ID: 1083997187

View in Genome Browser
Species Human (GRCh38)
Location 11:66278345-66278367
Sequence GGCATGGCCCGTGGGGCTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 183}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083997187_1083997210 23 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997210 11:66278391-66278413 GGGGGCGTCCCCTTGCGCCCGGG 0: 1
1: 0
2: 2
3: 8
4: 126
1083997187_1083997209 22 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997209 11:66278390-66278412 GGGGGGCGTCCCCTTGCGCCCGG 0: 1
1: 0
2: 1
3: 8
4: 82
1083997187_1083997203 3 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997203 11:66278371-66278393 CCGGCCCTAAGCGCGGGCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 68
1083997187_1083997201 2 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997201 11:66278370-66278392 GCCGGCCCTAAGCGCGGGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 95
1083997187_1083997200 1 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997200 11:66278369-66278391 GGCCGGCCCTAAGCGCGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 74
1083997187_1083997204 4 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997204 11:66278372-66278394 CGGCCCTAAGCGCGGGCCGGGGG 0: 1
1: 0
2: 1
3: 3
4: 77
1083997187_1083997196 -4 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997196 11:66278364-66278386 TGCCCGGCCGGCCCTAAGCGCGG 0: 1
1: 0
2: 1
3: 6
4: 50
1083997187_1083997205 5 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997205 11:66278373-66278395 GGCCCTAAGCGCGGGCCGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1083997187_1083997197 -3 Left 1083997187 11:66278345-66278367 CCCCGAGCCCCACGGGCCATGCC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1083997197 11:66278365-66278387 GCCCGGCCGGCCCTAAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083997187 Original CRISPR GGCATGGCCCGTGGGGCTCG GGG (reversed) Exonic
900226800 1:1536765-1536787 CGCAAGGCGCGTGGGGCCCGCGG - Intronic
900291740 1:1926572-1926594 GGGGTGGGCCGTGGGGCTGGGGG + Intronic
900584870 1:3427951-3427973 GGCCTGGCCTGTGGCGCTCATGG - Intronic
901176211 1:7301478-7301500 GGCTTTGCCCGTGGGGCCCGGGG + Intronic
901204282 1:7485002-7485024 GGCATGGCCCATGGTGAGCGTGG - Intronic
902640737 1:17764657-17764679 GGCATGCCAAGTGGGGCTGGAGG - Intronic
902809006 1:18877769-18877791 GGCCTGGCCCGTGGGTCTCTGGG - Intronic
903037797 1:20505497-20505519 GGCATGGGCCTGGGAGCTCGAGG + Intronic
905334116 1:37232305-37232327 GGCTTGGACCCTGGGGCTCCTGG + Intergenic
906128502 1:43442136-43442158 GGCATGGCCCGGGGGGGCGGGGG + Intronic
906677118 1:47701241-47701263 GGTAGGGCCTGTGGGGCTGGAGG - Intergenic
906719769 1:47996793-47996815 GCCAGGGCCCGCGGGGCGCGGGG + Exonic
916963849 1:169915269-169915291 GGCATGGCCCCTGGGGGATGCGG - Intergenic
920437202 1:205955066-205955088 GGAATAGCCCATGGGGCTGGGGG - Intergenic
920496902 1:206461310-206461332 GGCTTGGGCCGTGTGGCTGGTGG - Exonic
1063664701 10:8054426-8054448 GGCGAGGCCCGCGGGGCTTGGGG - Intronic
1066453649 10:35553738-35553760 GGCATCGCCCTTGGGGGTTGTGG + Intronic
1067545770 10:47191607-47191629 GGCATGGCCCTTGGGCCGCCTGG - Intergenic
1072737978 10:97891894-97891916 GGCAGGGCCCTTGGGTCACGAGG - Intronic
