ID: 1083995364

View in Genome Browser
Species Human (GRCh38)
Location 11:66268982-66269004
Sequence CCTGAAGTGACCGGGACTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083995364_1083995374 15 Left 1083995364 11:66268982-66269004 CCCGCAGTCCCGGTCACTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 237
Right 1083995374 11:66269020-66269042 CTGCTGCTTGACAACTGTCCCGG 0: 1
1: 0
2: 1
3: 10
4: 127
1083995364_1083995375 23 Left 1083995364 11:66268982-66269004 CCCGCAGTCCCGGTCACTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 237
Right 1083995375 11:66269028-66269050 TGACAACTGTCCCGGAGTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083995364 Original CRISPR CCTGAAGTGACCGGGACTGC GGG (reversed) Intronic