGCTGCAGGGAAGGGGGGCTGG - Exonic
1162427010 19:10602829-10602851 GGGCGGCTCGGATGGCGGGCGGG + Intronic
1163156119 19:15440666-15440688 GGGGTGGTGGGGAGCCCGGCCGG + Intronic
1163446114 19:17347464-17347486 GGGCCCCAGGGAAGGCAGGCGGG - Intergenic
1163663974 19:18594573-18594595 GGGCTGCTGTGCAGGGCCGCGGG - Intronic
1163670158 19:18622914-18622936 GGGATGCTGGGAAGGACACCAGG - Intergenic
1165049543 19:33132627-33132649 GGCGTGCTGGGGATGCCGGCGGG + Intronic
1165100574 19:33436321-33436343 GGCCTGCTGGGAAGGCTGCCTGG - Intronic
1165325892 19:35114703-35114725 GGGTGGCTGGGAAGGGCGGGGGG - Intergenic
1165330336 19:35138463-35138485 GGGCTCCTGGGCAGTCAGGCTGG + Intronic
1165463410 19:35958152-35958174 GGCCTGGAGGGAAGGCTGGCAGG + Intergenic
1165764653 19:38343230-38343252 GGGATGCTGGGAAGGTGGGAGGG - Intronic
1165900363 19:39166817-39166839 CGCCTGCTGGGGAAGCCGGCAGG + Intronic
1166364839 19:42273084-42273106 GGGCTGCTCGCCAGGGCGGCCGG - Intronic
1166524920 19:43504791-43504813 GGGCTGCTGGGGAGGGGGACCGG - Exonic
1166553565 19:43683299-43683321 GGGATTCTGGGAAGCCTGGCAGG + Intergenic
1167001040 19:46746036-46746058 TGGCCGCCGGGACGGCCGGCGGG - Exonic
1167016184 19:46842585-46842607 GGGCAGCCGGAAAGTCCGGCTGG - Intronic
1167262987 19:48469486-48469508 TGGCGGCTAGGAAGGCCCGCGGG - Exonic
1167268286 19:48493985-48494007 CGGCTGGCGGGGAGGCCGGCGGG - Exonic
1168237409 19:55071969-55071991 GGGCTGCAGGGGTGGCCAGCGGG - Intergenic
1168288652 19:55346697-55346719 GGGCTGCTGGGATGGCAGGGAGG - Intronic
1168414459 19:56159721-56159743 GGGCCGCTAGGAAGGCGGGCAGG - Exonic
925479416 2:4253348-4253370 GGGCTGCTGGGTTGGCTAGCTGG - Intergenic
926056330 2:9776173-9776195 TGGCTCCGGGGAAGGCTGGCAGG + Intergenic
926166024 2:10522537-10522559 GGGGTGCTGAGGAGGCTGGCGGG - Intergenic
926251837 2:11159289-11159311 GGGCTGCTCAGGAGGCTGGCAGG + Intronic
927156703 2:20224991-20225013 GGGCTGCAGGGTCCGCCGGCTGG + Exonic
927181378 2:20448517-20448539 GGGCTGCTGGGGAGGATGGGGGG + Exonic
927596654 2:24403211-24403233 GGGCTGGGGGGAGGGCGGGCGGG - Intergenic
927990337 2:27442755-27442777 GGGCTGCTGGTGAGCGCGGCAGG + Exonic
929824834 2:45302005-45302027 CTGATGCTGGGAAGGCTGGCAGG - Intergenic
930237299 2:48900407-48900429 GGGCTGCTGGGGCTGCCGCCTGG + Intergenic
931811806 2:65861660-65861682 GGGATCCTGGGAAGGCCAGAGGG - Intergenic
932074718 2:68652009-68652031 GGGCTGCTGGGATGCCAGGAAGG + Intronic
932456438 2:71852583-71852605 GGGCTGCTCGGTAGGTTGGCTGG + Intergenic
932620166 2:73260452-73260474 GGTCTGCCGGGAAGGCCTGAAGG - Exonic
