ID: 1083996476

View in Genome Browser
Species Human (GRCh38)
Location 11:66275568-66275590
Sequence TGTTGAGGTGTTGGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1771
Summary {0: 1, 1: 0, 2: 3, 3: 101, 4: 1666}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083996470_1083996476 -7 Left 1083996470 11:66275552-66275574 CCCAAGTTGGGGCAGCTGTTGAG 0: 1
1: 0
2: 1
3: 6
4: 123
Right 1083996476 11:66275568-66275590 TGTTGAGGTGTTGGGGCAGCTGG 0: 1
1: 0
2: 3
3: 101
4: 1666
1083996471_1083996476 -8 Left 1083996471 11:66275553-66275575 CCAAGTTGGGGCAGCTGTTGAGG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 1083996476 11:66275568-66275590 TGTTGAGGTGTTGGGGCAGCTGG 0: 1
1: 0
2: 3
3: 101
4: 1666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083996476 Original CRISPR TGTTGAGGTGTTGGGGCAGC TGG Intronic
900372090 1:2336644-2336666 TGTTGAGGTGGTGGGTGGGCAGG + Intronic
900462655 1:2808960-2808982 TGTGGAGGAGCTGGGGCTGCCGG + Intergenic
901169322 1:7244736-7244758 TGTTGTGGGGTTGGGGGAGGCGG + Intronic
901187091 1:7381300-7381322 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
901223568 1:7598081-7598103 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
902083819 1:13840801-13840823 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
902107410 1:14049311-14049333 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
902638062 1:17748039-17748061 GGCTGAGGTGCTGGGACAGCAGG + Intergenic
902695176 1:18135407-18135429 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
902736728 1:18406064-18406086 TGTTGGGGTGAGGGGGCAGTTGG + Intergenic
902943135 1:19814774-19814796 TGAGGCGGTGGTGGGGCAGCTGG - Exonic
903090148 1:20907537-20907559 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
903348926 1:22706461-22706483 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
903584386 1:24399880-24399902 TGGTGAGGATTTGGAGCAGCTGG + Intronic
903617512 1:24672054-24672076 TGTTGTGGGGTAGGGGGAGCAGG - Intronic
903683779 1:25116130-25116152 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
904358382 1:29956363-29956385 TGTTGAGGGATGGGGGCAGAAGG - Intergenic
904690950 1:32292785-32292807 TGTTGAGGGGCTGGGGCCGTGGG + Intronic
904795807 1:33055571-33055593 GGTAGATGTGATGGGGCAGCAGG - Intronic
905334913 1:37238602-37238624 TGTGGAGAGGTTGGTGCAGCGGG - Intergenic
906081937 1:43096911-43096933 TGTTGAGGGGTTGGGGGTGATGG + Intergenic
906260519 1:44385060-44385082 TGTTGTGGAGTGGGGGGAGCGGG - Intergenic
906572214 1:46852471-46852493 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
906604579 1:47157949-47157971 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
906768693 1:48462189-48462211 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
906840152 1:49129459-49129481 TGTTGTGGGGTTGGGGGAGGTGG - Intronic
906902785 1:49854611-49854633 TGTGGAGGTGCAGGAGCAGCTGG - Intronic
907139283 1:52171147-52171169 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
907464424 1:54625289-54625311 TGGTGAGGTGTCAGGGCTGCTGG + Intronic
907533602 1:55127213-55127235 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
908327442 1:63037097-63037119 TGTTGTGGTGTGGGGGGAGCAGG - Intergenic
908455394 1:64299060-64299082 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
908907845 1:69037201-69037223 TGTTGAGGGGTGGGGGGAGGGGG + Intergenic
908968468 1:69796114-69796136 TGTTGAGGGGTGGGGGGAGGGGG - Intronic
909160713 1:72146042-72146064 TGTTGTGGTGGTGGGGCAGGGGG + Intronic
909489664 1:76211780-76211802 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
909886813 1:80951382-80951404 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
910020705 1:82586041-82586063 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
910081778 1:83350556-83350578 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
910111131 1:83684659-83684681 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
910601384 1:89036250-89036272 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
910719495 1:90270610-90270632 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
910797012 1:91107618-91107640 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
910947564 1:92610942-92610964 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
911113001 1:94211900-94211922 TGTTGTGGGGTTGGGGGAGGAGG - Intronic
911309862 1:96278742-96278764 TGTTGTGGGGTTGGGGGAGCAGG - Intergenic
911341742 1:96647332-96647354 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
911402822 1:97398092-97398114 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
911458772 1:98162026-98162048 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
911523497 1:98957181-98957203 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
911762257 1:101629781-101629803 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
911765377 1:101668490-101668512 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
911795719 1:102073558-102073580 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
911870690 1:103094138-103094160 TGTGGAGGTGTGGGGGCAAAGGG + Intronic
911882956 1:103264943-103264965 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
911908542 1:103600956-103600978 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
911914378 1:103678504-103678526 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
911932962 1:103928195-103928217 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
911949280 1:104152735-104152757 TGTTGTGGGGTTGGGGGAGGCGG - Intergenic
911999775 1:104818284-104818306 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
912008887 1:104935290-104935312 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
912027002 1:105189651-105189673 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
912107610 1:106299416-106299438 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
912207050 1:107520352-107520374 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
912299097 1:108495023-108495045 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
912383089 1:109258032-109258054 TGTTGAGGTGTAGAGGCTGAGGG + Intronic
912999312 1:114563733-114563755 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
913268475 1:117068389-117068411 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
913301994 1:117381331-117381353 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
913446670 1:118957617-118957639 TGTTGTGGGGTTGGGGGAGGAGG - Intronic
914406202 1:147376110-147376132 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
914682897 1:149952195-149952217 TGTTGTGGAGTTGGGGGAGGGGG - Intronic
915036286 1:152928369-152928391 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
915086373 1:153391679-153391701 TGTGGAGGAGTGTGGGCAGCAGG - Intergenic
915086494 1:153392666-153392688 TGTGGAGGAGTGTGGGCAGCAGG - Intergenic
915089397 1:153412979-153413001 TGTCGTGAGGTTGGGGCAGCGGG + Intergenic
915164889 1:153942886-153942908 GGTTGAGGTTGCGGGGCAGCCGG + Exonic
915485472 1:156217078-156217100 TGTGGTGGGGTTGGGGGAGCGGG + Intronic
916154878 1:161834620-161834642 TGTTGTGGTGTGGGGGGAGGGGG + Intronic
916210685 1:162357271-162357293 TGTTGGGGAGTGGGGGCAGCGGG + Intronic
916576352 1:166070402-166070424 TCTTCAGCTCTTGGGGCAGCGGG - Exonic
916598538 1:166270291-166270313 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
916622632 1:166517215-166517237 TGGTGGGGTGTTGGGGCAGGGGG - Intergenic
916639298 1:166709770-166709792 TGTTGAGGGGTGGGGGAAGGGGG + Intergenic
917053561 1:170952595-170952617 TGTTGTGGAGTTGGGGGAGGGGG + Intronic
917126069 1:171688980-171689002 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
917288081 1:173442351-173442373 TGGGGAGGAGTTGGGGGAGCAGG - Intergenic
917574631 1:176308524-176308546 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
918166461 1:181954181-181954203 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
918445545 1:184613647-184613669 TGCTGGGGTGTGGGGGTAGCAGG - Intronic
918588807 1:186218438-186218460 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
918592578 1:186256741-186256763 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
918791516 1:188836713-188836735 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
918824183 1:189300485-189300507 TGTTGTGGGGTGGGGGAAGCAGG + Intergenic
918946880 1:191077899-191077921 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
919064141 1:192671487-192671509 TGTGGAGGTGCTGAGGGAGCAGG - Intergenic
919137093 1:193523188-193523210 TGTGTAGGTTTTGGGGCAGATGG + Intergenic
919164670 1:193876848-193876870 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
919286076 1:195561287-195561309 TGTTGTGGGGTGGGGGTAGCGGG + Intergenic
919289573 1:195611753-195611775 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
919303706 1:195802615-195802637 TGTTGTGGTGTGGGGGTAGGGGG + Intergenic
919471788 1:197988353-197988375 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
919960864 1:202467370-202467392 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
920362616 1:205429777-205429799 TGTTGGGGGGTGGGGGGAGCAGG + Intronic
920374769 1:205502021-205502043 TGTGGTGGTGGTGGGGCAGGGGG + Intergenic
920619427 1:207529714-207529736 TGTTGTGGGGTGGGGGAAGCGGG - Intronic
920621209 1:207548269-207548291 TGTTGTGGGGTGGGGGAAGCGGG - Intronic
920868197 1:209770599-209770621 TGTGGAGGTGTGTGTGCAGCTGG + Intronic
920990440 1:210933358-210933380 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
921024358 1:211263018-211263040 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
921090198 1:211834855-211834877 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
921250419 1:213292095-213292117 TGTTGAGGGGTGGGGGTAGGGGG + Intergenic
921489210 1:215753656-215753678 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
921545491 1:216469750-216469772 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
921615235 1:217258614-217258636 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
921846901 1:219892673-219892695 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
922393709 1:225174106-225174128 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
922559027 1:226554478-226554500 AGTTGATGTGTTGGGACAGTGGG + Intronic
922818958 1:228470985-228471007 TGTTGGGATGCTGGGGCTGCAGG - Intergenic
923037991 1:230298979-230299001 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
923418333 1:233787329-233787351 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
923828062 1:237522116-237522138 TGTTGTGGGGTAGGGGGAGCGGG - Intronic
923961423 1:239088517-239088539 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
924006971 1:239623258-239623280 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
924020756 1:239779226-239779248 TGTGCATGTGTTGGGGCAGGGGG - Intronic
924060152 1:240165969-240165991 TGTTGAGGGGTGGGGGCAAAAGG + Intronic
924150838 1:241127537-241127559 TGTTGTGGCGTGGGGGGAGCGGG + Intronic
924456274 1:244221368-244221390 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
924649607 1:245913357-245913379 TGTTGTGGTGTGGGGGGAGGGGG + Intronic
924697099 1:246411820-246411842 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
924873429 1:248073471-248073493 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
924884653 1:248201591-248201613 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
924890267 1:248270264-248270286 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
924892259 1:248296000-248296022 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1062890321 10:1055105-1055127 TGTTGATGTGCTAGGGCTGCAGG - Intronic
1063189627 10:3681159-3681181 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1063311840 10:4960068-4960090 TGTTGTGGTGTGGGGGGAGGGGG - Intronic
1063327016 10:5113929-5113951 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1063332451 10:5175121-5175143 TGTTGCGGGGTTGGGGGAGGGGG - Intergenic
1063489855 10:6453916-6453938 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1063709978 10:8467975-8467997 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1063784884 10:9371062-9371084 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1063840710 10:10069518-10069540 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1063854013 10:10226024-10226046 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1064185237 10:13156215-13156237 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1064508482 10:16062937-16062959 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
1064508603 10:16064227-16064249 TGTTGTGGGGTCGGGGGAGCGGG - Intergenic
1064919004 10:20495774-20495796 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1064923388 10:20543121-20543143 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
1066001328 10:31106529-31106551 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1066077640 10:31896084-31896106 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1066138825 10:32482644-32482666 TGTTGTGGGGTTGGGGGAGGTGG - Intronic
1066152267 10:32636374-32636396 TGTTGTGGTGTGGGGGTAGGGGG - Intronic
1066152989 10:32644347-32644369 TGTGGAGGGGTTGGGGGAGGAGG - Intronic
1066161510 10:32736536-32736558 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1066692247 10:38041960-38041982 TGTTGAGGTGTGGGGGCAAGGGG - Intronic
1067283748 10:44892351-44892373 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1067771237 10:49127716-49127738 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1067898330 10:50210649-50210671 TGCTTAGGTCTGGGGGCAGCGGG + Intronic
1067991100 10:51213311-51213333 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1068281309 10:54874118-54874140 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1068421639 10:56801856-56801878 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1068505729 10:57897101-57897123 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1068541420 10:58298801-58298823 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1068621166 10:59184795-59184817 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1068817603 10:61335168-61335190 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1068846196 10:61677691-61677713 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1069067869 10:63962731-63962753 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1069162136 10:65105725-65105747 TGTTGTGGGGTTGGGGGAGGTGG + Intergenic
1069201026 10:65616990-65617012 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1069272198 10:66542733-66542755 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1069363477 10:67671505-67671527 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1069834667 10:71301097-71301119 CCTGGAGGTGTTGGGGAAGCGGG - Exonic
1070230704 10:74564039-74564061 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1070231133 10:74568922-74568944 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1070619657 10:77999146-77999168 TGTTGTGGGGTAGGGGGAGCGGG + Intronic
1071108821 10:82130373-82130395 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
1071323206 10:84485889-84485911 TGTTGTGGGGTTGGGGGAGGTGG - Intronic
1071459892 10:85882617-85882639 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1072910209 10:99494117-99494139 TGTTGTGGGGTTGGGGGAGGAGG + Intergenic
1072985690 10:100137956-100137978 TGTACATGTGTTGGGGCAGGAGG + Intergenic
1073022802 10:100460403-100460425 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1073641335 10:105255317-105255339 TGTTGTGGTGTCGGGGGAGGAGG + Intronic
1073654546 10:105398862-105398884 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1073742209 10:106420697-106420719 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1073919476 10:108442599-108442621 TGTTGTGGTGTGGGGGCAGGGGG + Intergenic
1073943369 10:108723578-108723600 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1074212208 10:111346006-111346028 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1074238472 10:111610578-111610600 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1074269174 10:111936061-111936083 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1074523345 10:114244323-114244345 GGGAGAGGTGTTGGGGCTGCCGG - Intronic
1074646043 10:115453792-115453814 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1074808397 10:117077624-117077646 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1075170687 10:120111134-120111156 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1076088895 10:127661657-127661679 TGTTGTGGGGTTGGGGAAGGGGG - Intergenic
1076261044 10:129066527-129066549 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
1076788418 10:132763321-132763343 TGTGGAGGTGAGGAGGCAGCAGG - Intronic
1076891392 10:133285601-133285623 TGATGAGGTCATGGGGCATCAGG + Exonic
1076963832 11:61543-61565 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1077106993 11:846506-846528 TGTTGCGGGGTTGAGCCAGCAGG + Intronic
1077827826 11:5830084-5830106 TGTTGTGGGGTGGGGGCAGTGGG + Intronic
1077831511 11:5876768-5876790 TATTGTGGGGTGGGGGCAGCGGG + Intronic
1078113689 11:8424134-8424156 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1078695085 11:13623167-13623189 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1078718547 11:13862126-13862148 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1078797624 11:14608406-14608428 TGTTGTGGGGTAGGGGGAGCGGG + Intronic
1079253889 11:18809820-18809842 TGTTGTGGAGTGGGGGGAGCGGG - Intergenic
1079522062 11:21339864-21339886 TGTGGAGCTTTTGGGGAAGCTGG - Intronic
1079527626 11:21409426-21409448 TGTTGTGGGGTTGGGGGAGCGGG + Intronic