1076299668 10:129415476-129415498 GTCAAGGCCCCTGGGGCTCAGGG - Intergenic
1076372511 10:129964454-129964476 GGCGGGGCTCGCGGGGCTCGCGG - Intergenic
1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG + Intergenic
1076612749 10:131736812-131736834 GGGTTGGCCCCTGGGGCTTGGGG + Intergenic
1076731413 10:132440856-132440878 GCCATGGACAGTGGGGCTCAGGG - Intergenic
1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG + Intronic
1076846781 10:133073133-133073155 GGCCTGGCCCCGGGGGCTCGTGG - Intronic
1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG + Intronic
1077505794 11:2929517-2929539 GGTATGGCCCGGGGCGCGCGGGG - Intergenic
1077581854 11:3422360-3422382 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
1080384832 11:31805155-31805177 GGCAGGCCCCGAGGGGCGCGGGG - Intronic
1082849494 11:57752935-57752957 GGAATGGACCGTGGGGATCCGGG + Intronic
1083417458 11:62534954-62534976 GGCATGGCCGGGGGAGCTCAGGG + Intronic
1083436373 11:62646357-62646379 GGCCTTGCCTGTGGGGCTCCGGG - Intronic
1083595227 11:63915814-63915836 GCCATGGCCATTGGGGCTGGAGG + Intronic
1083595447 11:63916640-63916662 GCCCTGGCTCGTGGGGGTCGTGG - Exonic
1083729444 11:64644888-64644910 GGGGTGGCACATGGGGCTCGTGG - Intronic
1083997187 11:66278345-66278367 GGCATGGCCCGTGGGGCTCGGGG - Exonic
1084010841 11:66347541-66347563 TGCATGGCTCTCGGGGCTCGGGG + Exonic
1084238763 11:67805177-67805199 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
1084284087 11:68120729-68120751 GGCGTGGGCCGGGGGGGTCGGGG - Intronic
1084412912 11:69014357-69014379 GGCATGGCCCGTGAGCCTCCAGG - Intergenic
1084637019 11:70399068-70399090 GGCTGGGCCTGTGGGGTTCGGGG + Intronic
1089012943 11:115145424-115145446 GGCATGCCCGCTGGGGCTGGGGG - Intergenic
1089457729 11:118635073-118635095 GGCGTGGCCCGCGGGGCCGGGGG - Intronic
1091705750 12:2691779-2691801 GGCGTGGCCCGTGCCGGTCGGGG - Intronic
1092409452 12:8242809-8242831 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
1095584496 12:43835789-43835811 GGCTCGGCCCGTGGCGCACGCGG + Intergenic
1095958499 12:47819629-47819651 GGCTGGGCCCGCGGGGCTGGCGG + Intronic
1095982429 12:47981032-47981054 GGCAGGGCCCAAGGGGCTCTTGG - Intronic
1097720989 12:63021318-63021340 GGCTTGTCCCGTGGGTCCCGTGG + Intergenic
1101551591 12:105767531-105767553 GGCCTGGCCAGAGGGGCTCGGGG + Intergenic
1102339172 12:112108451-112108473 GGCAGGCCCCGTGGGACGCGTGG - Intronic
1103410849 12:120710516-120710538 GGCTGGGCCCGGGGGGCTGGTGG + Exonic
1103701201 12:122849527-122849549 CGCAGGGGCCGTGGGGCTGGAGG + Intronic
1104715336 12:131012641-131012663 GGGATGGGCGGTGGGGCTCATGG - Intronic
1104821270 12:131678949-131678971 GGACTGGCCCGTGTGGCTGGCGG + Intergenic
1104899439 12:132180788-132180810 GGGAGGGCCTGTGGGTCTCGGGG + Intergenic
1105335534 13:19464030-19464052 GGGATGGGCCTTGGGCCTCGGGG + Intronic
1116614848 14:47121999-47122021 TGCATGGACCTTGGGGCTCAAGG + Intronic
1118821333 14:69348032-69348054 GGCATGGCCCCTCGGGCTGCTGG - Intronic
1119536755 14:75409125-75409147 GGCCTGGCCTGTGGGGCCTGGGG + Intergenic
1121352399 14:93184422-93184444 GGCAGGGCGCGCGGGGCTTGGGG - Intronic
1121613811 14:95299396-95299418 TGCGTGTCCCGTGGGGCTGGAGG - Intronic