933958776 2:87395975-87395997 GGGCTCCTGGGCTGGCTGGCTGG - Intergenic
934242904 2:90287973-90287995 GGGCTCCTGGGCTGGCTGGCTGG - Intergenic
934242933 2:90288103-90288125 GGGCTCCTGGGCTGGCTGGCTGG - Intergenic
934568256 2:95352543-95352565 GGGCTGGGGGGAAGGCTGGTCGG - Intronic
937009686 2:118551444-118551466 TGGCTGCTGGCAAGGAAGGCTGG - Intergenic
937245697 2:120491245-120491267 GGGGTGCTGGAAAGGCAGGTGGG - Intergenic
937268591 2:120632983-120633005 GGGCTGCAGAGAAGGCCTGGTGG + Intergenic
938778225 2:134560488-134560510 GGGCTTCTGGGTAGCACGGCTGG - Intronic
941185616 2:162318494-162318516 GGGCAGGTGGGCAGGCGGGCAGG + Exonic
942049289 2:172123851-172123873 GGCCTGCTGGGGAGGGGGGCCGG - Intergenic
942681450 2:178480951-178480973 GGGCTGCTGAGAAGGCGGGTCGG + Intronic
943576091 2:189632754-189632776 AGGAGGCTGGGAAGGCGGGCAGG - Intergenic
944614484 2:201446385-201446407 GGGTTTCTGGGAAGGCCTGTTGG - Intronic
945972857 2:216247177-216247199 TGGATGCTGGGTAGGCCAGCTGG - Intergenic
946308805 2:218871616-218871638 GGGGTGCCGGGCAGGCCGGAGGG - Exonic
946312853 2:218892499-218892521 CAGCTGCTGGAAAGGCGGGCAGG + Intronic
946331592 2:219012409-219012431 GGGCTGCTGGGAAGGCAGAGGGG + Intronic
946352609 2:219165215-219165237 GGGCTGCTGGGAAGCCCCATGGG - Exonic
946462098 2:219877853-219877875 GAGCTGCAGGGAGGGCGGGCAGG + Intergenic
947471983 2:230409188-230409210 GAGCTGCTGGGAAGGTGGGTAGG + Intergenic
947741947 2:232488594-232488616 GGACTGATGGGAGGGCAGGCTGG + Intergenic
947871546 2:233441457-233441479 GGCATGCTGGGAAGGCTGGCAGG + Intronic
948477838 2:238231839-238231861 CCGCTGCTGGGAAGCCCGACAGG - Intergenic
948479145 2:238239613-238239635 GGGCTGCGGGGCGGGCGGGCGGG - Intronic
948659674 2:239499238-239499260 GAGCTGCTGGCCTGGCCGGCAGG + Intergenic
949032074 2:241802045-241802067 GGCCTGCTGGGGAGGAGGGCGGG + Intronic
1168854971 20:1002056-1002078 GGGTGGCTGGGCAGGGCGGCCGG - Intronic
1169673807 20:8132508-8132530 GGGAGGCCGGGGAGGCCGGCGGG + Intronic
1169729109 20:8767398-8767420 TGGCAGCTGGGAAGGGAGGCAGG - Intronic
1170764236 20:19276151-19276173 GGGCAGCTGGGAAGGCTTGGAGG - Intronic
1171187796 20:23135894-23135916 GGGCGGCTGGCAGGGCCTGCGGG + Intergenic
1173295306 20:41750183-41750205 AGGCTGCTGGGAAGGGCAGCAGG + Intergenic
1173522851 20:43712128-43712150 GGGCTCCTGGGCAGGGGGGCAGG + Intronic
1174048056 20:47747876-47747898 GTGCTGCTTGGAAGGTCGGCAGG - Intronic
1174118255 20:48242742-48242764 GTGCTGCTTGGAAGATCGGCAGG - Intergenic