1079633410 11:22706480-22706502 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1079742022 11:24073950-24073972 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1079784917 11:24659415-24659437 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1079836384 11:25340105-25340127 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1079845397 11:25460780-25460802 TGTTGTGGGGTCGGGGGAGCGGG - Intergenic
1079883601 11:25957295-25957317 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1079889261 11:26029840-26029862 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1079970060 11:27025831-27025853 TGTTGAGGGGTGGGGGGAGCGGG + Intergenic
1080117748 11:28639502-28639524 TGTTGTGGGGTGGGGGAAGCAGG - Intergenic
1080177598 11:29384977-29384999 TGTTGTGGGGTGGGGGTAGCTGG - Intergenic
1080180666 11:29421465-29421487 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1080252738 11:30253125-30253147 TGTGGTGGGGTTGGGGGAGCGGG + Intergenic
1080291849 11:30679782-30679804 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1080710960 11:34747856-34747878 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1080733097 11:34981145-34981167 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1081051001 11:38341599-38341621 TATTGTGGGGTTGGGGGAGCAGG - Intergenic
1081162061 11:39761020-39761042 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1081220416 11:40453026-40453048 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1081227343 11:40540552-40540574 GGTGGAGGTGTCAGGGCAGCAGG - Intronic
1081836038 11:46155421-46155443 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1082137979 11:48572407-48572429 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1082153389 11:48771809-48771831 TGTTGAGGGGTGGGGGGAGGGGG - Intergenic
1082218872 11:49608444-49608466 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1082265086 11:50109568-50109590 TGGTGTGGTGGTGGGGAAGCAGG - Intergenic
1082266373 11:50122855-50122877 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
1082273150 11:50193889-50193911 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1082289716 11:50355717-50355739 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
1082311143 11:50649932-50649954 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1082604125 11:55202155-55202177 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1082754450 11:57060046-57060068 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
1082891076 11:58139429-58139451 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1083005747 11:59344321-59344343 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
1083537371 11:63481901-63481923 TGTTGTGGGGTAGGGGGAGCGGG + Intronic
1083996476 11:66275568-66275590 TGTTGAGGTGTTGGGGCAGCTGG + Intronic
1084029255 11:66471451-66471473 TGTTAAGGTGTGGGGGCTGTGGG - Intronic
1084247016 11:67864854-67864876 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1084250652 11:67896152-67896174 TGTTGTGGGGTGGGGGTAGCGGG + Intergenic
1084797349 11:71517033-71517055 TGTTGTGGTGTGGGGGGAGGGGG + Intronic
1084873626 11:72114680-72114702 AGTAGAGATGTTGGGGCGGCAGG + Intergenic
1085001963 11:73045763-73045785 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1085481513 11:76826554-76826576 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1085966475 11:81534437-81534459 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1086012856 11:82125938-82125960 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
1086025306 11:82283324-82283346 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
1086163211 11:83746572-83746594 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1086304257 11:85462646-85462668 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1086304535 11:85465451-85465473 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1086389849 11:86351946-86351968 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1086517278 11:87627205-87627227 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
1086640976 11:89155475-89155497 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1086664373 11:89461153-89461175 TGTTGTGGGGTGGGGGGAGCCGG + Intronic
1086919296 11:92567886-92567908 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1087087294 11:94232668-94232690 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1087340763 11:96903976-96903998 TGTTGTGGGGTTGGGGGAGGAGG - Intergenic
1087352893 11:97055626-97055648 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1087505347 11:99013561-99013583 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1087580544 11:100046132-100046154 TGTTGTGGAGTTGGGGGAGGGGG + Intronic
1087911814 11:103762424-103762446 TGTTGTGGGGTTGGGGTAGAGGG + Intergenic
1088083989 11:105956254-105956276 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1088369957 11:109078226-109078248 TGTTGTGGGGTTGGGGGAGGAGG - Intergenic
1088417704 11:109607649-109607671 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1088427540 11:109720984-109721006 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
1088504799 11:110517108-110517130 AGTTGAGGTGCAGGGGCAGTGGG + Intergenic
1088740427 11:112762482-112762504 GGGTCAGGTGTGGGGGCAGCAGG + Intergenic
1088791353 11:113229928-113229950 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1088846485 11:113672636-113672658 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1089023614 11:115244247-115244269 TGTTGGGGTGGGGGTGCAGCGGG + Intronic
1089367777 11:117931624-117931646 AGTTGATGTGTTGGGGCGGGTGG + Intergenic
1089788023 11:120921965-120921987 TGGTGAGGTGTGGTGGCAGCAGG + Intronic
1089907366 11:122054549-122054571 TGTTGTGGGGTGGGGGTAGCGGG + Intergenic
1090160582 11:124489350-124489372 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1090642191 11:128739406-128739428 GGTTGAGGGGTGGGGGCAGCAGG - Intronic
1090955364 11:131508880-131508902 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1091052857 11:132389397-132389419 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1091874083 12:3919263-3919285 TGTTGGTGGGGTGGGGCAGCAGG - Intergenic
1091950113 12:4585623-4585645 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1093029892 12:14278777-14278799 TGTGCAGGTGTGGGGGCAGTAGG - Intergenic
1093279828 12:17179502-17179524 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1093364398 12:18274648-18274670 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1093404810 12:18791206-18791228 TGTTGTGGGGTCGGGGAAGCGGG + Intergenic
1093476854 12:19565630-19565652 TGTTGTGGGGTCGGGGGAGCGGG - Intronic
1093514183 12:19966474-19966496 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1093579921 12:20774935-20774957 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1093827383 12:23710386-23710408 TGTTGTGGGGTAGGGGAAGCGGG - Intronic
1094083414 12:26562761-26562783 TGTTGAGGGGTGGGGGAAGGGGG + Intronic
1094277561 12:28695619-28695641 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1094356585 12:29584588-29584610 TGTTGTGGGGTCGGGGAAGCGGG - Intronic
1094428235 12:30338174-30338196 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1094522746 12:31210007-31210029 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1094715960 12:33015510-33015532 TGTTGTGGTGTGGGGGCAGGGGG + Intergenic
1094730273 12:33166661-33166683 TGTTGTGGGGTTGGGGGAGGAGG - Intergenic
1094735919 12:33233544-33233566 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1094756605 12:33477257-33477279 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1094790072 12:33902463-33902485 TGTTGTAGGGTTGGGGAAGCAGG + Intergenic
1094795712 12:33969785-33969807 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1094859498 12:34446179-34446201 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1095072383 12:37868946-37868968 TGTTGTGGGGTGGGGGTAGCAGG + Intergenic
1095077254 12:37945769-37945791 TGTTGAGGGGTGGGGGGAGTGGG + Intergenic
1095116820 12:38363989-38364011 TGTTGCGGGGTGGGGGGAGCGGG + Intergenic
1095133981 12:38575574-38575596 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1095185107 12:39192419-39192441 TGTTGTGGGGTTGGGGAAGGGGG - Intergenic
1095216948 12:39560156-39560178 TGTTGTGGGGTGGGGGCAGCAGG - Intronic
1095429473 12:42117123-42117145 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1095696751 12:45152725-45152747 TGTTGTGGGGTAGGGGGAGCGGG - Intergenic
1096423800 12:51483884-51483906 TGTTGTGGGGTGGGGGGAGCAGG - Intronic
1096637557 12:52970570-52970592 GCTTGGGGTCTTGGGGCAGCCGG - Intergenic
1096764651 12:53874576-53874598 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1096897169 12:54833816-54833838 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1096953792 12:55504841-55504863 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1096955581 12:55522166-55522188 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1096957370 12:55540273-55540295 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1096974367 12:55690964-55690986 TGTTGTGGGGTGGGGGCAGTGGG + Intronic
1096984803 12:55749248-55749270 TGTTGAGGCGTTGGGCCAAGGGG + Intronic
1097080062 12:56423354-56423376 TTTTGAGGTCATGGGCCAGCCGG + Exonic
1097142464 12:56913750-56913772 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
1097285150 12:57871312-57871334 TGTTGAGAGGCTGAGGCAGCAGG + Intergenic
1097427825 12:59468788-59468810 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1097428859 12:59478816-59478838 TGTTGTGGGGTGGGTGCAGCGGG - Intergenic
1097599486 12:61673096-61673118 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1097605457 12:61747710-61747732 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1097667497 12:62497152-62497174 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1098002551 12:65960530-65960552 GGTTGATGTGGTGGGGCAGGTGG - Intronic
1098027078 12:66215105-66215127 TGTTGAATAGTTGGGCCAGCTGG - Intronic
1098048355 12:66426067-66426089 GGTTGTGGTGCTGGAGCAGCAGG - Intronic
1098222902 12:68289174-68289196 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1098245590 12:68513746-68513768 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1098287866 12:68926708-68926730 TGTTGTGGGGTTGGGGGAGCGGG - Intronic
1098322360 12:69258811-69258833 TGTGGAGGTGGTGGGCCAGGAGG - Exonic
1098374783 12:69803643-69803665 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1098388546 12:69944529-69944551 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1098604282 12:72371537-72371559 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1098606578 12:72397979-72398001 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1098735200 12:74092521-74092543 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1098737572 12:74126412-74126434 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1099050129 12:77771757-77771779 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
1099086412 12:78252173-78252195 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
1099146630 12:79053352-79053374 TGTTGTGGGGTGGGGGGAGCAGG + Intronic
1099267703 12:80467852-80467874 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1099312703 12:81048013-81048035 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1099377615 12:81911534-81911556 TGTTGTGGGGTAGGGGGAGCAGG - Intergenic
1099501630 12:83420508-83420530 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1099515348 12:83590077-83590099 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1099515823 12:83595540-83595562 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1099553322 12:84075274-84075296 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1099642667 12:85312566-85312588 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1099753348 12:86806851-86806873 TGTTGTGGGGTGGGGGTAGCGGG + Intronic
1099841212 12:87969906-87969928 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1099876027 12:88406566-88406588 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1100057122 12:90525381-90525403 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1100090223 12:90958842-90958864 TGTGGAGGGGTTGGGGGAGTGGG + Intergenic
1100174616 12:92015384-92015406 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1100227865 12:92577139-92577161 TGTTGTGGTGTGGGGGGAGAGGG - Intergenic
1100351002 12:93782337-93782359 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1100564381 12:95781148-95781170 TGTTGTGGGGTTGGGGGAGCAGG + Intronic
1101130588 12:101687219-101687241 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1101186686 12:102288326-102288348 TGTTGTGGGGTTGGGGAAGCGGG - Intergenic
1101324263 12:103700999-103701021 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1101418654 12:104530960-104530982 CATTAAGGTGTTGGGGAAGCCGG + Intronic
1101619568 12:106371784-106371806 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1101698519 12:107149904-107149926 TGTTGAGGGGTCGGGGGAGAGGG - Intergenic
1101883672 12:108643010-108643032 TGGTTAGCTGTGGGGGCAGCAGG - Intergenic
1102343915 12:112146014-112146036 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1102424801 12:112834577-112834599 TGCTGAGGTGGTAGGGAAGCTGG - Intronic
1102806551 12:115786466-115786488 TGTCGTGGGGTTGGGGGAGCGGG - Intergenic
1102815898 12:115866290-115866312 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1103006998 12:117429034-117429056 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1103205024 12:119122153-119122175 GTTTGAGGAGTTGGGGCATCTGG + Intronic
1103445030 12:120988932-120988954 TGTTGAGGTGTTGGGACAGGTGG - Exonic
1103446174 12:120996624-120996646 TGATGAGGTTCTGGGGCTGCTGG - Exonic
1103725631 12:122996194-122996216 TGTGGAGGGGTTGGGGGTGCAGG - Intronic
1103803934 12:123557880-123557902 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1104028669 12:125048545-125048567 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1104211502 12:126692959-126692981 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1104519836 12:129463620-129463642 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1104661522 12:130614377-130614399 TGTTGTGTTGTTAGGGCAGAGGG - Intronic
1104927535 12:132321546-132321568 TGGTGAGGTGCTAGGGCAGGGGG - Intronic
1105250553 13:18695653-18695675 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1105276118 13:18928467-18928489 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1105542660 13:21328222-21328244 TGATGAGGGGTTGGGGGTGCTGG + Intergenic
1105649591 13:22361228-22361250 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1105663115 13:22521661-22521683 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1105945876 13:25188980-25189002 TATTGAAGTTTTGGGGCAGGTGG + Intergenic
1106032045 13:26012679-26012701 TGATGAGGAGTTGGGGGAGCGGG + Intronic
1106130760 13:26937475-26937497 TGTGGTGGTGGTGGGGGAGCTGG - Intergenic
1106302813 13:28484926-28484948 TGTTGTGGTGTGGGGGGAGGGGG + Intronic
1106348871 13:28908287-28908309 TGTTGTGGGGTTGGGGGAGGTGG - Intronic
1106886872 13:34196354-34196376 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1106908903 13:34441028-34441050 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1106933112 13:34688572-34688594 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1107615540 13:42163008-42163030 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1107712414 13:43163271-43163293 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1108329918 13:49375641-49375663 TGTTGTGGGGTCGGGGGAGCGGG + Intronic
1108428613 13:50331291-50331313 TGTTGTGGGGTCGGGGGAGCGGG - Intronic
1108882008 13:55132046-55132068 TGTTGTGGGGTGGGGGTAGCGGG - Intergenic
1109064483 13:57668987-57669009 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1109084536 13:57952582-57952604 TGTTGGGGGGTTGAGGCAGGTGG - Intergenic
1109315121 13:60740909-60740931 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1109565448 13:64108169-64108191 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1109592367 13:64502946-64502968 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1109701779 13:66035246-66035268 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1109896558 13:68699377-68699399 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
1110146674 13:72200652-72200674 TGTTGTGGGGTAGGGGGAGCGGG - Intergenic
1110396199 13:75032427-75032449 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
1110457700 13:75708943-75708965 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1110459295 13:75727771-75727793 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1110507045 13:76299034-76299056 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1110590215 13:77247986-77248008 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
1110991823 13:82051214-82051236 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1111096401 13:83521751-83521773 TGTTGAGGGGTGGGGGGAGGGGG - Intergenic
1111185428 13:84727951-84727973 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1111371225 13:87320278-87320300 TGTTGCGGGGTGGGGGGAGCGGG + Intergenic
1111415649 13:87940184-87940206 TGTGGAGGTGTTGGGAGGGCGGG + Intergenic
1111452998 13:88444248-88444270 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1111593141 13:90375652-90375674 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1111747341 13:92286730-92286752 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1111782850 13:92751592-92751614 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1111800300 13:92973293-92973315 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1111840226 13:93440840-93440862 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1111874878 13:93880559-93880581 TGTTGTGGGGTTGGGGGAGGAGG + Intronic
1112041418 13:95552381-95552403 TGGTGAGGTGGGGGCGCAGCAGG + Intronic
1112087923 13:96051327-96051349 TGTTGTGGGGTTGGGGGAGCGGG + Intronic
1112145733 13:96698191-96698213 TGTTGTGGGGTGGGGGGAGCAGG - Intronic
