ID: 1083992885

View in Genome Browser
Species Human (GRCh38)
Location 11:66257764-66257786
Sequence TGCTGGGAAGGCCGGCGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 349}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083992869_1083992885 24 Left 1083992869 11:66257717-66257739 CCGACGCCACCGAGGTAGCGGCT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349
1083992864_1083992885 30 Left 1083992864 11:66257711-66257733 CCCCCTCCGACGCCACCGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349
1083992878_1083992885 -2 Left 1083992878 11:66257743-66257765 CCTTTAAGGCGGCGCGGGGGCTG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349
1083992867_1083992885 27 Left 1083992867 11:66257714-66257736 CCTCCGACGCCACCGAGGTAGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349
1083992865_1083992885 29 Left 1083992865 11:66257712-66257734 CCCCTCCGACGCCACCGAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349
1083992871_1083992885 15 Left 1083992871 11:66257726-66257748 CCGAGGTAGCGGCTTCACCTTTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349
1083992866_1083992885 28 Left 1083992866 11:66257713-66257735 CCCTCCGACGCCACCGAGGTAGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349
1083992870_1083992885 18 Left 1083992870 11:66257723-66257745 CCACCGAGGTAGCGGCTTCACCT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG 0: 1
1: 0
2: 1
3: 28
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083992885 Original CRISPR TGCTGGGAAGGCCGGCGGGA TGG Intronic
900149862 1:1173646-1173668 TCCTGGGAGGGCCGGGCGGAGGG + Intergenic
900394070 1:2446022-2446044 TGATGGGCACGCCGACGGGAGGG + Intronic
900495355 1:2973686-2973708 GCCTGGGAAGGATGGCGGGATGG - Intergenic
900614165 1:3556995-3557017 TGCGGGGAAGGCAGGAGGGAAGG + Intronic
900785128 1:4644479-4644501 TCCTGGGAAGGGGGGTGGGATGG + Intergenic
901443342 1:9292745-9292767 TGCAGGGAAGGCCGGGGGCGCGG - Intergenic
901651126 1:10743768-10743790 TGACGGGAGGGCAGGCGGGATGG + Intronic
901654351 1:10760799-10760821 AGCTGGGAGGGCAGGTGGGATGG + Exonic
902609160 1:17587281-17587303 TGCTGGTAAGGCCGGGGGGAGGG - Intronic
902820076 1:18938335-18938357 TGCTGGGAAGGCTGGGAGGGAGG + Intronic
903140934 1:21338906-21338928 GGCTGGGAAGGCAGGAGGGTGGG - Intronic
904100352 1:28021266-28021288 TGCTGGGAAGGCAAGGGGGTTGG - Intronic
904245012 1:29181574-29181596 TGGTGGGGAGGCCGCGGGGACGG - Intronic
904492491 1:30869733-30869755 GGCAGGGAAGGCCTGGGGGAGGG + Intronic
904591418 1:31617631-31617653 GGGAGGGAGGGCCGGCGGGAGGG - Intergenic
904672901 1:32179631-32179653 TGCTGGGAAGGACGAAGCGAGGG - Intergenic
906530799 1:46522879-46522901 TGCTGGGCAGCCAGGAGGGAGGG + Intergenic
906693410 1:47808233-47808255 TGCAGGGCAGGCCAGCGGGCTGG - Intronic
908380467 1:63593282-63593304 TCCTGGCAGGTCCGGCGGGAGGG - Intronic
909042756 1:70673673-70673695 TGCAGGGTAGGCCGGCAGGCTGG - Intergenic
912068608 1:105779400-105779422 TGATGGGAAGGCTGCCGTGAAGG - Intergenic
912659579 1:111515851-111515873 AGCCGGGGAGGCCGGAGGGAGGG + Intronic
913211391 1:116585394-116585416 GGCTGGGAAGGGCGGGGGAAGGG + Intronic
914803064 1:150974486-150974508 GGCTGGGAAGGCCGCGGGGCCGG - Intronic
914918660 1:151833287-151833309 TGCTGGGGGGGCGGGGGGGAAGG - Intergenic
917521680 1:175752961-175752983 TGCTGGGAAGGGCCTTGGGAAGG - Intergenic
917790508 1:178496188-178496210 GGCTGGAGAGGCCGGCGGGAGGG - Intergenic
917813114 1:178679585-178679607 TGCTGGGAAGCTGGGCTGGATGG + Intergenic
918415614 1:184303831-184303853 AGCTGGGAAGGATGGTGGGAGGG - Intergenic