1174176784 20:48650376-48650398 GGACTGCAGGGAAGGCCTGGAGG + Intronic
1175303421 20:57959227-57959249 GACCTGCTGGGAAGGCAAGCGGG - Intergenic
1175793826 20:61758765-61758787 GGCCTGCAGGGGAGGCGGGCAGG - Intronic
1175803117 20:61812340-61812362 GGGCTGCTGGGCCTGCCGGGTGG + Intronic
1176297614 21:5082675-5082697 GGGCTGCTGGGAGGGGCCTCCGG + Intergenic
1176430124 21:6570174-6570196 AGGCTGCTGGGGAGGCCAGAAGG + Intergenic
1176549341 21:8214608-8214630 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1176557234 21:8258831-8258853 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1176568274 21:8397646-8397668 GGACGGCTGGGAAGGCCGGCGGG + Intergenic
1176576176 21:8441866-8441888 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1178709358 21:34901171-34901193 GGGCTGCTGGGAACCCCTGAAGG + Intronic
1178904844 21:36628251-36628273 GGGCTGCCAGGAAAGCTGGCTGG + Intergenic
1178949876 21:36977591-36977613 GGGCTGCTGGGCAGGATGACTGG - Intronic
1179543475 21:42099544-42099566 GTGCTGCTGGGTAAGCGGGCAGG - Intronic
1179616163 21:42584570-42584592 GGACTGCTGGGAAGGACAGTGGG + Intergenic
1179705518 21:43177636-43177658 AGGCTGCTGGGGAGGCCAGAAGG + Intergenic
1179859415 21:44179274-44179296 GGGCTGCTGGGAGGGGCCTCCGG - Intergenic
1180791526 22:18577808-18577830 GGGCCGCTGGTAGGGCCGGCCGG - Intergenic
1180876507 22:19177597-19177619 GGACGCCAGGGAAGGCCGGCGGG - Intronic
1181064513 22:20299224-20299246 GCGCGGCTGGGAAGGCGGGTCGG + Intergenic
1181107264 22:20582690-20582712 GGGCTGCGGGGACGGCTGGGGGG - Exonic
1181230214 22:21417503-21417525 GGGCCGCTGGTAGGGCCGGCCGG + Intronic
1181248435 22:21517360-21517382 GGGCCGCTGGTAGGGCCGGCCGG - Intergenic
1181876404 22:25944105-25944127 GGGCTGCCCTGAAGGCAGGCAGG - Intronic
1182044573 22:27264216-27264238 GGGCTGGTGGAAAGGAAGGCAGG + Intergenic
1182417555 22:30231213-30231235 GGGCTGCTGGGAAGACAGATGGG - Intergenic
1182437781 22:30341667-30341689 AAGCTGCTGGGCAGGCCTGCAGG - Intronic
1182908318 22:33957706-33957728 GGGCTTCTGGGAAGGCCCCAGGG - Intergenic
1183265004 22:36819472-36819494 GGGCTGGTGGGAAGTCCTGTCGG + Exonic
1183404358 22:37623169-37623191 GGGCTCCTGGCAGGGCCTGCTGG + Intronic
1183406009 22:37631019-37631041 GGGCTGCTGCGGAGGCCTGGGGG - Exonic
1183457896 22:37932686-37932708 GAGCGGCTGGGAGGGCCTGCTGG + Intronic
1183601057 22:38840869-38840891 GGGCTGCTGTGAGAGGCGGCTGG + Intronic
1184128140 22:42501786-42501808 GGGCTGAAGGGAAGGCCAGGGGG + Intergenic
1184136930 22:42555099-42555121 GGGCTGAAGGGAAGGCCAGGGGG + Intronic