1112246201 13:97736274-97736296 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1112316701 13:98369511-98369533 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1112405515 13:99116375-99116397 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1112482182 13:99786352-99786374 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1112667961 13:101598581-101598603 TGTTGTGTGGTGGGGGCAGCGGG - Intronic
1112713601 13:102158515-102158537 TGTTGTGGGGTGGGGGTAGCGGG + Intronic
1112961731 13:105135200-105135222 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1113281837 13:108796762-108796784 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1113487410 13:110664383-110664405 TGTTGGGATGTTGGGACTGCAGG - Intronic
1113599440 13:111558194-111558216 TGTAGACGTCTTGGGGAAGCTGG + Intergenic
1113720095 13:112549329-112549351 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1114034150 14:18606139-18606161 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1114048527 14:18898565-18898587 TGTTGTGGGGTGGAGGCAGCGGG + Intergenic
1114078948 14:19185317-19185339 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1114113985 14:19503081-19503103 TGTTGTGGGGTGGAGGCAGCGGG - Intergenic
1114115684 14:19620833-19620855 TGTTGTGGGGTGGAGGCAGCGGG - Intergenic
1114124493 14:19708870-19708892 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1114145013 14:19965147-19965169 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
1114154254 14:20082536-20082558 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1114569933 14:23659694-23659716 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1114585872 14:23813226-23813248 TGTTGTGGGGTAGGGGGAGCGGG - Intergenic
1114718216 14:24851383-24851405 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1114798691 14:25745482-25745504 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
1114815169 14:25948757-25948779 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1114874266 14:26696161-26696183 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1115045873 14:28993360-28993382 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1115046870 14:29005262-29005284 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1115067835 14:29286236-29286258 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1115325357 14:32131730-32131752 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1115525300 14:34274073-34274095 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1115614090 14:35076437-35076459 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1115712214 14:36062755-36062777 TGTACAAGTGTTGGGGGAGCTGG - Intergenic
1115737759 14:36353185-36353207 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1115764430 14:36608330-36608352 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1115893497 14:38058814-38058836 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1116025776 14:39512512-39512534 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1116038911 14:39661867-39661889 TGTTGTGGTGTTGGGGGAGGGGG + Intergenic
1116184638 14:41582518-41582540 TGTTGTGGAGTTGGGGGAGGGGG - Intergenic
1116200813 14:41792993-41793015 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1116252163 14:42499940-42499962 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1116339627 14:43704501-43704523 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1116585797 14:46701605-46701627 TGTTGTGGTGTGGGGGGAGAGGG - Intergenic
1116618222 14:47165096-47165118 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1116872304 14:50079835-50079857 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1117092144 14:52262034-52262056 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1117093976 14:52278462-52278484 TGTTGTGGGGTGGGGGGAGCTGG + Intergenic
1117115721 14:52508900-52508922 TGTTGTGGGGTGGGGGCAGCGGG + Intronic
1117505393 14:56397415-56397437 TGTTGTGGCGTGGGGGAAGCGGG + Intergenic
1117511920 14:56460390-56460412 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1117624658 14:57622664-57622686 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
1117646471 14:57858525-57858547 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
1118020419 14:61707452-61707474 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1118064268 14:62173930-62173952 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1118153689 14:63217233-63217255 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1118518868 14:66558883-66558905 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1118562009 14:67095774-67095796 TGTTGTGGGGTGGGGGGAGCAGG + Intronic
1118646325 14:67844765-67844787 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1118664212 14:68049202-68049224 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1119155800 14:72409709-72409731 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
1119194478 14:72706972-72706994 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1119700626 14:76752110-76752132 TGTTGTGGGGTCGGGGGAGCGGG + Intergenic
1120233496 14:81864749-81864771 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1120569972 14:86105602-86105624 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1120598855 14:86475121-86475143 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1120624474 14:86807590-86807612 TGTTGTGGGGTGGGGGAAGCAGG - Intergenic
1120722680 14:87905485-87905507 TGCTGTGGTGCTGGGGCAGGAGG + Intronic
1120781040 14:88486025-88486047 GGTTGACGGGTTGGGGCAGCAGG - Intronic
1121597401 14:95175647-95175669 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1122606241 14:102948684-102948706 TGTGGAGGTGAGGGGGGAGCAGG + Intronic
1122805689 14:104255537-104255559 GGTAGAGGTGTTGGGGGAGAGGG - Intergenic
1122805753 14:104255765-104255787 GGTAGAGGTGTTGGGGGAGGGGG - Intergenic
1122808889 14:104277934-104277956 TGGTGAGGTGTGTGGGCTGCTGG + Intergenic
1202880920 14_KI270722v1_random:59083-59105 TGTTGGGGGGTGGGGGCAGGGGG + Intergenic
1123392838 15:19894174-19894196 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1123543024 15:21314302-21314324 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1123727899 15:23123294-23123316 TGTTGTGGTGTTGGGGGAGGGGG - Intergenic
1124817109 15:33005034-33005056 TGTTGTGGGGTGGGGGTAGCGGG + Intronic
1125054257 15:35339027-35339049 TGTTGTGGGGTGGGGGTAGCGGG + Intronic
1125055242 15:35352426-35352448 TGTTGTGGGGTGGGGGTAGCGGG - Intronic
1125058032 15:35385992-35386014 TGTTGTGGGGTGGGGGTAGCAGG - Intronic
1125222395 15:37354346-37354368 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1125226249 15:37399610-37399632 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1125466550 15:39958788-39958810 TGTGTAGATGTTGGGGCAGGAGG - Intronic
1125500854 15:40239636-40239658 TCTGGAGGTGTTGGGACAGAAGG + Exonic
1125721340 15:41846554-41846576 TGTGGGGGTGTTGGTTCAGCAGG + Intronic
1125909230 15:43421274-43421296 TGCTGAGCCTTTGGGGCAGCAGG + Intronic
1126017227 15:44364038-44364060 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1126212000 15:46110503-46110525 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1126500255 15:49337670-49337692 TGTTGAGGGGGTGGGGCTGTGGG - Intronic
1126976179 15:54184413-54184435 TGTTGTGGGGTGGGGGAAGCGGG - Intronic
1127017483 15:54704807-54704829 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1127032346 15:54877679-54877701 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1127118988 15:55754914-55754936 TGGTGGGGTGATGTGGCAGCAGG + Intergenic
1127677439 15:61255528-61255550 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1128049757 15:64653705-64653727 TGTTTAGGGGTTGGGGGAGTGGG - Intronic
1128722517 15:69960936-69960958 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1128824666 15:70702266-70702288 TGTTGCAGTGTTGAGGCAGCAGG - Intronic
1129047264 15:72746654-72746676 TATGCATGTGTTGGGGCAGCTGG + Intergenic
1129351908 15:74960430-74960452 GGAGGAGGTGTTGGGGTAGCTGG + Intronic
1129730213 15:77926391-77926413 TGCTGGGGTGTTGGGGCTGGGGG + Intergenic
1129916940 15:79282619-79282641 GGTCGAGGGGGTGGGGCAGCAGG + Intergenic
1130121454 15:81051729-81051751 TGTTGTGGTGTGGGGGAAGGCGG - Intronic
1130302479 15:82690399-82690421 TGTTGTGGCGTTGGGGGAGGAGG - Intronic
1130739466 15:86582856-86582878 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1130739612 15:86584756-86584778 TGTTGATTTCTTTGGGCAGCAGG + Intronic
1130873261 15:87989498-87989520 TGTTGTGGAGTTGGGGGAGGGGG + Intronic
1130922815 15:88363036-88363058 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1131192540 15:90328633-90328655 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1131331770 15:91506481-91506503 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1131444799 15:92488998-92489020 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1131552802 15:93372548-93372570 AGAAGAGGTGTTGGGGCAGAGGG + Intergenic
1131926852 15:97394353-97394375 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1132218857 15:100089827-100089849 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1202951343 15_KI270727v1_random:41432-41454 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1132470165 16:98092-98114 TGTGGCGGTGCTGGGGCATCAGG - Intronic
1132709888 16:1261763-1261785 TGGGGAGGTGCTGGGGCTGCTGG - Intergenic
1133046775 16:3092521-3092543 TGGTGAGAGGGTGGGGCAGCGGG - Exonic
1133601693 16:7345973-7345995 TGTTGTGGGGTTGGAGGAGCTGG - Intronic
1133830317 16:9317264-9317286 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1134298404 16:12967404-12967426 TGTTGTGGGGTTGGGGGAGCGGG + Intronic
1134364673 16:13565913-13565935 TGTTGTGGGGTTAGGGGAGCGGG + Intergenic
1134898527 16:17912398-17912420 TGTTGTGGGGTTGGGGGAGGAGG + Intergenic
1135032718 16:19051398-19051420 TGTTGTGGTGTGGGGGGAGGGGG - Intronic
1135569143 16:23535008-23535030 TGTTGAGGAGCAGGGGCAGGTGG + Exonic
1135640985 16:24119586-24119608 TGCTAAGGTGATGGGGCAGCAGG + Intronic
1135896730 16:26412262-26412284 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1136992787 16:35165996-35166018 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1137066706 16:35854067-35854089 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1137088034 16:36153497-36153519 TGTGGTGGGGTTGGGGGAGCGGG - Intergenic
1137355638 16:47760514-47760536 TGTTGAGGGGTGGGGGGAGGGGG + Intergenic
1137747542 16:50834222-50834244 TTTTGAGGAATTGGGGCAGGAGG + Intergenic
1138165683 16:54799592-54799614 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1138357760 16:56397523-56397545 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
1138377985 16:56579958-56579980 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1138720943 16:59078237-59078259 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1138858781 16:60729690-60729712 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1138972403 16:62161503-62161525 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1138983637 16:62300364-62300386 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
1139009160 16:62611323-62611345 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
1139102370 16:63784184-63784206 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1140167737 16:72571419-72571441 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1140216893 16:73015863-73015885 TGTTGTGCAATTGGGGCAGCCGG - Intronic
1140337035 16:74117459-74117481 TGTTGGGGGGTGGGGGAAGCAGG + Intergenic
1141049641 16:80748706-80748728 GGTTGTGGTGTTGGGCCAGATGG - Intronic
1141170647 16:81688804-81688826 TGTTGTGGGGTTGGGGGAGGAGG - Intronic
1141211278 16:81982264-81982286 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1141859127 16:86704616-86704638 TGGTCAGGGGTCGGGGCAGCAGG - Intergenic
1142946047 17:3428103-3428125 TGTTGGGGTGGGGGGGCAGTAGG + Intergenic
1142963937 17:3569112-3569134 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
1143117796 17:4590547-4590569 TGTTGAGGGCCTGGGGCACCTGG - Intronic
1143422182 17:6802628-6802650 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1143841182 17:9732995-9733017 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1143876234 17:9992750-9992772 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1144041863 17:11419059-11419081 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1144137017 17:12305444-12305466 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1144204160 17:12967448-12967470 TGTTGAGGAATTGAGGCAGGAGG - Intronic
1144851310 17:18245413-18245435 TGTAGACCTGTGGGGGCAGCAGG + Exonic
1145402756 17:22555718-22555740 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
1146462708 17:33059304-33059326 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1146519833 17:33517694-33517716 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1146624205 17:34423657-34423679 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1146699465 17:34943609-34943631 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
1147414501 17:40278800-40278822 TGGTGGGGTGGGGGGGCAGCAGG - Exonic
1147853732 17:43462486-43462508 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1148556465 17:48581697-48581719 TCTTGGGGTGCTGGGGCACCTGG - Intronic
1149372450 17:56008454-56008476 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1149409182 17:56386316-56386338 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1150123148 17:62619766-62619788 GGTGGAGGTGGTGGGCCAGCTGG + Intergenic
1150291889 17:63987148-63987170 TGTTGGGGGGATGGGGCTGCTGG - Intergenic
1150901338 17:69280877-69280899 TATTGTGGGGTTGGGGGAGCGGG + Intronic
1151060504 17:71087367-71087389 TGTTGGGGTGTTGTGGGGGCAGG - Intergenic
1151106122 17:71618877-71618899 TGTTGCGGGGTTGGGGGAGGGGG + Intergenic
1152236874 17:79143462-79143484 TTCTGAGCTGTGGGGGCAGCAGG - Intronic
1153091792 18:1355146-1355168 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1153106607 18:1535280-1535302 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1153114706 18:1641325-1641347 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1153420385 18:4898559-4898581 TGTTGTGGGGTCGGGGGAGCGGG + Intergenic
1153494239 18:5681437-5681459 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1153529808 18:6034293-6034315 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1153674569 18:7445345-7445367 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1153928166 18:9854124-9854146 TGTTGAGGGGTTGGGGGTGGGGG - Intronic
1154121645 18:11657231-11657253 TGTGGAGGTGCTGGGGAAGCAGG - Intergenic
1154478178 18:14788540-14788562 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1155535758 18:26815824-26815846 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1155660815 18:28246290-28246312 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1155710935 18:28878583-28878605 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1155768904 18:29672454-29672476 TGTTGAGGAGTAGGGGCTGGGGG - Intergenic
1155770105 18:29686159-29686181 TGTTGTGGCGTTGGGGGAGGGGG - Intergenic
1156004368 18:32422135-32422157 TGTTGTGGGGTTGGGGAAGGGGG - Intronic
1156116622 18:33793841-33793863 TGTTGTGGGGTTGGGGGAGGTGG + Intergenic
1156203916 18:34865197-34865219 TGTTGGTGTGTTGGGGCCGTGGG - Intronic
1156308684 18:35903471-35903493 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1156374912 18:36504587-36504609 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1156805164 18:41169662-41169684 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
1156916625 18:42469808-42469830 TGTTCAGTTGTTTGGGCAGAAGG - Intergenic
1156981360 18:43291913-43291935 TGTTGCGGGGTTGGGGGAGTGGG + Intergenic
1157031023 18:43908783-43908805 TGTTGTGGGGTTGGGGTAGGGGG - Intergenic
1157155437 18:45261159-45261181 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1157155483 18:45261554-45261576 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
1157335897 18:46737158-46737180 GGCTGAGGTGTTGAGGCAGGAGG - Intronic
1157631512 18:49102562-49102584 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
1157646787 18:49281798-49281820 TGTTGTGGAGTGGGGGCAGGGGG + Intronic
1157702485 18:49771215-49771237 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1157739620 18:50080834-50080856 TGCTGAGGTGTTCATGCAGCAGG + Intronic
1157772857 18:50365125-50365147 TGTTGTGGGGTTGGGGGAGGAGG - Intergenic
1158047799 18:53177174-53177196 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1158702632 18:59762396-59762418 TGTGCATGTGTTGGGGCAGGGGG + Intergenic
1158730536 18:60017849-60017871 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1159349338 18:67251740-67251762 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1159385580 18:67721367-67721389 TGTTGTGGGGTAGGGGCAGCGGG + Intergenic
1159387639 18:67746138-67746160 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
1159516484 18:69465452-69465474 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1159591766 18:70343086-70343108 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1159722164 18:71905517-71905539 TGTTGCGGGGTGGGGGGAGCGGG - Intergenic
1159830289 18:73269096-73269118 TTTTGAAATGTTGGGTCAGCTGG + Intergenic
1160351494 18:78184944-78184966 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
1161878969 19:6933799-6933821 TCTTGGTGTGTGGGGGCAGCGGG - Intronic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1162136937 19:8561252-8561274 TGTGGAGGTGTGGCTGCAGCAGG + Intronic
1162927278 19:13936865-13936887 TGTGGGGGTGTTGGGGCATTTGG - Intronic
1163827123 19:19529984-19530006 TGTTGAGTTTTGGGGGCAGGAGG + Intronic
1164236491 19:23341172-23341194 TCCTGAGGAGTTGGGGCTGCAGG + Intronic
1164387734 19:27790304-27790326 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1164971468 19:32536493-32536515 TGCAGAGGTGATGGGGGAGCAGG - Intergenic