918651494 1:186969555-186969577 TGCTGGGAAGGCTAGTGGAAAGG - Intronic
920495649 1:206453313-206453335 TGGTGGGAAGGCCGGCACAATGG + Exonic
921709358 1:218357772-218357794 AGCTTGGAAGGCCTGAGGGACGG - Intronic
922416752 1:225428648-225428670 TGCTGGGACCGGCGGCGGGAGGG + Intronic
923171693 1:231422362-231422384 GGCCGGGAGGGCCGGGGGGAGGG + Exonic
923651151 1:235875209-235875231 TGCTGGGAAGGCAGGCAGGTGGG + Intronic
1063462220 10:6222016-6222038 TGGTGGGCAGGCTGGCAGGAGGG + Intronic
1063805886 10:9639862-9639884 TGGTGGGAAGGGTGGCAGGATGG + Intergenic
1064655106 10:17548937-17548959 TGCAGGGCAGGCCGGCAGGCTGG + Intergenic
1065300673 10:24318474-24318496 TGCTGGGAAGGTCAGCAGGATGG - Intronic
1065741389 10:28800237-28800259 TGCTGAGAAGTCAGGCGGGTGGG + Intergenic
1068269198 10:54697746-54697768 GGCAAGGAAGGCCGGCAGGAAGG + Intronic
1068983684 10:63087634-63087656 AGCTGGGCAGGCTGGAGGGATGG - Intergenic
1069037889 10:63664601-63664623 TGTTGGGAGGGGCGGGGGGAGGG + Intergenic
1069664607 10:70146207-70146229 TGCAGGGGACGCCCGCGGGACGG + Exonic
1070126394 10:73625720-73625742 TGCTGGGAGGTCCAGGGGGAGGG - Intronic
1071847438 10:89535404-89535426 TTCAAGGAAGGGCGGCGGGACGG - Intronic
1071948354 10:90673828-90673850 TGCTGGGCAGGCCAGCAGGCTGG + Intergenic
1072611347 10:97019361-97019383 TGCTTGGCAGGCAGGCGGGCGGG + Intronic
1072633220 10:97161201-97161223 TGCTGGGAAGGAGGGGAGGAGGG - Intronic
1075244675 10:120810588-120810610 TGTTGGGAAGGGCTGCAGGATGG - Intergenic
1076571365 10:131435404-131435426 TGCCGGGAGGGCCGGCGTGCGGG + Intergenic
1076831066 10:132994511-132994533 AGCGGGGAAGGCCGACGGGTGGG + Intergenic
1077227565 11:1445063-1445085 TGCTAGGAAAGGCGGGGGGAGGG + Intronic
1077303155 11:1856337-1856359 AGCTGGGAAAGCTGGTGGGATGG - Intronic
1077337750 11:2012968-2012990 TGCTGGGAAGAAGGGCAGGAGGG - Intergenic
1077358221 11:2128342-2128364 TGCTGGGCAGGCGGTGGGGAGGG - Intergenic
1077496672 11:2890037-2890059 AGCTGGGGAGGCAGCCGGGAAGG - Intronic
1077614885 11:3667494-3667516 TGCTGGGCATGCCGGCGCGGCGG - Exonic
1078999408 11:16738725-16738747 GGCTGGGAAGAGCGGCGAGAGGG + Exonic
1079076600 11:17388743-17388765 GGCTGGGAAGGCAGGCTGGGCGG - Intronic
1081705605 11:45180726-45180748 CGCCGGGAAGGCTGGCGAGAGGG + Intronic
1083457037 11:62786402-62786424 TGCAGGGAAGGGAGGCTGGAAGG - Intronic
1083595177 11:63915641-63915663 TCCAGGGAGGGCGGGCGGGAGGG + Intronic
1083992885 11:66257764-66257786 TGCTGGGAAGGCCGGCGGGATGG + Intronic
1084122688 11:67078437-67078459 TGCTGGGAAGGCAGAGGGCAGGG + Intergenic
1085423123 11:76380842-76380864 GGCTGGGCCGGCCGGCGGGCGGG - Exonic
1089660162 11:119980563-119980585 TGCTGGAAAGGTGGGTGGGAGGG + Intergenic
1089701368 11:120246022-120246044 AGCTGGGGAGGCAGGCGGGGAGG + Intronic
1090251689 11:125256079-125256101 TGCTGGGAAGACGGTGGGGATGG + Intronic
1090648558 11:128786685-128786707 TGCTGGGAAGGCCTCCGGCAGGG - Intronic
1091311760 11:134579906-134579928 TGTGGGGAAGGGTGGCGGGAGGG - Intergenic
1202820734 11_KI270721v1_random:68150-68172 TGCTGGGAAGAAGGGCAGGAGGG - Intergenic
1091582068 12:1796265-1796287 TGCTGGGAAGGCCGTGGGCCTGG - Intronic
1093536435 12:20229234-20229256 TGCTGGGCAGGCAGGCAGGAAGG - Intergenic
1094316166 12:29139169-29139191 GACTGGGAAGACAGGCGGGAGGG + Intergenic
1094330799 12:29290848-29290870 GGCTGGGAAGGCAAGTGGGAGGG + Intronic
1095509822 12:42938666-42938688 TGCAGGGAAGGGCGGGAGGAGGG - Intergenic
1095561550 12:43572044-43572066 GGCTGGGCCGGCCGGCGGGCGGG - Intergenic