1184139531 22:42570622-42570644 GGGCCGCGGAGGAGGCCGGCAGG + Intronic
1184236676 22:43186873-43186895 GAGGTGCGGGGAAGGGCGGCGGG - Exonic
1184363180 22:44030882-44030904 GGCATGTTGGGAAGGCCAGCGGG + Intronic
1184392748 22:44214360-44214382 GGGATGCTGGGGTGGCCAGCTGG - Intronic
1184466302 22:44670345-44670367 GGATTGCTGTGAAGTCCGGCAGG + Intronic
1184492247 22:44816379-44816401 CGGCTGGTGGGAAGACAGGCAGG - Intronic
1184516454 22:44965581-44965603 GGGGTGCTGGGAAAGGAGGCAGG - Intronic
1184712752 22:46262842-46262864 GGGCCGCGGGGGAGGCCGGGCGG + Exonic
1185016571 22:48346664-48346686 CGGATGCTGGGGATGCCGGCAGG - Intergenic
1185148151 22:49150308-49150330 GGTCTCCTGGGAAAACCGGCAGG - Intergenic
1185244079 22:49763982-49764004 GGGCTGGTGGGGATGCCAGCAGG - Intergenic
1185255037 22:49827311-49827333 GGGATGCCGGGGAGGCCGGGCGG - Intronic
1185320088 22:50196618-50196640 TGGGTGCTGGGCAGGCAGGCTGG - Intronic
1203254226 22_KI270733v1_random:130924-130946 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1203262282 22_KI270733v1_random:176003-176025 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
949105796 3:198142-198164 GGGCTGCTGGGCGGGAAGGCGGG + Intronic
950944380 3:16929393-16929415 AGACTTCTGGGAAGGCGGGCAGG + Intronic
953890727 3:46750176-46750198 GGGCTGCTAGGGAGGCAAGCTGG + Intronic
954025502 3:47780416-47780438 GCGCGGCTTGGAAGGCCGGGCGG - Intronic
954147000 3:48639435-48639457 GAGGTGCTGGGAAGGCTGGCTGG + Intronic
954706628 3:52484478-52484500 GGGCGGGTGGGCAGGCAGGCAGG - Intronic
955977004 3:64489337-64489359 GGCTTGCTGGGGAGGCCTGCGGG - Intergenic
959267849 3:104167161-104167183 GGACTGTTGGGAAGGCTGGTTGG - Intergenic
960386101 3:117023741-117023763 GGGAAGTGGGGAAGGCCGGCCGG - Intronic
961305876 3:125958952-125958974 TGGCCGCTGGGAGGGCTGGCAGG - Intergenic
961537312 3:127577906-127577928 GGGCTGCTGGGAAAGGCAGACGG + Intronic
961654175 3:128432557-128432579 GTGGGGCTGGGAAGGCCAGCTGG + Intergenic
962369043 3:134805538-134805560 GTGCTGCTGGGCAGGAGGGCAGG - Intronic
965489131 3:169315218-169315240 GGGCAACTGAGAAGGGCGGCAGG + Intronic
966235352 3:177695490-177695512 GAGCTTGTAGGAAGGCCGGCTGG + Intergenic
966914851 3:184578968-184578990 CAGCTGCTGGGAAGCCAGGCTGG + Intronic
967980615 3:195063018-195063040 AGGCAGCTGGGAAGGTCCGCGGG + Intergenic
968041251 3:195591159-195591181 GTTCTGCTGGGAAGACTGGCAGG - Intergenic
968061546 3:195729793-195729815 GGGCTGCAGGGAAGACCCGCAGG + Intronic
968085595 3:195872602-195872624 GGGCTGTTGGGGAGGAGGGCCGG - Intronic