1165011595 19:32852016-32852038 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1165352275 19:35282327-35282349 TGTTCAGGGGGTGGGGCAGACGG - Intronic
1166613393 19:44220804-44220826 TGTTGTGGGGTTGGGGGAGGCGG - Intronic
1167095684 19:47373837-47373859 TGACCAGGTGTTGGGGCAGCTGG + Intronic
1167269463 19:48499172-48499194 TGCCGAGGTCTTGGGGGAGCGGG - Exonic
1168268950 19:55239418-55239440 TGATGAGGAGTTTGGGGAGCAGG - Exonic
1168390405 19:56002611-56002633 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1202656524 1_KI270708v1_random:28190-28212 TGTTGAGGGGTGGGGGCAGGGGG + Intergenic
925132925 2:1506032-1506054 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
925352813 2:3213995-3214017 TGTCGTGGGGTTGGGGGAGCGGG - Intronic
925431112 2:3794511-3794533 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
925963834 2:9044314-9044336 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
926038200 2:9651714-9651736 TGTTGTGGGGTCGGGGGAGCGGG + Intergenic
926265637 2:11317761-11317783 TGTTGTGGGGTTGGGGGAGCGGG - Intronic
926461917 2:13140632-13140654 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
926478683 2:13359600-13359622 TCATGTGGTGTTGGGCCAGCAGG - Intergenic
926568215 2:14501596-14501618 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
926615746 2:14995206-14995228 TGTTGTGGAGTGGGGGCAGGGGG - Intergenic
926711180 2:15882284-15882306 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
926925499 2:17983276-17983298 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
926957274 2:18315252-18315274 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
927273591 2:21241087-21241109 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
927574985 2:24193570-24193592 TGTTGTGGGGTTGGGGGAGCGGG - Intronic
928034872 2:27812702-27812724 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
928041045 2:27878177-27878199 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
928046352 2:27936793-27936815 TGTTGTGGGGTAGGGGCAGGGGG + Intronic
928193288 2:29193753-29193775 GGCAGAGGTGGTGGGGCAGCTGG + Exonic
928204765 2:29276077-29276099 AATTGAGGGGTCGGGGCAGCAGG - Intronic
928268057 2:29829160-29829182 TGTTGAGGGGTGGGGGGAGGGGG + Intronic
928390876 2:30910055-30910077 TGTTGAGGGGTGGGGGGAGGGGG + Intergenic
928457764 2:31438802-31438824 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
928463923 2:31502287-31502309 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
928713334 2:34031985-34032007 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
928765577 2:34641311-34641333 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
928810196 2:35214996-35215018 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
928811517 2:35233578-35233600 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
928817707 2:35319904-35319926 TGTTGCGGGGTTGGGGGAGAGGG - Intergenic
929339915 2:40802532-40802554 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
929360487 2:41082851-41082873 TGTTGTGGGGTTGGGGGAGGTGG + Intergenic
929415283 2:41740925-41740947 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
929420784 2:41787518-41787540 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
930606928 2:53502507-53502529 TGTTGTGGTGTCGGGGGAGGGGG - Intergenic
930904621 2:56551743-56551765 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
930962833 2:57282188-57282210 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
931019629 2:58028731-58028753 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
931108708 2:59086893-59086915 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
931124036 2:59253747-59253769 TGCAGAGGTCTTGGGGCATCTGG + Intergenic
931280719 2:60789172-60789194 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
931427371 2:62183513-62183535 TGGTGAGGTGTTGGAGCAGCTGG + Intergenic
931482283 2:62653474-62653496 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
931791274 2:65666296-65666318 TGTTGAGGAGGTTGGGCAGTAGG + Intergenic
931810812 2:65853124-65853146 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
931920159 2:67006412-67006434 TGGGGAGGTGTGGGGGCATCAGG + Intergenic
931928176 2:67098128-67098150 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
931981660 2:67699644-67699666 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
932064556 2:68540156-68540178 TGTTGAGGGGTGGGGGCAAGGGG - Intronic
932111481 2:69005426-69005448 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
932649945 2:73544360-73544382 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
932733009 2:74233630-74233652 AGTTGAGGAGGTGGGACAGCAGG - Intronic
932864984 2:75332158-75332180 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
932926201 2:75978055-75978077 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
932929076 2:76012433-76012455 TGTTGTGGAGTAGGGGGAGCGGG - Intergenic
932992237 2:76801509-76801531 TGTTGTGGTGTGGGGGGAGGGGG + Intronic
933093755 2:78152296-78152318 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
933257041 2:80093150-80093172 TGTTGTGGGGTTGGGGGAGCAGG - Intronic
933381942 2:81559074-81559096 TGTTGTGGGGTTGGGGAAGGGGG + Intergenic
933565630 2:83947106-83947128 TGTTGAAGTGATGGGGCCGAGGG + Intergenic
933622578 2:84560605-84560627 TGTTGTGGGGTGGGGGAAGCGGG - Intronic
934116090 2:88795021-88795043 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
934154598 2:89184563-89184585 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
934320989 2:91971709-91971731 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
934511685 2:94949577-94949599 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
934680011 2:96276954-96276976 AGTTGTGGTGCTGGTGCAGCTGG - Exonic
934698650 2:96420527-96420549 TGTTGTGGGGTTGGGGGAGGCGG - Intergenic
934715844 2:96542798-96542820 TGCTGAGGCTCTGGGGCAGCAGG + Intronic
934805870 2:97225771-97225793 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
935361226 2:102247670-102247692 TGGTGAGGTCATGGGGCAGTAGG + Intergenic
935423954 2:102900006-102900028 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
935475570 2:103517935-103517957 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
935673011 2:105571645-105571667 TGTGGAGGCCTTGGGGCAGCAGG + Intergenic
935925488 2:108064395-108064417 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
936943528 2:117910256-117910278 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
937452389 2:122012333-122012355 TGTGGAGGTCTTGGGGCCACAGG + Intergenic
937507799 2:122556654-122556676 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
937519597 2:122696083-122696105 TGTTGTGGGGTTGGGGGAGGCGG - Intergenic
937559033 2:123197820-123197842 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
937602577 2:123756447-123756469 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
937850792 2:126633531-126633553 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
938567722 2:132534834-132534856 TGTTGTGGGGTTGGGGGAGGAGG + Intronic
938627694 2:133129241-133129263 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
938808709 2:134831290-134831312 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
938865739 2:135417955-135417977 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
939099486 2:137879950-137879972 TCTTGAGGTGGTGGGGGAGGAGG - Intergenic
939205861 2:139102990-139103012 TGTTGAGGGGTGGGGGGAGGGGG - Intergenic
939434442 2:142155653-142155675 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
939938627 2:148322991-148323013 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
940376748 2:152966499-152966521 TGTTGTGCTGATGTGGCAGCGGG + Intergenic
940416915 2:153433975-153433997 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
940634590 2:156283553-156283575 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
940672532 2:156688332-156688354 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
940686666 2:156859099-156859121 TGTTGTGGGGTAGGGGGAGCGGG - Intergenic
940754933 2:157671327-157671349 TGTTGTGGGATTGGGGGAGCGGG - Intergenic
940755561 2:157677759-157677781 TGTTGTGGGATTGGGGGAGCAGG + Intergenic
940778663 2:157910318-157910340 CGTGGAGGTGGTGGGGGAGCAGG + Intronic
941120630 2:161526365-161526387 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
941345302 2:164361359-164361381 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
941445951 2:165600079-165600101 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
941586404 2:167364484-167364506 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
941775962 2:169394051-169394073 TGTTGTGGAGTTGGGGGAGGAGG - Intergenic
942436819 2:175987518-175987540 TGTTGTGGGGTGGGGGGAGCAGG + Intronic
942685361 2:178525013-178525035 TGTTGTGGGGTTGGGGGAGGCGG - Intergenic
943012078 2:182462150-182462172 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
943048059 2:182881955-182881977 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
943097532 2:183448453-183448475 TGTTGTGGTGTGGGGAGAGCGGG - Intergenic
943268399 2:185767163-185767185 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
943558780 2:189436370-189436392 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
943766924 2:191673043-191673065 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
943823899 2:192363039-192363061 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
943858839 2:192834085-192834107 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
943932865 2:193877461-193877483 TGTTGCGGGGTGGGGGGAGCGGG - Intergenic
943935929 2:193917484-193917506 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
943998650 2:194804542-194804564 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
944030999 2:195234295-195234317 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
944033401 2:195264633-195264655 TGTTGTGGAGTTGGGGGAGGGGG - Intergenic
944437211 2:199703201-199703223 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
944490286 2:200251625-200251647 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
944988466 2:205206362-205206384 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
945393061 2:209287685-209287707 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
945496357 2:210511377-210511399 TGTTGTGGGGTGGGGGTAGCGGG + Intronic
945551394 2:211225176-211225198 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
945728957 2:213508762-213508784 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
945814671 2:214589839-214589861 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
945823255 2:214689637-214689659 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
945826176 2:214722618-214722640 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
945865677 2:215172379-215172401 TGTTGGGGGGTTGGGGGAGGTGG - Intergenic
945870995 2:215226166-215226188 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
945973749 2:216254610-216254632 TGTGGAGGTGAGAGGGCAGCGGG - Intergenic
946636666 2:221736314-221736336 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
946990523 2:225324148-225324170 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
947024010 2:225716114-225716136 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
947027076 2:225748124-225748146 TGTTGTGGGGTCGGGGGAGCGGG + Intergenic
947034279 2:225834136-225834158 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
947245690 2:228045593-228045615 TGTTGCGGGATTGGGGGAGCGGG + Intronic
947423924 2:229965520-229965542 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
947492728 2:230609968-230609990 TGTTGAGGTGTGGGGGCTGGGGG + Intergenic
947902556 2:233733951-233733973 TGTTGTGGGGTAGGGGGAGCGGG + Intronic
948098498 2:235355449-235355471 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
948438764 2:237971866-237971888 TGTGCATGTGTTGGGGCAGGGGG + Intronic
948451015 2:238071637-238071659 TGCAGAGGTTTAGGGGCAGCAGG - Intronic
948526065 2:238571588-238571610 TGTTGTGGAGCTGGGCCAGCTGG - Intergenic
948674229 2:239587686-239587708 GGGTGGGGTGTCGGGGCAGCGGG + Intergenic
948814363 2:240502364-240502386 TGCTGAGATGTTGGGCCAGAGGG - Intronic
948949173 2:241237994-241238016 GGTTGAGCTGTTTGGGCGGCAGG - Intronic
949075098 2:242052072-242052094 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1168919304 20:1517647-1517669 TGTGGAAATGTTGGGGAAGCAGG + Intergenic
1169556801 20:6759892-6759914 TGTCGTGGGGTGGGGGCAGCGGG + Intergenic
1169607717 20:7341198-7341220 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1169679667 20:8196814-8196836 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1169726075 20:8733634-8733656 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1169779815 20:9296853-9296875 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1169821494 20:9715891-9715913 TGTTGAGGGGTTGGGGGAGGGGG + Intronic
1170248772 20:14255530-14255552 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1170343376 20:15354345-15354367 TGTTGTGGGGTGGGGGTAGCGGG + Intronic
1170502532 20:16989380-16989402 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
1170505355 20:17020189-17020211 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1170754444 20:19187212-19187234 TGTAGTGGGGTTGGGACAGCAGG - Intergenic
1171058581 20:21932941-21932963 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1171075728 20:22120919-22120941 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1171167800 20:22987737-22987759 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1171192391 20:23168161-23168183 TGTCGTGGGGTTGGGGGAGCAGG - Intergenic
1171207465 20:23292202-23292224 TGTTGTGGGGTCGGGGGAGCGGG + Intergenic
1171245330 20:23606147-23606169 TGCGGAGGTGCTGGGGCAGCTGG - Intergenic
1171368626 20:24645643-24645665 TGGTGAGGTGAGGGGACAGCAGG - Intronic
1171514043 20:25713799-25713821 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1171515578 20:25730053-25730075 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1171535427 20:25883589-25883611 TGTTGTGGTGTCGGGGGAGGGGG + Intergenic
1171980953 20:31628433-31628455 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1172866968 20:38107742-38107764 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1172977645 20:38918739-38918761 TGGGGAGGTGTCAGGGCAGCTGG + Exonic
1173045653 20:39507773-39507795 TGTTGTGGGGTGGGGGCAGAGGG - Intergenic
1173082888 20:39886710-39886732 TGTGGAGGTGATGGGGCAATGGG - Intergenic
1173300850 20:41801443-41801465 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1173396748 20:42687441-42687463 TGTTGAGGTTTTGGGGGATAAGG - Intronic
1173445064 20:43110321-43110343 TTCTGAGGTGTTGGGTCATCGGG - Intronic
1174542674 20:51302253-51302275 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1175029603 20:55938909-55938931 TGTTGTGGGGTGGGGGCAGCGGG - Intergenic
1175279551 20:57793982-57794004 TGTCAAGGTGGTGGAGCAGCAGG + Intergenic
1175633019 20:60557918-60557940 TGTTGTGGGGTTAGGGGAGCGGG - Intergenic
1175848447 20:62072393-62072415 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1176025223 20:62982237-62982259 TGGGGAGGGGTTGGGGCAGCTGG - Intergenic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1176285085 21:5015237-5015259 TGTTGAGGGGCGGGGGCAGCTGG - Intergenic
1176457384 21:6926199-6926221 TGTTGTGGGGTCGGGGGAGCGGG - Intergenic
1176644138 21:9333867-9333889 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1176700952 21:10049058-10049080 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1176771095 21:13074556-13074578 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1176835557 21:13791283-13791305 TGTTGTGGGGTCGGGGGAGCGGG - Intergenic
1176839000 21:13822608-13822630 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1176909120 21:14541126-14541148 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1177085891 21:16703538-16703560 TGTTGTGGGGTGGGGGTAGCAGG - Intergenic
1177253350 21:18625774-18625796 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1177272705 21:18870221-18870243 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1177299732 21:19226999-19227021 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1177392636 21:20496052-20496074 TGTTGTGCTGTTGGGGGAGGGGG - Intergenic
1177458382 21:21375008-21375030 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
1177492080 21:21839407-21839429 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1177568979 21:22861146-22861168 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1177577267 21:22975019-22975041 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1177692951 21:24534521-24534543 TGTTGTGGGGTTGAGGGAGCGGG - Intergenic
1177761663 21:25408571-25408593 TGGTGAGGGGTTGGGGGGGCAGG + Intergenic
1177818449 21:26003783-26003805 AGTTGAGGTGATGGGGAATCAGG - Intronic
1177975947 21:27850249-27850271 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1178041924 21:28648931-28648953 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1178220923 21:30658992-30659014 TGTTGAGGGGTGGGGGGAGGGGG + Intergenic
1178338342 21:31763956-31763978 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1178641760 21:34350289-34350311 TGGTGAGGATTTGGAGCAGCTGG + Intergenic
1179078352 21:38145125-38145147 TGGTGAGGATGTGGGGCAGCAGG - Intronic
1179872096 21:44248238-44248260 TGTTGAGGGGCGGGGGCAGCTGG + Intronic
1180106495 21:45622297-45622319 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1180176497 21:46093013-46093035 TGTTGAGGTGTGGTGTCCGCAGG + Intergenic
1180368806 22:11965361-11965383 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1180401508 22:12433514-12433536 TGTTGTGGTGTTGGGGGAGTGGG + Intergenic
1180458269 22:15533186-15533208 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1180467067 22:15621227-15621249 TGTTGTGGGGTGGAGGCAGCGGG + Intergenic