1095584566 12:43836096-43836118 CGCTGGGAAGCGCGGCGAGACGG - Exonic
1096682957 12:53269038-53269060 TGCTGGGAAAACCAGCTGGAGGG - Exonic
1098521568 12:71439865-71439887 TGCTCCGAAGGCCGGCGTGGCGG + Exonic
1098897972 12:76084485-76084507 AGATGGGAGGGCCGGAGGGATGG - Intronic
1101618107 12:106357825-106357847 TGCAGGGAAGGCGGGCGCGGAGG + Exonic
1102029619 12:109732447-109732469 TGCTGGGCAGGCGGCCGGGCAGG - Intronic
1102651539 12:114445900-114445922 GGCTGAGAAGGCCGGGGGGGGGG + Intergenic
1103716276 12:122947212-122947234 TGGTGGGAAGGCCGGAAGCAAGG + Intronic
1103898647 12:124291739-124291761 TGCGAGGAAGGCCAGAGGGAAGG - Intronic
1104042450 12:125139347-125139369 CGCTGTGAAGGCTGGCGGCAAGG - Intronic
1104591014 12:130084714-130084736 TGCTGGGAAGGCCTGTAGCAGGG + Intergenic
1104736318 12:131137819-131137841 TGGTGGGCAGGCAGGCGGGTGGG - Intronic
1104981361 12:132574358-132574380 TGTTGGGAAGGCCCGTGGCAAGG + Exonic
1107145854 13:37059706-37059728 GGCGGGGAAGGCGGGCGGAAGGG + Intronic
1108037375 13:46305663-46305685 GGCTGGGAAGGGCGGTGGGGAGG + Intergenic
1109203808 13:59459740-59459762 TGCTGGGCAGGCAGTCTGGAAGG + Intergenic
1112849551 13:103688173-103688195 GGCTGGGAAGGCTAGAGGGAAGG - Intergenic
1113373189 13:109741039-109741061 TGCAGAGAAGGCTGGTGGGAGGG + Intergenic
1116628401 14:47297263-47297285 TGCTGGGAAGGAGGGCAGGTAGG + Intronic
1119333149 14:73810398-73810420 TGCTGGGATTGCAGGCGTGAAGG + Intergenic
1119721486 14:76894351-76894373 GGCTGAGAATGCCGGGGGGACGG - Intergenic
1119920453 14:78441439-78441461 TTCTGGGAAGGACAGTGGGAGGG - Intronic
1121310140 14:92931446-92931468 GGCTGGGGAGGCTGGCTGGAGGG - Exonic
1122661801 14:103301067-103301089 TGCTGAGAAGTCTGGCGGGAAGG + Intergenic
1123065460 14:105616834-105616856 TGCTGGGGAGGCAGGGGTGAGGG - Intergenic
1123069664 14:105636300-105636322 TGCTGGGGAGGCAGGTGTGAGGG - Intergenic
1123088757 14:105732083-105732105 TGCTGGGGAGGCAGGGGTGAGGG - Intergenic
1123094686 14:105761340-105761362 TGCTGGGGAGGCAGGGGTGAGGG - Intergenic
1123931249 15:25172744-25172766 TGCTGGGATCCCCGGCAGGAGGG + Intergenic
1124360364 15:29032448-29032470 TGCAGGGCAGGCCGGCAGGCTGG - Intronic
1124513610 15:30348084-30348106 TGGTGGGATGGCCTGCGAGAGGG - Intergenic
1124729311 15:32182681-32182703 TGGTGGGATGGCCTGCGAGAGGG + Intergenic
1126109410 15:45166938-45166960 AGGCGGGAAGGCTGGCGGGACGG - Intergenic
1127209805 15:56761832-56761854 TGCAGGGCAGGCCGGCAGGCTGG - Intronic
1127734043 15:61825312-61825334 TGCTGGGCAGCCTGGAGGGAGGG + Intergenic
1127880854 15:63157506-63157528 TGCTGGGAGGAGCGGCGGGGCGG + Exonic
1128554987 15:68625457-68625479 TGCTGGCAAGGCCTGGGGGTGGG - Intronic
1128768332 15:70264590-70264612 TGGTGGGTAGGCGGGAGGGAGGG + Intergenic
1132367014 15:101265049-101265071 TGAGAGGAAGGCCGGCTGGAGGG - Intergenic
1132713881 16:1281022-1281044 AGCTGGGAAGGCCTCCTGGAAGG + Intergenic
1132758390 16:1496993-1497015 TGATGAGGAAGCCGGCGGGAAGG - Intronic
1132832978 16:1938544-1938566 TGCTGGGAAGGCAGGCTGATGGG - Exonic
1132852282 16:2030201-2030223 TGCTGGGAAGGCCTGGGAGAGGG + Intronic
1133267345 16:4593131-4593153 TGCTGGGAAGGCTTCCTGGAGGG + Intronic
1136024315 16:27460295-27460317 TGTTGGCAGGGCCTGCGGGATGG - Intronic
1136551544 16:30984951-30984973 TCCTGGGAAGCCCAGCAGGAGGG + Exonic
1137898359 16:52238076-52238098 TGTTGGGGAGGGCGGCGGGGTGG + Intergenic
1138589479 16:57991903-57991925 TGCATGGCAGGCCGGTGGGAGGG + Intergenic
1139671101 16:68492931-68492953 TGCTGGGAGGTCCCCCGGGATGG + Intergenic
1140227943 16:73093707-73093729 TCCTGGGAACGCCGCCAGGAGGG - Intergenic