1122028469 14:98895071-98895093 TGCATGGCCCAGGGGGCTCTGGG + Intergenic
1122582197 14:102777759-102777781 GGCGGGGCCCGGGGGCCTCGGGG + Intronic
1122833865 14:104421506-104421528 GGCTTGGCCAGGGTGGCTCGTGG + Intergenic
1123020808 14:105397112-105397134 GGGATGGACCGTGGGGCTCCTGG - Exonic
1123405999 15:20019818-20019840 GGCATGGCCTGTGAGGCTGCAGG - Intergenic
1123515329 15:21026466-21026488 GGCATGGCCTGTGAGGCTGCAGG - Intergenic
1124168834 15:27353961-27353983 GGCATTGCCCCAGGGGCTGGAGG - Intronic
1124640247 15:31392413-31392435 GGCGTGGCCTGGGCGGCTCGAGG - Intronic
1127469631 15:59278976-59278998 GGGGTGGCACGTGAGGCTCGGGG + Intronic
1128054290 15:64688351-64688373 GGCATGGCCTGGAGGGCTGGTGG - Exonic
1132391599 15:101442876-101442898 AGCAGGGCCCGTGGAGCTGGCGG - Intronic
1132468591 16:89346-89368 GTCATGGCCAGTGTGGCTTGAGG - Intronic
1132539591 16:502367-502389 GGCATGGCCTGCGGTGCTGGGGG + Intronic
1132600320 16:770126-770148 GGCTGGGCCAGTGGGGCTGGTGG + Exonic
1132805719 16:1774198-1774220 GGCAGGGCCCCTGGGGCACCCGG + Intronic
1132909180 16:2299571-2299593 GGCCTTGGCCGTGGGCCTCGGGG - Intronic
1133350428 16:5097603-5097625 GGAGAGGCCCGCGGGGCTCGCGG - Intronic
1134094654 16:11411477-11411499 CGTATGGCCCTTGGGCCTCGGGG - Intronic
1134143663 16:11742953-11742975 GGCGTGGCCCGTTGGGGGCGGGG - Intergenic
1136029197 16:27490425-27490447 GGCATGGCCGGTGGGGCCCGGGG + Intronic
1136073557 16:27803262-27803284 GGCATGGACAGAGGGGCTTGGGG - Intronic
1136849101 16:33599640-33599662 GGTAAGGCCTGTGGGGTTCGGGG + Intergenic
1137926548 16:52546821-52546843 GGGGTGGCGCGTGGGACTCGCGG + Exonic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138105226 16:54284406-54284428 GGCAGGGCCCGGGGGGCGCAGGG - Intronic
1138474643 16:57263646-57263668 GGCAGGGCCCAGGGAGCTCGTGG + Intronic
1138506160 16:57479348-57479370 GGCATGGCGCGTGGGGCACGCGG - Intronic
1139446681 16:67002560-67002582 GGGAAGGCCCCTGGGGCTGGGGG + Intronic
1139593167 16:67944195-67944217 GGCCTGGCCAGTGGGGGTTGTGG + Exonic
1142120434 16:88383942-88383964 GGGAAGGCCAATGGGGCTCGGGG + Intergenic
1203110808 16_KI270728v1_random:1448290-1448312 GGTAAGGCCTGTGGGGTTCGGGG + Intergenic
1142638268 17:1270935-1270957 CGCAGGGCCCGCGGGGCGCGGGG - Exonic
1144999145 17:19291313-19291335 GGCATGGCCCGAAGGCCTGGCGG - Intronic
1145779297 17:27551784-27551806 GGCCTGGACCGTGGTGCTGGAGG - Intronic
1145997104 17:29111136-29111158 GACAGGGCCCGTGGGGCTGGGGG + Intronic
1147123802 17:38352210-38352232 GGCCCGGCCCGCGGGGCTCCCGG + Intronic
1147160714 17:38568073-38568095 GGTATGGGCGGTGGGCCTCGGGG - Intronic
1147421573 17:40324466-40324488 GGTATGGCCCCTGGGGATGGAGG + Intronic
1148110687 17:45143469-45143491 GCCATGGCCCCTTGGGCTCCCGG + Exonic
1148559558 17:48598012-48598034 GCCCTGGCCCGTAGGGCGCGGGG + Exonic
1148756494 17:49975795-49975817 AGCATGGCCTGAGGGGCTGGGGG + Intergenic
1152124248 17:78437004-78437026 TGCCTGGCACCTGGGGCTCGAGG - Intronic
1152631147 17:81411206-81411228 GGCATGCCCAGTGGGGCCCCAGG + Intronic
1152706244 17:81845079-81845101 GGCATGTCCCGTGGGGCCAAGGG + Intronic
1154168059 18:12030524-12030546 GGCATGGAGCGTGGGCCACGAGG - Exonic
1155864111 18:30942505-30942527 GGCCTGGACCGTGGGGCTATGGG + Intergenic
1157293166 18:46424291-46424313 GGCAAGGCCCCTGGGGGTCTGGG + Intronic