1180524389 22:16241024-16241046 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1180694252 22:17741930-17741952 TGATGAGGTGCTGGAGGAGCTGG - Intronic
1180717105 22:17879269-17879291 CGCTGTGGTGGTGGGGCAGCGGG - Intronic
1180802536 22:18638529-18638551 TGTTCAGGTGTGGGGGAAGCAGG - Intergenic
1180853772 22:19034085-19034107 TGTTCAGGTGTGGGGGAAGCAGG - Intergenic
1181219187 22:21356732-21356754 TGTTCAGGTGTGGGGGAAGCAGG + Intergenic
1181344941 22:22212161-22212183 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1181470766 22:23137957-23137979 TAGTTAGGTGTTGGGGCAACAGG - Intronic
1181994969 22:26870190-26870212 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1182197585 22:28534907-28534929 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1182707440 22:32294810-32294832 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1182762928 22:32737461-32737483 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1182805502 22:33066504-33066526 TGTGCATGTGTTGGGGCAGGGGG + Intergenic
1182832975 22:33318592-33318614 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
1182992252 22:34779234-34779256 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1183932499 22:41243978-41244000 TGGTGAGGATTTGGGGCAACTGG - Intergenic
1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG + Intronic
1184160090 22:42692746-42692768 TGTTGAGGAGCTGTGGGAGCAGG - Exonic
1184210072 22:43030285-43030307 TGTTGAGGTGTCAGGGCAATAGG - Intergenic
1184756026 22:46516452-46516474 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
949209759 3:1483459-1483481 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
949276934 3:2294823-2294845 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
949458846 3:4268231-4268253 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
949635621 3:5978605-5978627 TATTGAGGAGGTGGGGCAGGGGG + Intergenic
949652401 3:6175439-6175461 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
949664450 3:6320749-6320771 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
949765872 3:7525110-7525132 TGTTGAGGGGTGGGGGTAGGGGG + Intronic
950176626 3:10879352-10879374 TGTTGGTGTGTTTTGGCAGCTGG + Intronic
950268748 3:11595831-11595853 TGTTGTGGTGTGGGGGGGGCGGG + Intronic
950596644 3:13989859-13989881 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
950645402 3:14373951-14373973 TGTGGAGGTGTGGGGGCAGGTGG - Intergenic
951042145 3:17999839-17999861 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
951125779 3:18981922-18981944 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
951176505 3:19607123-19607145 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
951286066 3:20815571-20815593 TGTTGTGGGGTTGGGGGAGGTGG - Intergenic
951354838 3:21652620-21652642 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
951412998 3:22387766-22387788 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
951413538 3:22395415-22395437 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
951433640 3:22637175-22637197 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
951471726 3:23063774-23063796 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
951769428 3:26239226-26239248 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
951774471 3:26294394-26294416 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
951795117 3:26530274-26530296 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
951831819 3:26937882-26937904 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
952020716 3:29016159-29016181 TCTTGGGTTGTTGGAGCAGCTGG - Intergenic
952320057 3:32268439-32268461 TGTTGTGGGGTAGGGGGAGCAGG + Intronic
952320286 3:32270715-32270737 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
952341166 3:32448823-32448845 TGTGGATGTGTGGTGGCAGCTGG - Intronic
952680775 3:36088721-36088743 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
952743917 3:36760471-36760493 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
952801548 3:37297305-37297327 TGGTGGGGTGGTGGGGCGGCGGG + Intronic
953053373 3:39366788-39366810 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
953129012 3:40119761-40119783 TGTTGTGGGGTGGGGGGAGCAGG + Intronic
953225420 3:41014604-41014626 TGATAAGGTGTTTGAGCAGCTGG + Intergenic
953265862 3:41387519-41387541 TGTTGTGGAGTTGGGGGAGTAGG - Intronic
953471181 3:43168089-43168111 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
953513921 3:43571680-43571702 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
954477537 3:50762101-50762123 TGTTGTGGGGTGGGGGCAGCGGG + Intronic
954500236 3:51006769-51006791 TGTTGTGGGGTAGGGGGAGCAGG - Intronic
954513289 3:51147486-51147508 TGTTGTGGTGTGGGGTCAGGGGG - Intronic
954528012 3:51290530-51290552 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
954548708 3:51461907-51461929 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
955428035 3:58812550-58812572 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
955622449 3:60878635-60878657 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
955637801 3:61048970-61048992 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
955902383 3:63771029-63771051 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
956760884 3:72443520-72443542 TGTGGAGGTTCAGGGGCAGCAGG - Intronic
957092536 3:75746019-75746041 TGTTGTGGGGTAGGGGGAGCAGG - Intronic
957130749 3:76220172-76220194 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
957147237 3:76440396-76440418 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
957158322 3:76575170-76575192 TGTTGAGTTTTTGAGGCAGAAGG - Intronic
957171280 3:76739475-76739497 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
957218505 3:77351942-77351964 TGTTGTGGAGTGGGGGCAGGGGG + Intronic
957267451 3:77985287-77985309 TGTTGTGGGGTTGGGGGAGGTGG - Intergenic
957622222 3:82608160-82608182 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
957648620 3:82969470-82969492 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
957648751 3:82971102-82971124 TGTTGTGGGGTTGGGGGAGCAGG - Intergenic
957722241 3:84018257-84018279 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
957794526 3:84986598-84986620 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
957815846 3:85295772-85295794 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
957888988 3:86330327-86330349 TGTTGTGGGGTGGGGGTAGCGGG - Intergenic
957900772 3:86486402-86486424 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
957948277 3:87092395-87092417 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
958015071 3:87931194-87931216 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
958059738 3:88464158-88464180 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
958464303 3:94439561-94439583 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
958680761 3:97328962-97328984 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
958756263 3:98252888-98252910 TGTTGGGGTGTGGGGGCCGTAGG + Intergenic
958944775 3:100350852-100350874 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
958956696 3:100472522-100472544 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
959036863 3:101376629-101376651 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
959044225 3:101453711-101453733 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
959075581 3:101745901-101745923 TGTTGTGGGGTGGGGGGAGCAGG - Intronic
959353962 3:105302055-105302077 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
959360333 3:105382085-105382107 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
959876678 3:111390599-111390621 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
959909922 3:111752794-111752816 TGTTGTGGGGTGGGGGCAGTGGG - Intronic
960449119 3:117783974-117783996 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
960751593 3:120960755-120960777 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
960754226 3:120991806-120991828 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
961241727 3:125417222-125417244 TCTTGAGGGGAAGGGGCAGCTGG - Intergenic
962057252 3:131885686-131885708 TGTTGTGGGGTGGGGGGAGCAGG - Intronic
962103927 3:132371378-132371400 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
962149564 3:132878652-132878674 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
962401344 3:135061743-135061765 TGTTGTGGTGTGGGGGGAGTGGG - Intronic
962441922 3:135427890-135427912 TGTTGTGGGGTTGGGGAAGGGGG + Intergenic
962484378 3:135827965-135827987 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
962525032 3:136230272-136230294 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
962533199 3:136302710-136302732 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
962575357 3:136751598-136751620 TGTTGGCGGGGTGGGGCAGCGGG - Intronic
962628662 3:137252982-137253004 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
962667244 3:137666558-137666580 TGTTGTGGGGTTGTGGCAGTGGG + Intergenic
962699772 3:137985791-137985813 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
962776151 3:138662257-138662279 TGTTGCGGGGTGGGGGGAGCGGG - Intronic
963357767 3:144231411-144231433 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
963372425 3:144417836-144417858 TGTTGGGGGGTTGGGGGAGAGGG + Intergenic
963415753 3:144993797-144993819 TGTTGTGGGGTTGGGGAAGGGGG - Intergenic
963452140 3:145494996-145495018 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
963516757 3:146318362-146318384 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
963612263 3:147485093-147485115 TGTTGTGGGGTAGGGGCAGGGGG - Intronic
963705199 3:148678432-148678454 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
963765819 3:149334958-149334980 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
964152491 3:153544445-153544467 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
964190978 3:154000606-154000628 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
964236338 3:154534754-154534776 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
964259551 3:154820140-154820162 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
964342200 3:155719361-155719383 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
964688998 3:159429041-159429063 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
964827359 3:160843612-160843634 TGTTGTGGTGTGGGGGGAGAGGG - Intronic
964841778 3:161001983-161002005 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
965011218 3:163094831-163094853 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
965014988 3:163146626-163146648 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
965186460 3:165471747-165471769 TGTTGTGGGGTTGGGGGAGGCGG - Intergenic
965196447 3:165602840-165602862 TGTTGTGGCGTTGGGGGAGAGGG - Intergenic
965366218 3:167803122-167803144 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
965497692 3:169417952-169417974 TGTTGTGGGGTTGGGGGAGCGGG + Intronic
965521909 3:169676765-169676787 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
965600221 3:170447031-170447053 TGTTGGGGGGTTGGGGGAGGGGG + Intronic
965798444 3:172466284-172466306 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
965870068 3:173254027-173254049 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
965982730 3:174712949-174712971 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
966105965 3:176334453-176334475 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
966249884 3:177853009-177853031 TGTTGCGGGGTTGGGGGAGGGGG + Intergenic
966335748 3:178865811-178865833 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
966503847 3:180676991-180677013 TGTTGTGGGGTGTGGGCAGCGGG + Intronic
966720730 3:183060720-183060742 TGTCGTGGGGTTGGGGGAGCGGG - Intronic
967281288 3:187826588-187826610 TGTTGAGGTGATGCACCAGCTGG + Intergenic
967564344 3:190956161-190956183 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
967717866 3:192783984-192784006 TGTTGGGGGGTTGGGGGAGTGGG + Intergenic
967796744 3:193606412-193606434 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
967865973 3:194190151-194190173 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
968045467 3:195621960-195621982 TGTTGGGGAGTTGGGGTAGGAGG - Intergenic
968052231 3:195662997-195663019 TCTTAAGGTGTTGGGGTGGCAGG - Intergenic
968064263 3:195749981-195750003 TGTTGGGGAGTTGGGGTAGGAGG - Intronic
968103579 3:195985341-195985363 TCTTAAGGTGTTGGGGTGGCAGG + Intergenic
968301881 3:197622934-197622956 TCTTAAGGTGTTGGGGTGGCAGG + Intergenic
1202742750 3_GL000221v1_random:71201-71223 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
968535510 4:1125492-1125514 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
968570381 4:1337266-1337288 TTTTGATGTGTTCTGGCAGCCGG + Intronic
968789314 4:2648598-2648620 TGCTGAGGTGCTGCTGCAGCAGG - Intronic
969167884 4:5332642-5332664 TGTTGTGGGGTGGAGGCAGCGGG - Intronic
969383274 4:6822924-6822946 TGTTGTGGTGTGGGGGGAGGGGG - Intronic
969949812 4:10824176-10824198 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
970154848 4:13131332-13131354 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
970580424 4:17469864-17469886 TGTTGTGGTGTGGGGGGAGCGGG - Intronic
970650769 4:18175444-18175466 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
970680061 4:18496404-18496426 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
970719201 4:18966397-18966419 TGTTGTGGGGTTGGGGAAGGGGG + Intergenic
970779386 4:19717970-19717992 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
970904502 4:21200036-21200058 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
971035994 4:22693395-22693417 TGTAGAGGAGTTGGGGCAAATGG - Intergenic
971160614 4:24129993-24130015 TGTTGAGGGGTGGGGGGACCGGG + Intergenic
971438082 4:26649858-26649880 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
971442992 4:26710177-26710199 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
971445129 4:26736389-26736411 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
971662740 4:29440640-29440662 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
971901613 4:32666712-32666734 TGTTGTGGGGTCGGGGGAGCAGG - Intergenic
971965976 4:33556973-33556995 TGTTGAGGGGTGGGGGGAGGGGG - Intergenic
972116054 4:35635013-35635035 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
972377085 4:38482382-38482404 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
972666741 4:41172194-41172216 GGATGAGGTGTTGGAACAGCAGG - Intronic
972677098 4:41270572-41270594 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
972820486 4:42696439-42696461 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
972901997 4:43696600-43696622 TGTTGAGGGGTGGGGGGAGGGGG + Intergenic
973079321 4:45970462-45970484 TGTTCAGGGGATGGGGCTGCTGG + Intergenic
973346974 4:49067342-49067364 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
973348276 4:49080431-49080453 TGTTGAGGGGTGGGGGAAGCGGG + Intergenic
973568958 4:52218366-52218388 TGTTGTGGAGTGGGGGGAGCGGG - Intergenic
973627085 4:52783684-52783706 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
973746513 4:53968597-53968619 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
974085918 4:57261421-57261443 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
974378167 4:61104310-61104332 TGTTGTGGGGTGGGGGAAGCAGG - Intergenic
974538628 4:63204131-63204153 TGTTGTGGGGTGGGGGTAGCGGG - Intergenic
974554382 4:63425259-63425281 TGTTGTGGTGTGGGGGGAGTGGG - Intergenic
974579312 4:63774716-63774738 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
974740678 4:66002505-66002527 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
974937566 4:68426169-68426191 TGTCGTGGGGTTGGGGAAGCAGG + Intergenic
974962638 4:68722663-68722685 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
975072478 4:70158859-70158881 GGGTGAGGTTCTGGGGCAGCAGG - Exonic
975141081 4:70919153-70919175 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
975179783 4:71331576-71331598 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
975213997 4:71733160-71733182 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
975277087 4:72514981-72515003 TGTTGTGGGGTGGGGGTAGCGGG - Intronic
975631468 4:76408332-76408354 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
975813267 4:78191687-78191709 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
976048096 4:80977124-80977146 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
976058905 4:81103305-81103327 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
976289600 4:83403873-83403895 TGTTGTGGGGTTGGGGAAGTGGG + Intergenic
976328986 4:83805969-83805991 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
976451328 4:85194599-85194621 TGTTGTGGGGTTGGGGAAGGGGG + Intergenic
976482811 4:85564388-85564410 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
976484375 4:85584436-85584458 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
976782954 4:88781835-88781857 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
976792665 4:88896265-88896287 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
976830623 4:89309529-89309551 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
976924405 4:90479522-90479544 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
976953378 4:90863085-90863107 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
976976732 4:91174968-91174990 TGTTGTGGGGTGGGGGGAGCAGG - Intronic
976999806 4:91482939-91482961 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
977093716 4:92713142-92713164 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
977100946 4:92814497-92814519 TGCTGAGGTGCTGGAACAGCAGG + Intronic
977164920 4:93682776-93682798 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