1141038480 16:80650962-80650984 GGCTGGGAAGGGCGGGGGGCGGG + Intronic
1141226022 16:82115863-82115885 TGCTGGGAAGGTGGCGGGGATGG - Intergenic
1141389090 16:83649550-83649572 TGCAGGGAAGGAGGGCAGGAAGG + Intronic
1142747438 17:1966929-1966951 TGCTGGGAAGGCCAGGGGCCAGG - Intronic
1143162609 17:4881360-4881382 GGCTGGGTAGACCGGAGGGAGGG - Intronic
1143539254 17:7559556-7559578 GGCTGGGAAGGCAGGCTGGCTGG + Intronic
1144584109 17:16477653-16477675 TGCTGGGAAGGCCCCTGGAAGGG - Intronic
1144778924 17:17798301-17798323 TGCTGTGATGGCCGGGAGGATGG + Exonic
1145208768 17:20998002-20998024 CTCTGGGAAGCCCGGCTGGAAGG - Intergenic
1145907617 17:28524888-28524910 TGCTGAGAAGCCAGGCAGGAAGG - Exonic
1149963284 17:61136060-61136082 CGCGGGGAAGGCAGGCGCGAAGG - Intronic
1150778718 17:68101876-68101898 GGCTGGGGCGGCGGGCGGGACGG - Intergenic
1150983308 17:70168657-70168679 TGCTGGGAAGGAGGGCTGGGAGG + Intronic
1151718429 17:75843075-75843097 TGGTGGGGAGGCAGGCGGGTGGG + Intronic
1151809749 17:76431696-76431718 AGCTGGGAAGCCCAGCGGGGGGG + Intronic
1151990837 17:77572946-77572968 TGCTGGGGAGGCTGGCAGGTGGG - Intergenic
1152310422 17:79546630-79546652 TGCTGGGAATGCCGGCGGATGGG - Intergenic
1152609386 17:81308177-81308199 TGCTGGGAGGGCCCGAGGGGAGG - Intergenic
1152740861 17:82017788-82017810 TGCTGGGGAGGCTGGCTGCAGGG - Intergenic
1152748572 17:82052179-82052201 TGCTGGGAGGGGAGGCGGGGCGG - Exonic
1152794304 17:82299320-82299342 CACAGGGCAGGCCGGCGGGAGGG + Intergenic
1153444512 18:5156183-5156205 TCCTGGGAAGGAAGGAGGGAGGG + Intronic
1153515226 18:5895609-5895631 AGCGGGGAAGGCCGGCGGCGTGG - Intronic
1154032769 18:10767755-10767777 TGCGGGGAAGGCTGTCTGGAAGG + Intronic
1154385312 18:13887306-13887328 TGCTGGGAAAGCCTCAGGGATGG + Intronic
1157591987 18:48841669-48841691 TGGTGGGCAGGCAGGCGGGCAGG + Intronic
1157617460 18:48995583-48995605 AGCTGGTGAGGACGGCGGGAAGG + Intergenic
1157723551 18:49945082-49945104 TTCTGGGAAGGGCGCCGGGCAGG - Intronic
1160150174 18:76392490-76392512 AGCTGGGAAGGCAGGTGGGAAGG + Intronic
1160150225 18:76392630-76392652 TGGAGGGAGGGCAGGCGGGAAGG + Intronic
1160256091 18:77250073-77250095 TGCGGGGAAGCGCCGCGGGAAGG + Intergenic
1160630715 18:80245377-80245399 TGCTGTGAAGGGCAGCAGGAAGG + Intronic
1160676496 19:394052-394074 TGATGGGAAGGATGACGGGAAGG + Intergenic
1160676523 19:394151-394173 TGATGGGAAGGATGACGGGAAGG + Intergenic
1160676938 19:395994-396016 TGATGGGAAGGACGACGGGAAGG + Intergenic
1160695405 19:481556-481578 TGATGGGAAGGATGGTGGGAAGG + Intergenic
1160763731 19:798020-798042 GGCTGGGGCGGCCGCCGGGAGGG + Intronic
1160791297 19:924990-925012 TGCAAGGAAGGCGGTCGGGAGGG - Intergenic
1160998341 19:1895604-1895626 TGCAGGGAAGGTCGCTGGGAGGG - Intergenic
1161165154 19:2782974-2782996 TGGTGGCGAGGACGGCGGGAGGG - Intronic
1161355853 19:3819289-3819311 TGCTGGGCAGGCGGGCAGGTGGG + Intronic
1161715560 19:5874293-5874315 TGGTGGGAAGGAAGGCGGGAAGG - Intronic
1162481090 19:10927603-10927625 GGCTGGGGAGGCAGGTGGGATGG - Intronic
1163420147 19:17209792-17209814 TGCTGGGAAGGCTGGTGAGTGGG + Intronic
1163676272 19:18656782-18656804 TGCTGGGAGGGCAGGCGTGCTGG - Intronic
1163739774 19:19004318-19004340 CGCCGGGAAGGCCGTCGGCAGGG + Exonic
1164586272 19:29478106-29478128 GGCTGGGCAGGCCCTCGGGAGGG - Intergenic
1164654551 19:29910741-29910763 GGGTGGGAAGGACGGAGGGAGGG - Intergenic
1165385393 19:35507539-35507561 TGATGGGGAGGCAGGCGGGCAGG + Intronic
1165830033 19:38725916-38725938 TGGTGGAAAGGCCAGCGGGCGGG - Intronic