968130280 3:196189082-196189104 GGGCTGCTGGGAGGGCCCGAGGG + Intergenic
968952088 4:3700450-3700472 GGGCGGATGGGCAGGCCGACAGG + Intergenic
969056999 4:4408290-4408312 AGGCTGCTGGGAGGGGCGGTGGG + Intronic
969121684 4:4915584-4915606 GGGCTGCTGGGTCGGGGGGCAGG + Intergenic
969314210 4:6371876-6371898 GGGCTGGTGGGCGGGCAGGCAGG - Intronic
969471961 4:7394379-7394401 GGGTTGCAGGGAGGTCCGGCAGG + Intronic
976246779 4:83012746-83012768 GGGCTCCTGGGCGGGCTGGCGGG - Intronic
977554740 4:98477291-98477313 GAGCTGGTGGGAAGGGCAGCTGG + Intronic
980166978 4:129240877-129240899 GGGGAGCTGGGAAGCCAGGCTGG + Intergenic
980658952 4:135831098-135831120 GGGCTGCTGGGAGGCCAGGATGG - Intergenic
982865203 4:160501526-160501548 AGGCTGCTGGCATGGCAGGCTGG - Intergenic
983351493 4:166596631-166596653 GGGCTTCTGTGAAGGCTAGCAGG - Intergenic
984439297 4:179746377-179746399 CGGCTGCTGGGAAGGAGTGCAGG + Intergenic
984849916 4:184144318-184144340 GCACAGCTGGGAAGGCCAGCAGG + Intronic
986473364 5:8097724-8097746 GGCCTGCTGGGAGGGCTGGCGGG + Intergenic
986695711 5:10353339-10353361 GGGCTCTTCGGAAGGCCGGGAGG - Intergenic
987524453 5:19030073-19030095 GGCCTTCTGGGAAGGCCAGAAGG + Intergenic
988993454 5:36693026-36693048 GGGCCGCTGGGAGAGCCCGCGGG - Intergenic
989963281 5:50440904-50440926 GGGATGCTGGTAAGGGCGGGTGG - Intronic
990322711 5:54645568-54645590 GAGCAGCTGGGGAGGCCAGCAGG - Intergenic
998281008 5:140807574-140807596 GTGTTGCTGGGAACACCGGCGGG - Exonic
999303470 5:150505270-150505292 GGGCTAATGTGAAGGCAGGCTGG - Intronic
999386661 5:151158272-151158294 GGGAAGCAGGGAAGGCAGGCAGG + Intergenic
1000335666 5:160239423-160239445 GGGCGGCTGGGAAGGGGGGGCGG + Intergenic
1001748170 5:174108003-174108025 GGTCTGCAGGGTAGGCCCGCAGG + Exonic
1001837750 5:174846006-174846028 GAGCACCTGGGAAGGCCGGAGGG - Intergenic
1002061300 5:176627515-176627537 GGGCCGCTGGGAAGGCCAGAGGG + Intronic
1002309567 5:178306422-178306444 GGGCTGCAGGGAAGGGAGGTGGG + Intronic
1002433965 5:179220149-179220171 GGGCCGATGGAGAGGCCGGCAGG + Intronic
1002589888 5:180283198-180283220 TGGCTGCTGGGAAAGCTGCCAGG - Intronic
1002600676 5:180352721-180352743 GGGCTGCGGGGACGGCGGGGCGG + Intronic
1002735008 5:181378787-181378809 GGGCTTCTGGATAGGCAGGCAGG + Intergenic
1002742694 5:181445006-181445028 GGGAGGCAGGGGAGGCCGGCTGG + Intergenic
1002929743 6:1624940-1624962 GGGCAGCTGGGAGGGGCGCCTGG - Intronic
1003408113 6:5839717-5839739 GGGCTCATGGGAAGACCGGAGGG + Intergenic
1003548936 6:7084946-7084968 GGGCTGCTGGAACGCCAGGCTGG - Intergenic