1161744724 19:6048913-6048935 GGCACTGGCCGTGGGGCTCTGGG - Intronic
1161848867 19:6728428-6728450 GGGATGGCCCGCGAGGCTGGAGG - Intronic
1165455539 19:35908383-35908405 GGCATGGCCCCTGGGTGTCTGGG - Intergenic
1166331558 19:42080719-42080741 CGAGTGGCCCGTGGGGCTCGAGG - Exonic
1167019187 19:46861349-46861371 GGCGGGGCCCGGGGGGCTGGGGG - Intergenic
1167649914 19:50723574-50723596 GGCTTTGGCCATGGGGCTCGGGG + Exonic
928200310 2:29243583-29243605 GGCATGGCCAAGGGGGCTTGGGG + Intronic
928373382 2:30757130-30757152 ATCATCGCCCGTGGGGCTGGGGG - Intronic
931892502 2:66689306-66689328 GGGATGGCCCATGGGGTTCGGGG + Intergenic
937867687 2:126766380-126766402 GCCATGGCCTGTGGTGCTCCTGG + Intergenic
937996926 2:127701403-127701425 GGCAGGGCCTGCGGCGCTCGCGG - Exonic
941367045 2:164621618-164621640 CGCGTGGCCCGGGGCGCTCGGGG + Exonic
945119551 2:206443710-206443732 GGCACGGGGCGCGGGGCTCGGGG - Exonic
948360008 2:237413208-237413230 GGCAGGGCCCCTGGGGCTGCAGG - Intronic
948456179 2:238105662-238105684 AGCCTGGCCCATGGGGCCCGGGG + Intronic
1172519874 20:35559582-35559604 GACATGGTGCGTGGGGCCCGGGG - Intergenic
1173389716 20:42621224-42621246 GGCAAGGCCCGAGGAGCTGGAGG - Intronic
1173870344 20:46337860-46337882 GGCAGGGCCCACGGGGCTCTGGG - Intergenic
1175569997 20:60011117-60011139 GGCATTGGCCATGGGGCTGGAGG + Intronic
1175916142 20:62426939-62426961 GGCCTGGCCCGTGGGGGAGGGGG + Intronic
1175927704 20:62479196-62479218 AGCATGGTTCGTGGGGATCGAGG - Intergenic
1179906436 21:44425533-44425555 TGCATGGCCATTTGGGCTCGGGG + Intronic
1180086516 21:45510144-45510166 GGCGCGGGCCGTGGGGCTGGCGG + Exonic
1181182384 22:21077370-21077392 GGGATGCCCCGTGGGGATAGAGG - Intergenic
1182095048 22:27620428-27620450 GGCATGGCCTGTGGAGATCTAGG - Intergenic
1182624568 22:31636410-31636432 GGCATGGCCCTGGGGGCTTGTGG - Intronic
1183069755 22:35387791-35387813 GCCATGGGGCCTGGGGCTCGGGG + Intronic
1184403107 22:44285488-44285510 TGCACGGCCTGTGGGGCTTGTGG + Exonic
1184523458 22:45008693-45008715 GGCCCCGCCCGTGGGGCTCCGGG - Intronic
1184686221 22:46097610-46097632 GGAAGGGCCAGTGGGGCTTGGGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
950912119 3:16605426-16605448 GGCGTGGTCCGCGGGGCTCAGGG + Intronic
952900450 3:38108729-38108751 GGCATGGCCAGTGGGTCTCAGGG - Intronic
954292376 3:49656418-49656440 GCCAAGGCCCCTGGGGCTGGGGG + Exonic
954937358 3:54338798-54338820 GCCCTGGCTCGTGGGGCTTGAGG + Intronic
955753921 3:62208945-62208967 GCCATGGGCCGTGTGGCTCTGGG - Intronic
957054715 3:75434975-75434997 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
961785099 3:129342888-129342910 GGCAGGGCCCGTGGGGCATTTGG + Intergenic
968812826 4:2807816-2807838 GGCATGGCAGGTGAGGCTGGTGG + Intronic
968997525 4:3955283-3955305 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
973134521 4:46689719-46689741 CGCATGCCCCGTGGGGCTTCAGG + Intergenic
992716322 5:79514265-79514287 CGCAAGGCCCGTCGGGCTCCCGG - Intergenic
999143591 5:149378562-149378584 GGCATGGGCCATGGGGCTGTGGG - Intronic
1001634675 5:173201335-173201357 GGCATAGCCAGCAGGGCTCGGGG - Intergenic
1002100188 5:176853760-176853782 GGCATGGGCCCTGGGACTCTGGG + Intronic
1002185638 5:177453638-177453660 GGTAGGGTCCGTGGGGCTCCTGG + Intronic