1166348821 19:42184341-42184363 TTCTGGGAAGGGCGGCAGGAAGG - Intronic
1167001035 19:46746032-46746054 CGCCGGGACGGCCGGCGGGGGGG - Exonic
1167268284 19:48493981-48494003 TGGCGGGGAGGCCGGCGGGGCGG - Exonic
1167359537 19:49022933-49022955 GGCTTGGAAGGCTGGGGGGAGGG + Exonic
1167361593 19:49033152-49033174 GGCTTGGAAGGCTGGGGGGAGGG - Exonic
1167410139 19:49339535-49339557 TGCTGGGTGGAGCGGCGGGAGGG - Intronic
1167464284 19:49642088-49642110 CGACGTGAAGGCCGGCGGGAAGG - Intergenic
1168317776 19:55491527-55491549 TGGTGGGAAGGAGGGAGGGAGGG + Intronic
925348825 2:3187740-3187762 TGGTGGGGAGGCCGTGGGGAGGG - Intergenic
925611351 2:5705705-5705727 AGCTGGGGAGGCCGGGGTGAAGG + Intergenic
927741787 2:25576870-25576892 TGCTGTGAGGGCCGCCGGCATGG + Exonic
927845258 2:26468297-26468319 GGCTGGGAGGGCTGGCAGGAGGG + Intronic
927845895 2:26472834-26472856 AGCTGCGGAGGCCGGTGGGAGGG + Intronic
930439805 2:51391283-51391305 TGCTGGGAAGGGAGGAGGGGTGG + Intergenic
932169200 2:69538373-69538395 TGCTGAGTAGGTCGGTGGGAGGG - Intronic
932583033 2:73004954-73004976 TTCTGGAAAGGGCAGCGGGAGGG - Intronic
932592207 2:73074345-73074367 TGCTGGGCAGGCGGGCAGGCAGG - Exonic
932592508 2:73075789-73075811 TGGTGGGCAGGCGGGCGGGCGGG - Intronic
934072594 2:88398275-88398297 TGCTGGGGAGCCAGGCTGGATGG + Intergenic
934651044 2:96091547-96091569 TGAGGGGAAGGCCGAGGGGAAGG + Intergenic
934680810 2:96282745-96282767 TTCTGGGAAGGCCTCAGGGAAGG - Intronic
934880452 2:97972458-97972480 GGGAGGGAAGGCGGGCGGGAGGG + Intronic
935114803 2:100126149-100126171 TGCTGGGAATGCCGGGGAAATGG + Intronic
935692774 2:105745345-105745367 GGATGGGAAGGCGGGCAGGAAGG - Intronic
936077622 2:109411713-109411735 TGCTAGGAAGGCCGGCCACACGG + Intronic
937966316 2:127514372-127514394 TGCTGGGTAAGCGGGAGGGAGGG - Intronic
938318388 2:130345695-130345717 ACCTGGTAAGGCCGGAGGGAGGG + Exonic
940730326 2:157382027-157382049 GGCTGGGAAGGACAGGGGGAAGG + Intergenic
941863783 2:170312618-170312640 TGCGTGGAAGGCTGGTGGGAAGG + Intronic
942276729 2:174328545-174328567 GGCAGGGAAGGCGGGCGGGCGGG + Intergenic
942352707 2:175069565-175069587 GGCTGGGAAGGGCAGTGGGAGGG + Intergenic
942383317 2:175416284-175416306 AGCTGGGAAGGGCAGTGGGAAGG - Intergenic
944361266 2:198860111-198860133 AGCTGGGAAGGGCAGTGGGAGGG + Intergenic
945699524 2:213152204-213152226 TGGTGGGGAGGCCGGGGGAAGGG + Intronic
946308804 2:218871612-218871634 TGCCGGGCAGGCCGGAGGGCCGG - Exonic
946476334 2:220010042-220010064 TGCATGGAAGGCCTGAGGGATGG - Intergenic
948190045 2:236051498-236051520 AGGTGGGAAGGCGGGCTGGAGGG + Intronic
948304983 2:236940145-236940167 GGCTGGCAGGGCAGGCGGGAGGG + Intergenic
948479912 2:238242843-238242865 TGCTGTGAAGGAGGGAGGGAGGG - Intergenic
948547811 2:238745323-238745345 TGCTGGGAGGGTGGGTGGGAAGG - Intergenic
1169141128 20:3228072-3228094 GGCTGGGGAGGCTGGCGGGCAGG - Intronic
1170017575 20:11799044-11799066 AGCTGGGAATGGCGGTGGGATGG - Intergenic
1170438062 20:16350523-16350545 TGCTGAGAAGGCGGGAGGGAAGG + Intronic
1171293218 20:23994399-23994421 TGCAGGGAAGGCCGGCCTGGGGG - Intergenic
1171370578 20:24659548-24659570 GGCTGGCAAGGCCGCTGGGAAGG + Intronic
1171445898 20:25204794-25204816 TGCTGGGGAGGCCTGGGGCAGGG + Intronic
1172020813 20:31912706-31912728 TGCAGGGCAGGCCAGCAGGATGG + Intronic
1172516054 20:35534365-35534387 TGGTGGGCAGGCCAGTGGGAGGG - Intergenic
1173817705 20:46000398-46000420 TGCAAGGAAGGCCAGCGGAAGGG - Intergenic
1174130612 20:48341349-48341371 GGCTGGGAAGCCCAGTGGGAGGG - Intergenic
1175338984 20:58215646-58215668 TGCTGGGAAGGCCTGGGAGGTGG - Intergenic