1003618598 6:7677311-7677333 AGCCTGCAGGGAAGGCCAGCAGG - Intergenic
1005815964 6:29553268-29553290 CGGCTGCAGGGAAGGCCAGTCGG - Intergenic
1006319923 6:33314244-33314266 GGGCTGCTGGGTAGTCCAGGAGG - Intronic
1008316387 6:50047162-50047184 GGGCTACTGGGCAGGCCTGGAGG + Intronic
1010326268 6:74566377-74566399 GGGAGGCTGGGAAGGCATGCTGG - Intergenic
1011516990 6:88166050-88166072 GGGCTGCTGGCGAGGCGGGGTGG + Exonic
1017960515 6:159217065-159217087 GCGCTGCTGAGAAGGCAGCCTGG + Intronic
1018612901 6:165661686-165661708 GGGCGGCTCGGGAGGGCGGCGGG - Intronic
1018623060 6:165750446-165750468 GGGGTGCTGGGCAGCCCAGCTGG - Intronic
1018721267 6:166574313-166574335 GGGCTGCTGGGGAGGAGGGAAGG - Intronic
1018998520 6:168728226-168728248 GGGCTGCTGGAAAGATCTGCTGG - Intergenic
1019179200 6:170176409-170176431 GGGCGCCTGGGAAGGACGGGAGG + Intergenic
1019247829 6:170720745-170720767 GGGAGGCAGGGGAGGCCGGCTGG + Intergenic
1019298784 7:292653-292675 GGGCGGCCGTGAAGGCAGGCGGG + Intergenic
1019309085 7:351439-351461 GGGCTGCAGAGGAAGCCGGCGGG + Intergenic
1019361798 7:608742-608764 GGGCTGTAGGGAAGGCTGGGGGG + Intronic
1019361822 7:608807-608829 GGGCTGTAGGGAGGGCCGGGGGG + Intronic
1019361846 7:608872-608894 GGGCTGTAGGGAAGGCCGGGGGG + Intronic
1019361871 7:608937-608959 GGGCTGTAGGGAGGGCCGGGGGG + Intronic
1019361896 7:609002-609024 GGGCTGTAGGGAGGGCCGGGGGG + Intronic
1019486932 7:1293653-1293675 GGGCTGCGGGGACCTCCGGCGGG + Intergenic
1019917014 7:4140146-4140168 GGGCGGCAGAGAAGGCCTGCAGG - Intronic
1020009144 7:4799042-4799064 GGGCTGCTCGGAGGGGCCGCAGG - Intronic
1020434894 7:8152057-8152079 AGAGGGCTGGGAAGGCCGGCAGG - Intronic
1022113434 7:27244769-27244791 GGGCAGGTGGGAAGGGCGGCTGG + Intronic
1022331249 7:29381480-29381502 GAGCTGCTGGGAAGAAGGGCTGG + Intronic
1022683988 7:32577543-32577565 GTGGTGCTGGGAAGGCAGGTCGG + Intronic
1022737895 7:33093082-33093104 GGGCTGCAGGGGTGGACGGCTGG + Intergenic
1023346848 7:39279285-39279307 GGACACCTGGGAAGGTCGGCAGG - Intronic
1025671873 7:63620325-63620347 GGGCTGATGGGACCGCGGGCTGG + Intergenic
1026566875 7:71496557-71496579 GGGCTTCGGGGAAGGAGGGCAGG - Intronic
1026789808 7:73324347-73324369 GGGCGGCTGGAGAGGCCCGCGGG - Intronic
1026901676 7:74040752-74040774 GGGCTGCAGGGCAGGCTGGATGG + Intronic
1029419350 7:100464443-100464465 GGGCTGCTGTGAAGGACTGCAGG - Intronic
1029491253 7:100871523-100871545 GGCCTGTTGGGAAGGAAGGCAGG - Exonic
1030085266 7:105810477-105810499 CTGGTGCTGGGAAGGCTGGCTGG + Intronic
1032161794 7:129516594-129516616 GGGCTTCTGGGGAGGCCTTCAGG + Intergenic