977298339 4:95236428-95236450 TGTTGAGCAGTTGGGGGAGGGGG + Intronic
977336245 4:95703304-95703326 TGTTGAGGGGTTGGGGGAATGGG - Intergenic
977404255 4:96576037-96576059 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
977506428 4:97908860-97908882 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
977584705 4:98761893-98761915 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
977661839 4:99597312-99597334 TGTTTTGGTGGTGGGGCAGTTGG - Intronic
978021893 4:103824702-103824724 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
978037145 4:104009371-104009393 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
978049841 4:104184717-104184739 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
978149757 4:105419303-105419325 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
978360480 4:107926107-107926129 TGTGGAGGGGTTGGGGCTGGGGG + Intergenic
978474249 4:109108176-109108198 TGTTGTGGGGTGGGGGGAGCCGG - Intronic
978893619 4:113858130-113858152 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
978985807 4:115010531-115010553 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
979170591 4:117596964-117596986 TGTTGATCTCTTGGAGCAGCAGG - Intergenic
979369883 4:119872235-119872257 TGTTGAGGTATTAGAGCAACAGG - Intergenic
979642270 4:123023030-123023052 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
979738925 4:124125960-124125982 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
979746332 4:124217976-124217998 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
979921771 4:126505337-126505359 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
979924971 4:126550551-126550573 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
980004877 4:127530530-127530552 TGTTGTGGTGTGGGGGGAGGTGG - Intergenic
980311933 4:131142392-131142414 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
980506377 4:133729376-133729398 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
980547620 4:134289003-134289025 TGTTGTGGGGTTGGGGGAGGTGG - Intergenic
980584773 4:134797464-134797486 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
980642046 4:135594154-135594176 TATTCATGTGTTGGGGCAGGTGG - Intergenic
980748891 4:137061919-137061941 TGTACAGGTGTTTGGGCAGTGGG + Intergenic
981071619 4:140546331-140546353 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
981262541 4:142738454-142738476 TGTTGTGGTGTGGGGGAAGAGGG + Intronic
981284281 4:142996882-142996904 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
981365465 4:143897002-143897024 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
981367129 4:143916486-143916508 TATTGTGGTGTGGGGGGAGCGGG - Intergenic
981368783 4:143934002-143934024 TTTTGTGGTGTGGGGGGAGCGGG + Intergenic
981376924 4:144026720-144026742 TGTTGTGGTGTGGGGGGAGTGGG - Intergenic
981387426 4:144148072-144148094 TGCTGTGGTGTGGGGGGAGCGGG - Intergenic
981450992 4:144897357-144897379 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
981493371 4:145365199-145365221 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
981637215 4:146894525-146894547 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
981829781 4:148986301-148986323 TGTTGTGGTGTGGGGGGAGAGGG + Intergenic
981830903 4:149000457-149000479 TGGTGAGGTGATGGGGAAGCAGG - Intergenic
981881076 4:149613715-149613737 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
981900306 4:149854069-149854091 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
981907920 4:149944056-149944078 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
981989172 4:150895429-150895451 TGTTGTGGGGTGGGGGTAGCGGG - Intronic
982052644 4:151517296-151517318 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
982327553 4:154144729-154144751 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
982399818 4:154954147-154954169 TGATGAGGTGTTGGGGTGGCAGG + Intergenic
982539385 4:156648904-156648926 TGTTGAGGTGTTGGGGTGGAAGG - Intergenic
982624614 4:157750534-157750556 TGTTGTGGTGTGGGGGTAGGGGG + Intergenic
982682873 4:158453052-158453074 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
982860224 4:160438844-160438866 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
983065631 4:163207153-163207175 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
983109668 4:163733601-163733623 TGTTGTGGGGTAGGGGGAGCGGG - Intronic
983117166 4:163832735-163832757 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
983176041 4:164588847-164588869 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
983400787 4:167263079-167263101 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
983508011 4:168576381-168576403 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
983549687 4:169003940-169003962 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
983697431 4:170549213-170549235 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
983705876 4:170658970-170658992 TGTTGTGGGGTGGGGGTAGCGGG - Intergenic
983814876 4:172111824-172111846 TGTGCAGCTGTAGGGGCAGCAGG - Intronic
983907061 4:173194785-173194807 TGTTGTGGGGTGGGGGAAGCGGG - Intronic
984182850 4:176506837-176506859 TGTCGTGGAGTTGGGGGAGCGGG - Intergenic
984344925 4:178511072-178511094 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
984574676 4:181434501-181434523 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
984695870 4:182779203-182779225 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985140667 4:186837441-186837463 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
985498442 5:224793-224815 TCTTAAGGTGTTGGGGTGGCGGG - Intronic
985619727 5:947928-947950 TGTTGAGGTGGAGGGGTGGCGGG - Intergenic
986102046 5:4621269-4621291 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
986555110 5:9002619-9002641 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
986672976 5:10159344-10159366 TGTTGAGGGGTTGGGGGAAGGGG + Intergenic
986940346 5:12940599-12940621 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
986980793 5:13446371-13446393 TGTTGTGGGGTGGGGGTAGCGGG + Intergenic
986981479 5:13453070-13453092 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
987001223 5:13662014-13662036 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
987149755 5:15026949-15026971 TGTAGAAGTGATGGGGCAGCTGG - Intergenic
987174960 5:15297935-15297957 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
987307518 5:16651535-16651557 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
987556503 5:19457862-19457884 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
987673711 5:21047034-21047056 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
987953155 5:24702508-24702530 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
987971653 5:24954123-24954145 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
988044573 5:25933524-25933546 TGGTGAGGTGTGGTGGAAGCTGG + Intergenic
988071211 5:26289916-26289938 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
988072342 5:26308418-26308440 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
988138813 5:27209383-27209405 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
988210361 5:28196300-28196322 TGTTGTGGGGTAGGGGAAGCGGG - Intergenic
988248343 5:28719788-28719810 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
988287756 5:29242494-29242516 TGTTGTGGGGTAGGGGAAGCGGG - Intergenic
988308730 5:29529043-29529065 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
988953623 5:36291545-36291567 TGTTGTGGGGTGGGGGCAGAGGG - Intronic
989036125 5:37173846-37173868 TTCTGAGGTGTTGGAGCAGGTGG + Exonic
989081144 5:37622736-37622758 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
989085760 5:37674378-37674400 TGTTGTGGGGTTGGGGAAGGCGG - Intronic
989227031 5:39040312-39040334 TGTTGAGGGGTGGGGGGAGGGGG + Intronic
989358251 5:40569362-40569384 TTTTGAGGTGCTGAGGCAGGAGG + Intergenic
989419868 5:41225211-41225233 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
989763266 5:45047360-45047382 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
989792049 5:45416858-45416880 TTTTAAGGTGTTGGGGGAGAGGG - Intronic
989827868 5:45881375-45881397 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
989948178 5:50264672-50264694 TGTCGTGGGGTTGGGGCAGAGGG + Intergenic
990143803 5:52735786-52735808 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
990228206 5:53680690-53680712 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
990239492 5:53802727-53802749 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
990656849 5:57966729-57966751 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
990839855 5:60065583-60065605 TGTTGTGGGGTCGGGGGAGCGGG - Intronic
990877388 5:60501146-60501168 TGTTGTGGGGTGGGGGAAGCGGG - Intronic
991088726 5:62672946-62672968 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
991101558 5:62799115-62799137 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
991211051 5:64105012-64105034 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
991321281 5:65376106-65376128 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
991376472 5:65973248-65973270 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
991379734 5:66007384-66007406 TGTCGTGGGGTTGGGGGAGCGGG + Intronic
991557011 5:67906836-67906858 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
991687779 5:69197647-69197669 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
993191886 5:84694235-84694257 TGTTGTGGAGTGGGGGAAGCGGG - Intergenic
993243438 5:85420881-85420903 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
993475824 5:88362718-88362740 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
993611985 5:90065345-90065367 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
993782745 5:92088672-92088694 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
993818646 5:92585141-92585163 TGTTGTGGAGTGGGGGTAGCGGG + Intergenic
993878681 5:93338647-93338669 TGTTGTGGGGTTGGGGGAGGTGG - Intergenic
993939386 5:94040499-94040521 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
994262747 5:97679411-97679433 TGTTGCGGGGTTGGGGGAGGGGG - Intergenic
994345872 5:98685461-98685483 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
994350460 5:98739127-98739149 TGTTGTGGAGTTGGGGAAGTGGG + Intergenic
994385303 5:99124417-99124439 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
994415723 5:99467905-99467927 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
994434334 5:99708539-99708561 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
994526807 5:100916147-100916169 TGTTGTGGGGTGGGGGGAGCCGG - Intergenic
994602544 5:101924652-101924674 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
994612221 5:102058012-102058034 TGTTGTGGGGTGGGGGGAGCTGG + Intergenic
994977545 5:106829323-106829345 TGTTGTGGGGTGGGGGGAGCCGG + Intergenic
995216670 5:109602995-109603017 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
995228499 5:109731507-109731529 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
995272374 5:110236264-110236286 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
995363481 5:111327154-111327176 TGTTGTGGAGTTGGGGGAGGGGG - Intronic
995643066 5:114279446-114279468 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
995677314 5:114676733-114676755 TGTTGCGGGGTTGGGGGAGGGGG + Intergenic
995806253 5:116055793-116055815 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
995938882 5:117553869-117553891 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
995951669 5:117721576-117721598 TGTTGTGGGGTTGGGGGAGGAGG + Intergenic
996114763 5:119605694-119605716 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
996171134 5:120293183-120293205 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
996188023 5:120503785-120503807 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
996257854 5:121427169-121427191 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
996261191 5:121471592-121471614 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
996276689 5:121675164-121675186 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
996381892 5:122870829-122870851 TGTTGATGTGGTGGTGCTGCTGG + Intronic
996501307 5:124219146-124219168 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
996604506 5:125305290-125305312 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
996626151 5:125572508-125572530 TGTTGTGGTGTGGGGGTAGGGGG + Intergenic
996631020 5:125632544-125632566 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
996857693 5:128028667-128028689 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
997001797 5:129770490-129770512 TGTTCAGGTGGGTGGGCAGCAGG - Intergenic
997039593 5:130235843-130235865 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
997071104 5:130623021-130623043 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
997569049 5:134911811-134911833 TGTTGAGCACGTGGGGCAGCGGG - Intronic
997592338 5:135083017-135083039 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
997776446 5:136611662-136611684 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
998063478 5:139137676-139137698 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
998242278 5:140457699-140457721 TGTTGTGGGGTCGGGGGAGCGGG + Intronic
998659776 5:144223138-144223160 TGTTGTGGGGTCGGGGGAGCGGG + Intronic
998699888 5:144686113-144686135 TGTTGTGGGGTAGGGGGAGCAGG - Intergenic
998764292 5:145468062-145468084 TGTTGTGGGGTTGGGAGAGCGGG - Intergenic
999033204 5:148317908-148317930 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
999033957 5:148326659-148326681 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
999060855 5:148633525-148633547 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
999349627 5:150857077-150857099 TGTTGTGGGGTTGGGGGAGGAGG - Intronic
999415260 5:151389556-151389578 TGTTGAGGGGTCGGGGGAGGGGG - Intergenic
1000321916 5:160141206-160141228 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1000377659 5:160598382-160598404 TGTTGTGGGGTGGGGGGAGCAGG + Intronic
1000464021 5:161553284-161553306 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1000531313 5:162423842-162423864 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1000556929 5:162737382-162737404 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1000561050 5:162789933-162789955 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1000566294 5:162851274-162851296 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1000566831 5:162858009-162858031 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1000593279 5:163184281-163184303 TGTTGTGGGGTGGGGGTAGCGGG + Intergenic
1000647506 5:163776784-163776806 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1000746480 5:165040532-165040554 TGTTGTGGGGTTGGGGGAGGAGG - Intergenic
1000749906 5:165082064-165082086 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1000948634 5:167452776-167452798 TGTTGTGGGGTAGGGGGAGCGGG + Intronic
1000980683 5:167813468-167813490 TGTTGCAGTGTTGGAGGAGCAGG + Intronic
1001076947 5:168636865-168636887 TGTTGTGGGGTTGGGGAAGCGGG + Intergenic
1001458423 5:171886417-171886439 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1001662109 5:173401954-173401976 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1001732647 5:173971901-173971923 TTTTGTGGTGTGGAGGCAGCAGG + Intergenic
1001884124 5:175273271-175273293 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1002378001 5:178802247-178802269 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1002747984 6:79578-79600 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1003034189 6:2628711-2628733 TGGTAAGGAGTTGGGGCTGCAGG + Intronic
1003730203 6:8813090-8813112 TGTTGTGGGGTTGGGGAAGGGGG + Intergenic
1003768432 6:9268326-9268348 TGTTGAGGGGTGGGGGGAGGGGG - Intergenic
1003803013 6:9692967-9692989 TGTTGGGGGGTTGGGGGAGAGGG - Intronic
1004440187 6:15642382-15642404 TGCTGAGGTCTTGGGGGAGAAGG - Intronic
1004450163 6:15738152-15738174 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1004553045 6:16668340-16668362 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1004563723 6:16775850-16775872 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
1004738817 6:18435867-18435889 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1004760656 6:18662363-18662385 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1004914278 6:20317978-20318000 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1004952423 6:20688880-20688902 TATTAAGGTGTTGGGGGAGAGGG + Intronic
1005100373 6:22166498-22166520 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1005231068 6:23702352-23702374 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1005351799 6:24943336-24943358 TGTTGTGGGGTAGGGGGAGCAGG + Intronic
1005664373 6:28036344-28036366 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1005757256 6:28936102-28936124 TGTAGAGATGGTGGGGCAGGGGG + Intergenic
1006207489 6:32361025-32361047 TGTTGCGGGGTGGGGGAAGCAGG - Intronic
1006302940 6:33203750-33203772 TCTGGAGGTGCTGGGGCTGCTGG + Exonic
1007315309 6:40983526-40983548 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
1007475395 6:42116453-42116475 GGCTGAGGTGGAGGGGCAGCAGG - Intronic
1007577510 6:42935480-42935502 TGTGCAGGTGTTGGGGCACAGGG + Intronic
1007581602 6:42963306-42963328 TCTGTAGGTGGTGGGGCAGCCGG - Exonic
1007720649 6:43883435-43883457 TGTCGAGGGGTTGGGGGAGTGGG + Intergenic
1007859532 6:44893373-44893395 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1007977248 6:46114126-46114148 TGTAGAGCTCTTGGGGCTGCTGG - Intergenic
1008163675 6:48108447-48108469 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1008194089 6:48496558-48496580 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