1179099165 21:38341664-38341686 TGCTGGGAAGTGCTGGGGGAAGG - Intergenic
1180083478 21:45497247-45497269 TGCTGGGAGGGCCCGCAGGAAGG - Intronic
1180614260 22:17117612-17117634 AGCAGAGAAGGCCGGAGGGAGGG - Exonic
1180824278 22:18852114-18852136 TGCAGGGAAGGCCGGCCTGGGGG - Intronic
1181046684 22:20217965-20217987 TGCTGGGAAGGCCCACAGCAGGG + Intergenic
1181106239 22:20577406-20577428 TGGTGGGAAGGAGGGAGGGAGGG - Intronic
1181124706 22:20695268-20695290 TGCAGGGAAGGCCGGCCTGGGGG - Intergenic
1181188456 22:21122434-21122456 TGCAGGGAAGGCCGGCCTGGGGG + Intergenic
1181210742 22:21288059-21288081 TGCAGGGAAGGCCGGCCTGGGGG - Intergenic
1181398766 22:22638829-22638851 TGCAGGGAAGGCCGGCCTGGGGG + Intergenic
1181413192 22:22739322-22739344 TGCCGGGAGGGCTGGAGGGAAGG - Intronic
1181425977 22:22839032-22839054 TGCCTGGAAGGCTGGAGGGAAGG - Intronic
1181486979 22:23237699-23237721 TGCTGAGACGGGCGGCGTGAAGG + Intronic
1181501497 22:23318185-23318207 TGCAGGGAAGGCCGGCCTGGGGG + Intergenic
1181650655 22:24257230-24257252 TGCAGGGAAGGCCGGCCTGGGGG - Intergenic
1181706726 22:24653508-24653530 TGCAGGGAAGGCCGGCCTGGGGG + Intergenic
1182558254 22:31140604-31140626 TGCTGAGAAGGCAGGCAGAATGG - Exonic
1185162354 22:49237675-49237697 TGCTGGGAGGGAGGGAGGGAGGG - Intergenic
1185375120 22:50479086-50479108 TGCTGGGGAGGCAGGCAGAAAGG - Intergenic
1185412083 22:50688001-50688023 TGCTTGGAGGGAGGGCGGGAAGG + Intergenic
1185414583 22:50702959-50702981 GGCTGGGAAGGCTGGTGGGTGGG + Intergenic
1203216205 22_KI270731v1_random:7371-7393 TGCAGGGAAGGCCGGCCTGGGGG + Intergenic
1203274417 22_KI270734v1_random:78018-78040 TGCAGGGAAGGCCGGCCTGGGGG - Intergenic
950519280 3:13486964-13486986 TGCTTGGGAGGCCGGATGGAAGG + Intronic
950990617 3:17434067-17434089 AGCTGTGAAGGCAGCCGGGAGGG - Intronic
953641588 3:44712793-44712815 TGCTGGGGCGGCGGGCTGGAGGG + Intronic
954183074 3:48896868-48896890 TGATGGGAAGGCAGGAGTGAAGG - Intronic
954263948 3:49459290-49459312 TGCTGGCAAGGCAAGCGGGTAGG + Intergenic
954751130 3:52814268-52814290 TTCTGGGATGGCCGTGGGGAGGG - Exonic
954798768 3:53175062-53175084 TGCTGGGCAGGCCGGGGGTAGGG + Intronic
960224041 3:115148178-115148200 GGGTGGGAAAGCCGGAGGGAGGG + Intergenic
960362918 3:116735656-116735678 AGCTGTGAAGGCAGCCGGGAGGG + Intronic
960638968 3:119809547-119809569 TGGGGGGAAGGCGGGGGGGAAGG + Intronic
960972961 3:123152172-123152194 AGGTGGGAAGGCAGGCGGGAAGG - Intronic
964749180 3:160038980-160039002 TGCTGAGAATGACTGCGGGAGGG + Intergenic
965757355 3:172040108-172040130 TGCTGGGAAGGCTGGGGGTGGGG - Intronic
968601759 4:1513024-1513046 TGCTGGGCGGGTCGGGGGGAGGG - Intergenic
969481595 4:7449373-7449395 TGCTGGGAGGGAGGGAGGGAGGG - Intronic
970531821 4:16992734-16992756 TGCTGGCAAGGTAGGCAGGATGG + Intergenic
972538668 4:40020431-40020453 TGCTGGGATGGCCGGGGGTCTGG + Intergenic
972988232 4:44792073-44792095 TGCTGGGAAGGCCAGTGAGTCGG + Intergenic
976087842 4:81424496-81424518 TGCTGGGAAGGTGGGGGGCAGGG - Intergenic
976246778 4:83012742-83012764 TCCTGGGCGGGCTGGCGGGAAGG - Intronic
979713142 4:123804179-123804201 TGCTGGGAAGGCAAGAGGTAAGG + Intergenic
983212970 4:164977505-164977527 AGCTGGGAAGGCCGCAGGAAAGG - Intronic
983248642 4:165319528-165319550 TGCTGGGATGGCTGCAGGGACGG - Intronic
985852361 5:2397969-2397991 TGTTGGGGAGGCCGGGGGGAGGG + Intergenic
986278875 5:6306370-6306392 TGCTGGGTGGGCCGAGGGGAGGG - Intergenic
986284641 5:6350432-6350454 TGCTGGGAGGGAGGGAGGGAAGG + Intergenic
986924644 5:12731733-12731755 TGATGGGAAGGCTGCCAGGAAGG + Intergenic