1032174397 7:129611897-129611919 CGGCTGCGGGGCGGGCCGGCCGG - Intronic
1032359185 7:131239117-131239139 GGGGTGCTGGGGAGGGTGGCAGG + Intronic
1032594321 7:133224434-133224456 GGGCTCCTGGGAATGCAGGCTGG - Intergenic
1034137309 7:148782905-148782927 GGGCTGCGAGGGAGCCCGGCTGG - Intronic
1034263935 7:149772628-149772650 GAGCTGCTTGGGAGGGCGGCGGG - Intronic
1034958984 7:155352582-155352604 GGGCTGCTGTGAGGGCCGAGTGG + Intergenic
1035488726 7:159253201-159253223 GGGTTGCTGGGATGGCCCCCAGG - Intergenic
1035500288 8:87119-87141 GGGAGGCAGGGGAGGCCGGCTGG - Intergenic
1035748572 8:1979157-1979179 GATCTGCAGGGCAGGCCGGCAGG + Intronic
1036518064 8:9463952-9463974 GGGATGCTGGGAAGACCAGGTGG - Intergenic
1039859281 8:41442680-41442702 GGGCTTCTGAGATGACCGGCTGG - Intergenic
1039896403 8:41719565-41719587 GGGCCTGTGGGAAGGGCGGCAGG - Intronic
1040544990 8:48392173-48392195 GGGCCTCTGGGAAGACCTGCTGG - Intergenic
1040588159 8:48763999-48764021 GGGCTGCTGGGATGGGTCGCTGG - Intergenic
1041552410 8:59118025-59118047 GGGCTGCTGCGGAGTTCGGCTGG - Intronic
1041719083 8:60960261-60960283 AGGCAGCTGGGTAGGCAGGCAGG - Intergenic
1045207525 8:100057359-100057381 GGACTGCTGGGAAGGCACGATGG + Intronic
1045773348 8:105771699-105771721 GGGCAGCTTGGAAGGCAGGGTGG - Intronic
1045847794 8:106658064-106658086 GGGCGGCGGCGAAGCCCGGCAGG + Intronic
1047753645 8:127901247-127901269 GGGCTGCTGGAGGGGCTGGCTGG + Intergenic
1048879122 8:138858711-138858733 GGGTTGCTGAGCAGGCAGGCAGG + Intronic
1048881709 8:138877248-138877270 GGGCTGCTGGGAAGAGCCGAGGG + Intronic
1049158837 8:141084519-141084541 CTGCTGCTGGGAAGGCGAGCCGG + Intergenic
1049173233 8:141174953-141174975 GGGCGGCTGGAAAGGGCTGCGGG + Intronic
1049202485 8:141347135-141347157 GATCCGCTGGGAATGCCGGCAGG - Intergenic
1049244176 8:141552631-141552653 GGGCAGCTTGGAAGGGCAGCTGG + Intergenic
1049434239 8:142579154-142579176 TTGCTGCTGGGGCGGCCGGCAGG + Intergenic
1049510610 8:143024998-143025020 GGGCTGCTGGGCGGCCAGGCGGG + Intergenic
1049611259 8:143556686-143556708 GAGCGGCTGGGAGGGCCGGGTGG + Intronic
1049748346 8:144272424-144272446 GGCCCTCTGGGGAGGCCGGCTGG - Intronic
1050114847 9:2253106-2253128 GGTCTGCTGGGGAGGCCAGATGG - Intergenic
1051170640 9:14315535-14315557 GGGCTGCGGGGCGGGCCGGCGGG + Intronic
1053162312 9:35821680-35821702 GGCCTGCTCGGAGGGCCGGGGGG + Intronic
1057185469 9:93055233-93055255 TGGCTGCTGGTGAGGCAGGCCGG - Intergenic
1057215289 9:93224470-93224492 GGGGTGCTGGGAAGGGCCGTTGG + Intronic