1008195392 6:48513064-48513086 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1008210828 6:48722962-48722984 TGTTGTGGGGTCGGGGGAGCGGG + Intergenic
1008297060 6:49791631-49791653 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1008313546 6:50008795-50008817 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1008549500 6:52614197-52614219 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1008724901 6:54405967-54405989 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1008797069 6:55316289-55316311 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1008825721 6:55690519-55690541 TGTTGTGGTGTGGGGGAAGGGGG + Intergenic
1008844285 6:55942983-55943005 TGTTGTTGTTTTGGGGCATCTGG + Intergenic
1009000424 6:57706378-57706400 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1009040192 6:58166583-58166605 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1009064669 6:58444847-58444869 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1009211097 6:60863890-60863912 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1009241336 6:61189455-61189477 TGTTGGGGGGTTGGGGGAGTGGG + Intergenic
1009260225 6:61476816-61476838 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1009275369 6:61671992-61672014 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1009282737 6:61772786-61772808 TGTTGTGGAGTTGGGGTAGGGGG - Intronic
1009362055 6:62826834-62826856 TGTTGTGGGGTTGGGGGAGGTGG - Intergenic
1009418277 6:63439199-63439221 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1009799499 6:68517642-68517664 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1009815007 6:68721471-68721493 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1009875644 6:69501217-69501239 TGTTGTGGGGTCGGGGGAGCGGG + Intergenic
1009949339 6:70377853-70377875 TGTTGAGGGGTGGGGGGAGGGGG - Intergenic
1010031600 6:71276500-71276522 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1010101872 6:72119799-72119821 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1010190840 6:73194839-73194861 TGTAAAGTTGTTGGGGCTGCTGG - Exonic
1010267581 6:73884247-73884269 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
1010271770 6:73923502-73923524 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1010309346 6:74365641-74365663 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1010347972 6:74835686-74835708 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1010546721 6:77167227-77167249 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
1010620831 6:78071929-78071951 TGTTGTGGGGTTCGGGGAGCGGG + Intergenic
1010644604 6:78372348-78372370 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1010672304 6:78700303-78700325 TGTTGTGGGGTGGAGGCAGCAGG + Intergenic
1010857130 6:80853605-80853627 TGTTGTGGGGTTGGGGGAGCGGG + Intergenic
1010907207 6:81506034-81506056 TGTTGTGGGGTTGGGGTAGGGGG - Intronic
1010908322 6:81520876-81520898 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1011096337 6:83668675-83668697 TGTTGTGGTGTAGGGGAAGGGGG + Intronic
1011118063 6:83917240-83917262 TGGTGAGGTTGTGGAGCAGCTGG + Intronic
1011363403 6:86552489-86552511 TGTTGTGGGGTTGGGGGAGGTGG + Intergenic
1011438486 6:87363492-87363514 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1011569297 6:88716812-88716834 TGTTGTGGGGTGGGGGGAGCAGG + Intronic
1011751858 6:90461875-90461897 TTTTGCTGTGTTGGAGCAGCTGG + Intergenic
1011803224 6:91042222-91042244 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1011817381 6:91208925-91208947 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1011924373 6:92624461-92624483 TGTTGTGGGGTCGGGGCAGGGGG - Intergenic
1012115938 6:95298879-95298901 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1012167133 6:95971357-95971379 TGTTGTGGGGTTGGGGGAGGAGG - Intergenic
1012295591 6:97517934-97517956 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1012435433 6:99210273-99210295 TGTTGTGGGGTAGGGGGAGCAGG + Intergenic
1012483527 6:99694221-99694243 TGTCGTGGGGTTGGGGGAGCAGG + Intergenic
1012504149 6:99925980-99926002 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1012819180 6:104063050-104063072 TATTGTGGGGTTGGGGGAGCGGG + Intergenic
1013152984 6:107464509-107464531 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1013613820 6:111822475-111822497 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1013715504 6:112956091-112956113 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1013750602 6:113401105-113401127 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1013756625 6:113469489-113469511 TGTTGTGGGGTTGGGGGAGCAGG + Intergenic
1013881881 6:114914779-114914801 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1013937497 6:115615823-115615845 TGTTGTGGGGTAGGGGCAGGGGG + Intergenic
1013963647 6:115929616-115929638 TGTTAAGGCTTTGGGGCAGGAGG - Intergenic
1014033767 6:116740839-116740861 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1014400524 6:120983917-120983939 TGTTGTGGGGTGGGGGTAGCGGG + Intergenic
1014652001 6:124051570-124051592 TGTTGTGGGGTCGGGGGAGCGGG - Intronic
1014711429 6:124810478-124810500 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1014784865 6:125607446-125607468 TGTCGTGGGGTGGGGGCAGCAGG - Intergenic
1015340396 6:132093239-132093261 TGTTGTGGAGTGGGGGGAGCAGG - Intergenic
1015431951 6:133142219-133142241 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1015679713 6:135792373-135792395 TGTTGTGGGGTAGGGGGAGCGGG - Intergenic
1015776029 6:136815224-136815246 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1015874976 6:137814017-137814039 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1016201970 6:141421391-141421413 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1016588782 6:145719467-145719489 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1016659144 6:146556121-146556143 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1016800072 6:148159544-148159566 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1016916386 6:149247905-149247927 TGTTGAGGGGTAGGGGCAGCGGG + Intronic
1017049628 6:150378325-150378347 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1017060187 6:150476081-150476103 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1017330127 6:153187875-153187897 TGTTGTGGGGTAGGGGGAGCGGG - Intergenic
1017550554 6:155502194-155502216 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1017574673 6:155789279-155789301 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1017594110 6:156010470-156010492 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1017987556 6:159457181-159457203 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
1018455422 6:163947521-163947543 TGTAGAAGTGTAGGGGCAGGTGG - Intergenic
1018464613 6:164032218-164032240 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1018592422 6:165442289-165442311 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1018938860 6:168294465-168294487 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1019097772 6:169599134-169599156 TGTTGTGGTGTGGGGGGAGGGGG - Intronic
1019903056 7:4039147-4039169 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1019940793 7:4288293-4288315 TGTTGAGGGGTGGGGGGAGCGGG - Intergenic
1020254773 7:6497056-6497078 TGGGGAGGTGTTGAGGCAGGAGG - Intergenic
1020448742 7:8298259-8298281 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1020480682 7:8656689-8656711 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1020492180 7:8800732-8800754 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1020825763 7:13025882-13025904 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1021437223 7:20632856-20632878 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1021478590 7:21090916-21090938 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1021917676 7:25451423-25451445 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1022617511 7:31946821-31946843 TTTAGAGATGTTGGGGCAGCTGG - Intronic
1022619658 7:31969987-31970009 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
1022696772 7:32714009-32714031 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1022830210 7:34058255-34058277 TGTAGAGGCTTTGGGGGAGCTGG - Intronic
1022986471 7:35660023-35660045 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1023694264 7:42828683-42828705 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1023782996 7:43675445-43675467 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1023821942 7:43985481-43985503 TGGGGAGGTGTGGGGGCAGGAGG - Intergenic
1024056949 7:45666281-45666303 TGTTGTGGTGTGGGGGGAGTGGG - Intronic
1024206406 7:47165627-47165649 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1024426321 7:49230434-49230456 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1024893549 7:54230276-54230298 TGTTGTGGAGTTGGGGGAGGAGG - Intergenic
1024900369 7:54312111-54312133 TGTTGTGGAGTTGGGGGAGGAGG + Intergenic
1025084213 7:56009535-56009557 GGGTGAGGTGGTGGGGCGGCAGG - Intergenic
1025134706 7:56401295-56401317 TGTTGTGGGGTTGGGGAAGGGGG + Intergenic
1025591450 7:62864773-62864795 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1025791954 7:64696963-64696985 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1025889096 7:65629647-65629669 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1026333777 7:69376334-69376356 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1026657456 7:72269354-72269376 TGTTGTGGAGTGGGGGCAGGGGG - Intronic
1026899778 7:74030341-74030363 TGTTGCGGGGGTGGGGGAGCAGG + Intronic
1026942501 7:74295336-74295358 AGTTGAGAAGCTGGGGCAGCAGG + Intronic
1027498776 7:78922338-78922360 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1027856544 7:83519117-83519139 TGTTGTGGGGTGGGGGTAGCGGG - Intronic
1027922259 7:84408889-84408911 TGTTGTGGGGTTGGGGGAGCGGG + Intronic
1027930200 7:84522349-84522371 TGTTGTGGGGTGGGGGTAGCGGG + Intergenic
1027944799 7:84731246-84731268 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1027983529 7:85255714-85255736 TGTTGTGGAGTGGGGGCAGGGGG + Intergenic
1028051745 7:86196704-86196726 TGTTGTGGGGTCGGGGGAGCGGG - Intergenic
1028055315 7:86233501-86233523 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1028064741 7:86369283-86369305 TGTTGTGGGGTTGGGGGAGGAGG + Intergenic
1028114867 7:86985813-86985835 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1028277276 7:88872615-88872637 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1028287067 7:89015482-89015504 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1028436726 7:90812462-90812484 TGTTGTGGGGTTGGGGAAGGGGG + Intronic
1028449984 7:90971068-90971090 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1028526415 7:91791527-91791549 TGTTGTGGGGTTGGGGCAGGAGG - Intronic
1028633439 7:92961244-92961266 TGTTGTGGGGTGGGGGAAGCAGG + Intergenic
1028685219 7:93584204-93584226 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1028824682 7:95257662-95257684 TGTTGTGGGGTGGGGGGAGCAGG - Intronic
1029316220 7:99716996-99717018 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029321880 7:99769587-99769609 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029709299 7:102290817-102290839 GGTTTATGTGTTGGGGCAGTGGG + Intronic
1029750206 7:102538894-102538916 TGGGGAGGTGTGGGGGCAGGAGG - Intronic
1029768157 7:102638002-102638024 TGGGGAGGTGTGGGGGCAGGAGG - Intronic
1029897813 7:104004219-104004241 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1029916550 7:104215725-104215747 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1029932714 7:104390333-104390355 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1030220017 7:107088721-107088743 TCTTGAGGAGTTGGGGCTACAGG + Intronic
1030477705 7:110058872-110058894 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1030593165 7:111505815-111505837 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1031143310 7:117969545-117969567 TGTTGTGGGGTTGGGGAAGGGGG + Intergenic
1031170316 7:118285125-118285147 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1031424204 7:121585948-121585970 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1031516137 7:122701435-122701457 TGTTGTGGGGTGGGGGAAGCGGG + Intronic
1031516743 7:122709902-122709924 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
1031617705 7:123900481-123900503 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1031739884 7:125416710-125416732 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1031751899 7:125585359-125585381 TGTTGTGGGGTTGGGGGAGAGGG + Intergenic
1032860397 7:135872865-135872887 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1032863039 7:135899524-135899546 TGTTGAGGAATTGGGGAACCTGG - Intergenic
1032974788 7:137209971-137209993 TGTTGTGGGGTCGGGGGAGCGGG - Intergenic
1033106526 7:138531363-138531385 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1033153908 7:138940160-138940182 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1033408073 7:141089855-141089877 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1033809416 7:144993278-144993300 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1033877283 7:145837884-145837906 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1033954107 7:146822316-146822338 TGTTGTGGCGTGGGGGCAGGGGG + Intronic
1034417837 7:150974605-150974627 TGTGGGGGTGTGGGGGCGGCTGG - Intronic
1034719143 7:153272124-153272146 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1035100744 7:156394339-156394361 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1035235084 7:157492062-157492084 TGTTGTGGGGTGGGGGGAGCCGG - Intergenic
1035519776 8:266743-266765 TGCGGAGGTGTGGGGGCCGCCGG + Intergenic
1035646993 8:1232162-1232184 TGCTGAGCCTTTGGGGCAGCTGG + Intergenic
1035991173 8:4491728-4491750 TGTTGAGGTTGTGGGGCAACAGG + Intronic
1036101404 8:5790345-5790367 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1036113477 8:5932135-5932157 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1037041911 8:14246441-14246463 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1037496111 8:19442565-19442587 TGTTGTGGCGTTGGGGGAGGGGG + Intronic
1037633821 8:20682270-20682292 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1038158594 8:25014965-25014987 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1038239328 8:25793587-25793609 TGTTGTGGGGTTGGGGGAGGCGG + Intergenic
1038582210 8:28758251-28758273 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1038742457 8:30227323-30227345 TGTTGCGGGGTTGGGGCCGGGGG + Intergenic
1038924439 8:32122770-32122792 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1038935877 8:32251203-32251225 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1039126854 8:34213070-34213092 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1039245091 8:35599948-35599970 TGTTGTGGGGTTGGGGGAGGAGG - Intronic
1039288711 8:36070610-36070632 TATGGAGGAGTTGGGGCAGAGGG + Intergenic
1040086131 8:43344587-43344609 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1040364308 8:46699363-46699385 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1040437898 8:47410805-47410827 TGTTGTGGGGTTGGGGGAGCGGG - Intronic
1040651429 8:49452958-49452980 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1041122541 8:54601417-54601439 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1041357054 8:57012393-57012415 TGTCGTGGGGTTGGGGGAGCGGG + Intergenic
1041587942 8:59543549-59543571 TGTTGTGGGGTGGGGGCATCAGG + Intergenic
1041881830 8:62760621-62760643 TGTTGTGGTGTGGGGGGAGGGGG + Intronic
1041975733 8:63797555-63797577 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1042338265 8:67651888-67651910 TGTTGCGGGGTGGGGGCAGGGGG - Intronic
1042411046 8:68465796-68465818 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1042434672 8:68749232-68749254 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1042450258 8:68936791-68936813 TGTTGTGGAGTTGGGGGAGGGGG + Intergenic
1042518787 8:69688482-69688504 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1042879268 8:73469300-73469322 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
1043026753 8:75080014-75080036 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1043041584 8:75269757-75269779 TGATGAGTTGGTGGAGCAGCTGG - Intergenic
1043120322 8:76313949-76313971 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1043272927 8:78356495-78356517 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1043333614 8:79147141-79147163 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1043643443 8:82486149-82486171 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1043804268 8:84651066-84651088 TGTTGTGGGGTGGGGGTAGCGGG + Intronic
1043985407 8:86689707-86689729 TGTTGTGGGGTTGGGGGAGGTGG - Intronic
1043995386 8:86807555-86807577 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1044471745 8:92578292-92578314 TGTTGTGGGATGGGGGCAGCGGG - Intergenic
1044754379 8:95446355-95446377 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1044766173 8:95577534-95577556 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1044821658 8:96159642-96159664 TGTTGAGGCCTCGGAGCAGCCGG + Intronic
1044901818 8:96954742-96954764 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1045125178 8:99081571-99081593 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1045164596 8:99589351-99589373 TGTTGTGGGGTTGGGGGAGCGGG - Intronic
1045774701 8:105789231-105789253 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1045787051 8:105934177-105934199 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1045816729 8:106285113-106285135 TGTTGTGGGGTGGGGGCAGTGGG - Intronic
1046095529 8:109555129-109555151 TGTTGTGGGGTTGGGGGAGAGGG - Intronic