988538490 5:32089160-32089182 TGCTGTGAAGGCTGGGGGGACGG + Exonic
989710350 5:44389533-44389555 TGCTGGGAACGCCAGGGAGAGGG + Intronic
990571074 5:57079318-57079340 TGCTTGGGAGGCTGGCAGGAGGG - Intergenic
993116209 5:83722412-83722434 TGCTGGGGAAGCCGCCGGGACGG + Intergenic
997754448 5:136383104-136383126 TGCGGGCAGGGGCGGCGGGAGGG - Intronic
998584739 5:143415338-143415360 GGCTGGGAAGGGCAGGGGGAAGG + Intronic
1000281986 5:159790068-159790090 TGCTGGGGAGGAAGGCGGGCAGG + Intergenic
1001403899 5:171462349-171462371 AGCTGGGCAGGCAGGCAGGAGGG - Intergenic
1001837749 5:174846002-174846024 ACCTGGGAAGGCCGGAGGGATGG - Intergenic
1002186280 5:177456198-177456220 TGCGGGGAGGGGCGGGGGGAGGG + Exonic
1002645291 5:180649689-180649711 GGCTGGGAGGGACGGGGGGAGGG - Intergenic
1003618596 6:7677307-7677329 TGCAGGGAAGGCCAGCAGGCTGG - Intergenic
1004044737 6:12012599-12012621 AGCTGGGGAGGGCGGCGGGGCGG + Intronic
1006239344 6:32664422-32664444 TGCTAGCGAGGCCGGCGGGCAGG + Intronic
1006297440 6:33176177-33176199 TGCGGGGCAGGCTGGAGGGAAGG + Intronic
1006333699 6:33410147-33410169 GGCTGGGGTGGCCGGCGGAAGGG - Intergenic
1006860764 6:37170369-37170391 TGCCGGGACTGGCGGCGGGAGGG - Exonic
1007255278 6:40523985-40524007 GGCTGGGAAGGGCAGGGGGAGGG + Intronic
1007693619 6:43718232-43718254 AGCTGGGCAGGCCGGAGGGAGGG - Intergenic
1008445117 6:51580117-51580139 TGCTGGGAAGGACTGGGGCAAGG - Intergenic
1008839082 6:55877448-55877470 GGAAGGGAAGGTCGGCGGGAAGG - Intergenic
1009025983 6:58001008-58001030 TGCTGGGAAGGTTGACGGGTAGG + Intergenic
1009531423 6:64821384-64821406 TGGTGGGGCGGTCGGCGGGAGGG + Intronic
1010969559 6:82248789-82248811 TGCTGGGAAGGGCAGTAGGAGGG - Intergenic
1014976948 6:127898959-127898981 TGCTGGGAAGGGTAGTGGGAGGG + Intronic
1017108584 6:150911545-150911567 TGCTTGGAAGGCCTTCTGGAAGG + Intronic
1017186465 6:151605679-151605701 TGCTGGGAAGGTTGAGGGGAGGG + Intronic
1018393275 6:163357363-163357385 TGCTGCGCAGGAGGGCGGGATGG - Intergenic
1018892010 6:167989367-167989389 TGCTGGAAAAGTCGGCGGGCTGG - Intergenic
1019208695 6:170385980-170386002 GGCTGAGCAGGCAGGCGGGAGGG + Intronic
1019431064 7:1000086-1000108 TGCCCTGAAGGCCGGCGGCAGGG + Intronic
1019536111 7:1530708-1530730 TGCTGGGGAGCCGGGCGGGCGGG + Exonic
1019743501 7:2687533-2687555 TGCCGTGAAGGCCGGCATGACGG - Intronic
1020198257 7:6059108-6059130 TGCTGGGCTGGCCGGCGGGCTGG - Exonic
1020434893 7:8152053-8152075 GGCTGGGAAGGCCGGCAGGCAGG - Intronic
1021675602 7:23077601-23077623 TGCTGGGAGGGCAGGCAGGCAGG + Intergenic
1024085643 7:45889447-45889469 TCCTGGGGAGGCCAGCAGGAGGG - Intronic
1025033132 7:55572893-55572915 TGATGGGAAGGCCGGCCTGGGGG + Intronic
1025106246 7:56174390-56174412 GGCTGGGAAGGCCAGCGTGTTGG + Intergenic
1025194026 7:56918633-56918655 TGCTGGCATGGCCTGAGGGAGGG + Intergenic
1026471116 7:70694626-70694648 TCCCGGGCCGGCCGGCGGGAGGG - Intronic
1026591195 7:71697041-71697063 TACAGGGAAGGCAGGCTGGACGG + Intronic
1026805057 7:73424176-73424198 GGCCGGACAGGCCGGCGGGAAGG + Intergenic
1029504351 7:100953350-100953372 TGCTGGGAAGGTCGTCAGGAGGG - Exonic
1031498096 7:122476970-122476992 TGGCGGGAAGGGGGGCGGGAGGG + Intronic
1031923134 7:127615607-127615629 TGGTGGGAAGCCAGGCTGGAGGG - Exonic
1033160725 7:138994072-138994094 TGCAGGGAAGGCCAGCTGGTGGG + Intergenic
1034137300 7:148782888-148782910 GGCTGGGAAGGTTGGTGGGAGGG - Intronic
1035406643 7:158602927-158602949 GCCTGGGAAGGCTGGCGTGAAGG + Intergenic
1035748573 8:1979161-1979183 TGCAGGGCAGGCCGGCAGGCTGG + Intronic