1002349909 5:178576713-178576735 GGCCTGGCGCGCGGGGCCCGGGG - Intronic
1002541119 5:179907383-179907405 TGCACGGCCCCCGGGGCTCGCGG + Intronic
1002780287 6:359842-359864 GGCAGCGCCCATGGGGCTGGTGG - Intergenic
1003212503 6:4079584-4079606 GACATGGCCAGTGGGCCTCTGGG + Exonic
1004396145 6:15248221-15248243 GGGACGGCCCGCGGGGGTCGCGG + Intronic
1006393111 6:33770536-33770558 GCCATGCCCCATGGGGCTTGTGG - Intergenic
1007161139 6:39792563-39792585 AGCATGCCCCGCGGGGCTTGGGG + Intronic
1007821737 6:44565329-44565351 GGTGTGGCCCGTGTGGCTCCGGG - Intergenic
1015938269 6:138424268-138424290 AGCATAGCCCGCGGGGCTCTGGG - Exonic
1018582120 6:165316536-165316558 GGCACTGCACGTGGGGCACGTGG + Intergenic
1018794803 6:167177470-167177492 GCCATGGCCCGTGCGTCTGGGGG + Intronic
1018821515 6:167377597-167377619 GCCATGGCCCGTGCGTCTGGGGG - Intronic
1019593446 7:1847326-1847348 GGCATGGCAGGCGGTGCTCGCGG + Exonic
1019922363 7:4171186-4171208 GGCAGGGTCCCTGGGGCACGTGG - Intronic
1020101291 7:5395504-5395526 GGGATGGCGTTTGGGGCTCGTGG - Intronic
1033253205 7:139777839-139777861 GGCCCGGCGCGGGGGGCTCGGGG + Intronic
1034179599 7:149126827-149126849 GGCATGTCCCGTCGGGGACGCGG + Intronic
1035272727 7:157729991-157730013 GACATGGCCCATTGTGCTCGAGG + Intronic
1035432098 7:158829788-158829810 AGGGTGCCCCGTGGGGCTCGAGG - Intronic
1036379729 8:8228719-8228741 GGAGAGGCCCGCGGGGCTCGCGG + Intergenic
1037704720 8:21309519-21309541 GGCATGGCCAGTTGGGCATGGGG + Intergenic
1037783630 8:21888715-21888737 GGCAGGCCTCGTGGGGCCCGAGG - Intergenic
1040564637 8:48554669-48554691 GGCATGGGGAGTTGGGCTCGGGG + Intergenic
1049109903 8:140635911-140635933 GGCGCGGCCCGTGTGGCGCGGGG + Intergenic
1049604954 8:143525084-143525106 GGCCTGGGCCTTGGGGCTCACGG - Intronic
1049750101 8:144279061-144279083 GTCATGGCCCGTGGTGGTCTTGG - Intronic
1049750115 8:144279109-144279131 GTCATGGCCCATGGCGGTCGTGG - Intronic
1056389494 9:86127495-86127517 GGCGTGGCCCTTGGGTCTCCTGG + Intergenic
1056852676 9:90097538-90097560 GGCATGGCCCCTTGGTCTTGTGG - Intergenic
1058707345 9:107648308-107648330 GCCATGGGCCGTGGGTCTGGAGG - Intergenic
1059234573 9:112750919-112750941 GGCTCGGCCCGGGGTGCTCGGGG + Exonic
1061804169 9:133128883-133128905 GGACTGACCCGTGGGGCTGGGGG + Intronic
1061877859 9:133553916-133553938 GGCCTGGGCAGTGGGGCTCTGGG + Intronic
1061946291 9:133909997-133910019 GGCATAGCTCGTGTGGCTCGTGG - Intronic
1061975996 9:134068217-134068239 GGCCTGGCCCGGGGGGCGCGCGG + Intronic
1062172737 9:135144525-135144547 GGCAGGGCTCGTGGGGATCCTGG - Intergenic
1062230701 9:135480037-135480059 GGCCGGGGCCGGGGGGCTCGGGG + Intronic
1062538280 9:137030397-137030419 GGCAGGGCCCTTGGGGCTGGGGG - Exonic
1186508231 X:10110918-10110940 GGCTTGGCACGAGGGGCTCACGG + Intronic
1186985108 X:15004152-15004174 GGCATGGTCCATGAGGCTCTTGG + Intergenic
1194800226 X:98264077-98264099 GGCAATGCCAGTGGGGCTCCAGG - Intergenic
1200228598 X:154432821-154432843 GGCTTGGTGCGTGGGGCTAGTGG + Intronic
1202281949 Y:23199011-23199033 GGCATGGACTGCGGGGCTCTGGG + Exonic
1202283942 Y:23219508-23219530 GGCATGGACTGCGGGGCTCTGGG - Intronic
1202433621 Y:24813396-24813418 GGCATGGACTGCGGGGCTCTGGG + Exonic
1202435618 Y:24833894-24833916 GGCATGGACTGCGGGGCTCTGGG - Intronic