1046329574 8:112697583-112697605 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1046370293 8:113296142-113296164 TGTTGTGGGGTTGGGGGAGAGGG + Intronic
1046370932 8:113305146-113305168 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1046429622 8:114108116-114108138 TGCTGAGGTTTTGTGGCAGGTGG - Intergenic
1046724106 8:117655764-117655786 TCTTGAGGTGTTGGGGCCTGAGG - Intergenic
1046895987 8:119474011-119474033 TGTTGAGGGGTTGGGGGAGAGGG - Intergenic
1047040780 8:120992811-120992833 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1047043467 8:121025068-121025090 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1047146249 8:122202643-122202665 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1047579312 8:126195251-126195273 TGTTGTGGGGTCGGGGGAGCAGG + Intergenic
1047666291 8:127095546-127095568 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1047875353 8:129130714-129130736 GGTTTATGTGCTGGGGCAGCTGG - Intergenic
1047911298 8:129532731-129532753 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1047918251 8:129605532-129605554 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
1048230217 8:132631860-132631882 TGTTGTGGGGTTGGGGGAGTGGG + Intronic
1048352785 8:133629569-133629591 TGGTGTGGTTTTGGGGCAGTGGG + Intergenic
1048684488 8:136888847-136888869 TGTTGTGGAGTGGGGGGAGCGGG - Intergenic
1050178809 9:2898151-2898173 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1050251178 9:3746557-3746579 TGTTGTGGTGTTCTGGCACCTGG + Intergenic
1050370345 9:4915217-4915239 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1050442272 9:5677993-5678015 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1050444990 9:5711721-5711743 TGTTGTGGGGTGGGGGCAGCAGG - Intronic
1050678963 9:8087576-8087598 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1050817840 9:9837914-9837936 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1050887892 9:10788855-10788877 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
1050960040 9:11718826-11718848 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1051116445 9:13699564-13699586 TGTTGCGGGGTAGGGGGAGCAGG - Intergenic
1051301414 9:15655027-15655049 TGTTGTGGGGTCGGGGGAGCAGG + Intronic
1051324270 9:15947971-15947993 TGTTGTGGGGTGGGGGCAGCGGG - Intronic
1051538091 9:18182133-18182155 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1051611022 9:18961483-18961505 TGTTGAGGGGTGGGGGCAAGGGG - Intronic
1051725158 9:20081473-20081495 TGTTGAGGGGTGGGGGGAGGGGG + Intergenic
1051738677 9:20229879-20229901 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1051787219 9:20758511-20758533 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1051790405 9:20795960-20795982 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1051803192 9:20960730-20960752 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1051812336 9:21063871-21063893 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1051830656 9:21272490-21272512 TGTTGTGGGGTTGGGGGAGTGGG - Intergenic
1051839559 9:21379908-21379930 TGATGAGGTCCTGGGACAGCTGG - Intergenic
1051961203 9:22764871-22764893 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1051976069 9:22950861-22950883 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1052059033 9:23938058-23938080 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1052074388 9:24122480-24122502 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1052328765 9:27245359-27245381 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1052448222 9:28591153-28591175 TGTTGTGGGGTTGGGGGAGGCGG + Intronic
1052470816 9:28893897-28893919 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1052591401 9:30501169-30501191 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1052623987 9:30951367-30951389 TGTTGTGGGGTGGGGGGAGCCGG - Intergenic
1053029154 9:34759322-34759344 TGATGAGGTGTTGGTGCCTCAGG - Intergenic
1054741295 9:68808399-68808421 TGTCGGGGTGGTGGGGAAGCTGG - Intronic
1054826272 9:69576701-69576723 TGTTGTGGGGTAGGGGGAGCGGG + Intronic
1054980949 9:71205058-71205080 TGTTGTGGGGTGGGGGGAGCAGG + Intronic
1055237598 9:74142758-74142780 TGTTGTGGAGTGGGGGGAGCGGG + Intergenic
1055578590 9:77684915-77684937 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1055610076 9:78013459-78013481 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1056032750 9:82569976-82569998 TGTTGTGGTGTGGGGGAAGTGGG + Intergenic
1056100184 9:83293574-83293596 TGTTGTGGGTTGGGGGCAGCAGG - Intronic
1056333018 9:85537386-85537408 TTTTGAGGTGCTGAGGCAGGTGG - Intergenic
1056388040 9:86115723-86115745 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1056501113 9:87210332-87210354 TGTTGTGGGGTGGGGGTAGCGGG - Intergenic
1056844892 9:90029119-90029141 TGTGGATGTGTGGGGGCAGAGGG + Intergenic
1057284432 9:93739552-93739574 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1057641401 9:96826394-96826416 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1057683332 9:97211137-97211159 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1057819563 9:98320823-98320845 TGTTGTGGTGTGGGGGGAGGGGG + Intronic
1058165817 9:101617793-101617815 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1058229967 9:102413549-102413571 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1058330148 9:103750475-103750497 TGTTGAGGGGTAGGGGGAGGGGG - Intergenic
1058555837 9:106166291-106166313 TGTTGTGGGGTCGGGGGAGCGGG - Intergenic
1058599228 9:106651590-106651612 TGTTGTGGGGTGGGGGTAGCAGG + Intergenic
1059078927 9:111226100-111226122 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1059243857 9:112832621-112832643 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1059293694 9:113250523-113250545 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1059358919 9:113723988-113724010 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1059513623 9:114872229-114872251 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1059594433 9:115702679-115702701 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1059672130 9:116501697-116501719 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1060083898 9:120679469-120679491 TGTTGAGGGGTGGGGGGAGGGGG + Intronic
1060321873 9:122569825-122569847 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1061285369 9:129619812-129619834 TGTTGCGGTGCTGGGGATGCTGG + Exonic
1061527804 9:131182034-131182056 TGTTGTGGTGCTGGGACAACTGG - Intronic
1062543159 9:137050430-137050452 TGTTGAAGTTCTGGGGCCGCTGG + Exonic
1203791846 EBV:155844-155866 TGTGAACGTGTTTGGGCAGCAGG - Intergenic
1203711386 Un_KI270742v1:101125-101147 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1185510082 X:657544-657566 TGTGGGGGTGTGGGGGGAGCAGG - Intronic
1186046661 X:5544082-5544104 TTTTGGGGGGTGGGGGCAGCGGG + Intergenic
1186634487 X:11387699-11387721 TGTTGTGGGGTGGGGGAAGCGGG - Intronic
1186708109 X:12164192-12164214 TGTTGTGGGGTTGGGGGAGTGGG - Intronic
1186756793 X:12679616-12679638 TGTGGGGATGTTGAGGCAGCAGG + Intronic
1186850868 X:13578774-13578796 TGTCGTGGGGTGGGGGCAGCGGG + Intronic
1186889515 X:13946600-13946622 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1186910366 X:14157574-14157596 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1186993502 X:15094393-15094415 TGTTGTGGGGTGGGGGCAGCGGG + Intergenic
1187002462 X:15196723-15196745 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1187210068 X:17221391-17221413 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
1187210857 X:17230166-17230188 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1187222497 X:17342626-17342648 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1187281049 X:17859027-17859049 TGTGGGGGTGTGGGGGCAGGTGG + Intronic
1187459196 X:19470396-19470418 TGTTGTGGGGTGGGGGGAGCAGG + Intronic
1187603508 X:20859108-20859130 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1187656703 X:21483436-21483458 TGTTGTGGGGTTGGGGGAGCGGG + Intronic
1188135494 X:26489995-26490017 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1188223447 X:27568817-27568839 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1188423291 X:30014891-30014913 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1188452821 X:30326571-30326593 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1188712788 X:33422298-33422320 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1188831692 X:34906130-34906152 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1188938280 X:36204424-36204446 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1188978089 X:36700343-36700365 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1189071722 X:37870670-37870692 TGTTGTGGTGTGGGGGGAGGGGG + Intronic
1189422353 X:40867345-40867367 TATTAAGGTGTTGGGGAAGGAGG + Intergenic
1189686989 X:43574761-43574783 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1189929922 X:45998462-45998484 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1189961954 X:46332650-46332672 TTGTAATGTGTTGGGGCAGCAGG + Intergenic
1190004341 X:46720657-46720679 TGTTTATGTGTAGGGGCAGATGG - Intronic
1190147559 X:47909754-47909776 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1190222349 X:48520578-48520600 TGTTGAGGTGTTGGGGGTCAAGG - Exonic
1190518405 X:51249122-51249144 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1190601313 X:52095788-52095810 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1190636746 X:52442274-52442296 TGTTGTGGGGTCGGGGGAGCGGG - Intergenic
1190686785 X:52881654-52881676 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1190798122 X:53762666-53762688 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1191019668 X:55845904-55845926 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1191032236 X:55987346-55987368 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1191075005 X:56443446-56443468 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1191087165 X:56581665-56581687 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1191173674 X:57477635-57477657 TGTTGTGGGGTTGGGGGAGCGGG - Intronic
1191185742 X:57609981-57610003 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1191630663 X:63318472-63318494 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1191653989 X:63576082-63576104 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1191723215 X:64252490-64252512 TGTTGTGGGGTGGGGGCAGAGGG - Intergenic
1191905598 X:66085450-66085472 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1191908418 X:66121388-66121410 TGTTGTGGGGTAGGGGGAGCAGG - Intergenic
1191936124 X:66428910-66428932 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1191940863 X:66480679-66480701 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1191945040 X:66524428-66524450 TGTTGTGGGGTTGGGGGAGGAGG - Intergenic
1191985822 X:66980084-66980106 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
1192002577 X:67170102-67170124 TGTTTAGGGGTGGGGGCAGGGGG + Intergenic
1192004911 X:67200072-67200094 TGTTGAGGGGTGGGGGGAGGGGG - Intergenic
1192027959 X:67475244-67475266 TGTTGAGGGGTTGGGGGAGGGGG + Intergenic
1192063258 X:67853350-67853372 TGTTGTGGGGTTGGGGGAGAGGG - Intergenic
1192093855 X:68189501-68189523 TGTTGTGGGGTTGGGGGAGGTGG - Intronic
1192110335 X:68357398-68357420 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1192255900 X:69458685-69458707 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1192289882 X:69783433-69783455 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1192398597 X:70811171-70811193 TGTTGTGGGGTGGGGGCAGGGGG - Intronic
1192715825 X:73641664-73641686 TGTTGTGGTGTGGGGGGAGGGGG - Intronic
1192838736 X:74831339-74831361 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1192844174 X:74888134-74888156 TGTTGTGGGGTGGGGGCAGGGGG + Intronic
1192912753 X:75622371-75622393 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1192946895 X:75973329-75973351 TGTTGTGGTGTGGGGGGAGGGGG + Intergenic
1192981015 X:76341345-76341367 TGTTGTGGGGTTGGGGGAGCTGG + Intergenic
1192983082 X:76367727-76367749 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1193457540 X:81749141-81749163 TGTTGTGGGGTTGGGGGAGGTGG + Intergenic
1193461635 X:81797052-81797074 TGTTGTGGGGTTGGGGGAGGTGG + Intergenic
1193543815 X:82802946-82802968 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1193547663 X:82849777-82849799 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1193556121 X:82955092-82955114 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1193597505 X:83465296-83465318 TGTTGAGGGGTGGGGGGAGGGGG - Intergenic
1193610779 X:83629821-83629843 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1193614751 X:83673412-83673434 TGTTGTGGTGTGGGGGGAGGGGG - Intergenic
1193692898 X:84668818-84668840 TGTTGTGGGGTGGGGGTAGCGGG - Intergenic
1193695537 X:84703066-84703088 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1193853638 X:86571443-86571465 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1193934160 X:87595166-87595188 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1193935097 X:87608908-87608930 TGTTGTGGGGTGGGGGGAGCAGG - Intronic
1194051677 X:89077083-89077105 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1194054495 X:89114926-89114948 TGTTGTGGGGTGGGGGCAGGGGG + Intergenic
1194259193 X:91672741-91672763 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1194271296 X:91819817-91819839 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1194442114 X:93945735-93945757 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1194454508 X:94085664-94085686 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1194569942 X:95544038-95544060 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1194575803 X:95613099-95613121 TGTTGAGGGGTTGGGGGAAAGGG - Intergenic
1194619465 X:96151470-96151492 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1194621253 X:96175512-96175534 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1194648997 X:96492405-96492427 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1194741342 X:97578316-97578338 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1194834941 X:98670502-98670524 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1194880142 X:99240595-99240617 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1195337785 X:103873234-103873256 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1195337846 X:103874251-103874273 TGTTGTGGAGTTGGGGGAGGGGG + Intergenic
1195409932 X:104559247-104559269 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1195512025 X:105726793-105726815 TGATGAGGTTTTAGGGAAGCAGG - Intronic
1195779927 X:108450990-108451012 TGTTGAGGGGTGGGGGGAGTGGG - Intronic
1195851974 X:109293677-109293699 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1195935553 X:110122420-110122442 TGTTGTGGGGTTGGGGGAGGGGG + Intronic
1196037344 X:111160612-111160634 TGTTGTGGGGTGGGGGGAGCGGG - Intronic
1196204405 X:112923042-112923064 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
1196484167 X:116184780-116184802 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1197031382 X:121820427-121820449 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1197322502 X:125050307-125050329 TGTTGTGGGGTGGGGGCAGGGGG - Intergenic
1197417664 X:126194546-126194568 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1197450894 X:126615962-126615984 TGTTGTGGAGTTGGGGGAGGGGG + Intergenic
1197697335 X:129564716-129564738 TGTTGTGGGGTGGGGGGAGCGGG + Intronic
1197833946 X:130674764-130674786 TGTTGTGGGGTTGGGGGAGGGGG - Intronic
1197911568 X:131488374-131488396 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1197991308 X:132320410-132320432 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1198067775 X:133116364-133116386 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1198336057 X:135667882-135667904 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1198344374 X:135745108-135745130 TGTTGTGGTGTGTGGGGAGCGGG + Intergenic
1198490813 X:137139386-137139408 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1198839324 X:140840040-140840062 TGTTGTGGGGTTGGGGGAGCGGG - Intergenic
1199101291 X:143803314-143803336 TGTTGTGGGGTGGGGGGAGCGGG + Intergenic
1199804740 X:151287395-151287417 TGTTGTGGGGTGGGGGGAGCAGG - Intergenic
1200016513 X:153168435-153168457 TGTTGTGGGGTGGGGGAAGCGGG + Intergenic
1200714895 Y:6526992-6527014 TGTTGTGGGGTAGGGGGAGCGGG + Intergenic
1200840836 Y:7780196-7780218 TGTAAAGGTGTTGGGGAAACAGG + Intergenic
1200879651 Y:8199421-8199443 TGTTGTGGGGTGGGGGGAGCAGG + Intergenic
1200912248 Y:8541249-8541271 TGTTGTGGGGTTGGGGGAGGAGG + Intergenic
1201016101 Y:9603615-9603637 TGTTGTGGGGTTGGGGAAGAGGG - Intergenic
1201018928 Y:9634139-9634161 TGTTGTGGGGTAGGGGGAGCGGG - Intergenic
1201246961 Y:12014376-12014398 TGTTGTGGGGTGGGGGGAGCGGG - Intergenic
1201402617 Y:13619519-13619541 TGTTGTGGGGTTGGGGGAGAAGG + Intergenic
1201466601 Y:14288130-14288152 TGTTGTGGGGTTGGGGGAGGAGG + Intergenic
1201546210 Y:15164853-15164875 TGTTGTGGGGTTGGGGGAGGAGG + Intergenic
1201610902 Y:15841753-15841775 TGTTGTGGGGTGGGGGAAGCGGG - Intergenic
1201691298 Y:16768062-16768084 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1201780366 Y:17714336-17714358 TGTTGTGGGGTGGGGGCAGTGGG + Intergenic
1201821188 Y:18191656-18191678 TGTTGTGGGGTGGGGGCAGTGGG - Intergenic
1201935182 Y:19403909-19403931 TGTTGTGGGGTTGGGGGAGGGGG + Intergenic
1201990646 Y:20021078-20021100 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1202017751 Y:20429635-20429657 TGTTGTGGGGTTGGGGGAGTGGG + Intergenic
1202055006 Y:20820531-20820553 TGTTGTGGGGTTGGGGGAGGGGG - Intergenic
1202382953 Y:24294560-24294582 GGTGGAGGGGTGGGGGCAGCGGG - Intergenic
1202487831 Y:25375561-25375583 GGTGGAGGGGTGGGGGCAGCGGG + Intergenic