1038136594 8:24792565-24792587 TTCTGGGAAGGCTGGCGGTGAGG - Intergenic
1038791734 8:30674059-30674081 TGCTGTGGAGGCCGGCAGGCTGG - Intergenic
1039445483 8:37628236-37628258 GTCTGGGAAGGCTGGTGGGAGGG - Intergenic
1041416141 8:57610233-57610255 TGCTGGAGAGGCCGGTGGGGTGG + Intergenic
1041800773 8:61795510-61795532 TGTTGGGGAGGCCGGGGAGAGGG - Intergenic
1041893640 8:62899579-62899601 GGCTGGGAAGGGTAGCGGGAGGG + Intronic
1042138989 8:65660553-65660575 TGATGAGAAGGCCTGAGGGAGGG - Intronic
1044996774 8:97844789-97844811 AGCTGGGAAGGCCGAAGGAATGG + Intronic
1047511886 8:125521782-125521804 GGCTGGGAAGGAAGGCAGGAAGG - Intergenic
1049166200 8:141128036-141128058 AGCAGGAAGGGCCGGCGGGAAGG - Intronic
1049367695 8:142248694-142248716 TACTGAGAAGCCCGGAGGGAGGG + Intronic
1049528509 8:143141897-143141919 TGAAGGGAAGGCAGGCGTGAGGG + Intergenic
1049722154 8:144123380-144123402 GGCTGGGAAGGGAGGTGGGAAGG + Intergenic
1049936469 9:505087-505109 GGCCGGGCCGGCCGGCGGGAGGG + Intronic
1050527067 9:6555321-6555343 TGGTGGGAAGGCTAGTGGGATGG - Intronic
1053308082 9:36997744-36997766 TGCCTGGGAGGCCTGCGGGATGG - Intronic
1055096619 9:72420900-72420922 TGCTGGAAAGGCAGGAGGAAGGG + Intergenic
1055945846 9:81689950-81689972 TGATGGGAAGGTCGGTGGGAAGG + Intergenic
1056102446 9:83312766-83312788 TGCTGGGGAGGAGGGCGGGGCGG - Intronic
1056895612 9:90545899-90545921 AGCTGGGAAGGGCAGTGGGATGG - Intergenic
1057942426 9:99296635-99296657 TGCGGGGAGGCCGGGCGGGAGGG + Intergenic
1058546622 9:106067484-106067506 TCCTGGGGAGGCCCGCAGGAAGG + Intergenic
1058766972 9:108191139-108191161 TGCTGGGATGGCAAGCTGGATGG + Intergenic
1059208488 9:112487487-112487509 AGGTGGGAAGGAGGGCGGGAAGG + Intronic
1061541185 9:131278426-131278448 GGCTGGGAAGGTCGCGGGGAGGG + Intergenic
1061592082 9:131604094-131604116 AGCTGTGAGGGCCGGCTGGAGGG - Intronic
1061616978 9:131786798-131786820 TGCCTGGAAGGACGGCAGGAAGG + Intergenic
1061963108 9:133998268-133998290 TGGAGGGAAGGACGGCGGGATGG - Intergenic
1061997564 9:134194214-134194236 TGCTGGGAAGGCATTCAGGAAGG + Intergenic
1062093980 9:134693687-134693709 TGCTCGGAGGGCCGGGCGGAAGG - Intronic
1062670263 9:137704775-137704797 GGGAGGGAAGGCAGGCGGGAGGG - Intronic
1185651264 X:1649677-1649699 TGCTGGGGAGGGGGGCGGGGCGG - Intergenic
1186618670 X:11215131-11215153 TGCTGGGCAGCCAGGCAGGAGGG - Intronic
1187449146 X:19381528-19381550 TGCTGCGAAGGCTGGAGGGCTGG + Intronic
1187824242 X:23318700-23318722 TGGTGGGAAGGCCACAGGGATGG + Intergenic
1187933756 X:24316304-24316326 TGCTTGGAAGGCCTGAAGGATGG - Intergenic
1188604879 X:32015986-32016008 TGCTGCTCAGGCCAGCGGGAGGG - Intronic
1188869162 X:35352701-35352723 TGCTGGTGAGGCAGGGGGGAAGG - Intergenic
1189247152 X:39572063-39572085 TGCTTGGAAGGATGGCAGGATGG + Intergenic
1190081846 X:47362800-47362822 TGCTGGGAAGCCGGGCGTGGTGG - Intergenic
1190598799 X:52069283-52069305 TGTTGGGAAAGCGGGCGGGCTGG - Intergenic
1190610025 X:52184790-52184812 TGTTGGGAAAGCGGGCGGGCTGG + Intergenic
1190988619 X:55522789-55522811 TGCTGGGAAGGAAGTCTGGAGGG - Intergenic
1192792772 X:74399560-74399582 TGCTGGGCCGGCCGGCTGGCGGG - Intergenic
1192928722 X:75782733-75782755 TGCTGGGAAGGATAGTGGGAAGG - Intergenic
1193933772 X:87589667-87589689 TGGTGGGAAGGTGGGTGGGAAGG + Intronic
1195178054 X:102329619-102329641 TGCAGGGAAGGCTGGCAGGCTGG - Intergenic
1195180810 X:102357474-102357496 TGCAGGGAAGGCTGGCAGGCTGG + Intergenic
1199756356 X:150868647-150868669 GGCTGGGAAGGCTAGGGGGAAGG - Intronic
1201574887 Y:15452353-15452375 TGCTGGGAGGGCCAGCCAGAGGG - Intergenic