1057314247 9:93958662-93958684 CGGCTGCTAGGGAGGGCGGCTGG - Intergenic
1057397052 9:94689664-94689686 GGGCTGGTGGGAAGGCGGGAGGG - Intergenic
1058065136 9:100540471-100540493 GGGCACTTGGCAAGGCCGGCTGG - Intronic
1058766971 9:108191135-108191157 AGGCTGCTGGGATGGCAAGCTGG + Intergenic
1059476150 9:114549576-114549598 GAGATGCTGGGAAGGCACGCAGG - Intergenic
1060661686 9:125408453-125408475 GCGCGGCTGGGAAGGCCCGAGGG - Intergenic
1061181686 9:129028273-129028295 GGGCAGGCGGGCAGGCCGGCAGG - Exonic
1061449506 9:130660733-130660755 GGGACGCTCGGAAGGGCGGCCGG - Intergenic
1061484438 9:130913206-130913228 GGAGGGCTGGGGAGGCCGGCTGG - Intronic
1061544784 9:131298422-131298444 GGGCTTCTGGGATGCCCTGCAGG - Intronic
1061592085 9:131604098-131604120 GGCCAGCTGTGAGGGCCGGCTGG - Intronic
1062212559 9:135372728-135372750 GGGCTGCTGGGAGGGGAGGCAGG + Intergenic
1062380740 9:136285449-136285471 GGGCAGGTGGGCAGGCGGGCAGG + Intronic
1203470627 Un_GL000220v1:114068-114090 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1203478448 Un_GL000220v1:158040-158062 GGACGGCTGGGAAGGCCCGGCGG + Intergenic
1203608601 Un_KI270748v1:76225-76247 GGGAGGCAGGGGAGGCCGGCTGG + Intergenic
1185587630 X:1252310-1252332 GGGGTGGTGGGAAGGTTGGCAGG - Intergenic
1185591834 X:1282518-1282540 GGCCAGCTGGGAAGGTCTGCAGG - Intronic
1187126052 X:16455467-16455489 AGGCTCCTGGGAGGGCTGGCAGG - Intergenic
1187281428 X:17860913-17860935 GGCCGGCTGGGAGGGCCGGGCGG - Intronic
1189999186 X:46668738-46668760 GGGCTGCAGGGAAGGGGGACTGG + Intronic
1190396863 X:49993856-49993878 GGGCAGCTGGGAAGCAGGGCAGG + Intronic
1190988621 X:55522793-55522815 AGGCTGCTGGGAAGGAAGTCTGG - Intergenic
1191040195 X:56069807-56069829 GGACTGCTGGGCAGGACCGCTGG - Intergenic
1192792774 X:74399564-74399586 GGGGTGCTGGGCCGGCCGGCTGG - Intergenic
1195221247 X:102746537-102746559 GGGCTCCCGGGAAGGCCGGGGGG + Intronic
1196214859 X:113038643-113038665 GGGCTGCTGGGGTGGGCGGTAGG - Intergenic
1197082679 X:122439046-122439068 ATGCTCCTGGGAAGGCAGGCTGG + Intergenic
1197654829 X:129105622-129105644 GGACTGGGGGGAAGGCGGGCTGG + Intergenic
1198473028 X:136966838-136966860 GGGCTCCTGGGAAGGCTTTCTGG + Intergenic
1200083997 X:153593943-153593965 GGGCAGCTCAGAAGGCTGGCCGG - Intronic
1200236979 X:154472463-154472485 GGGCTGCGGGGGAGGACGGAGGG + Intronic
1201799151 Y:17935732-17935754 GGGCTGCTGGACAGGGTGGCGGG - Intergenic
1201802402 Y:17970224-17970246 GGGCTGCTGGACAGGGTGGCGGG + Intergenic
1201904707 Y:19076955-19076977 TGTCGGCTGGGAAGGCCTGCAGG + Intergenic