ID: 1084000139

View in Genome Browser
Species Human (GRCh38)
Location 11:66291730-66291752
Sequence CGTCCCCGAGAAGCCCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084000139_1084000144 0 Left 1084000139 11:66291730-66291752 CCAGCGGGGGCTTCTCGGGGACG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1084000144 11:66291753-66291775 GGCGGAGCGCCCGCGGTGCCAGG 0: 1
1: 0
2: 4
3: 21
4: 163
1084000139_1084000148 12 Left 1084000139 11:66291730-66291752 CCAGCGGGGGCTTCTCGGGGACG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1084000148 11:66291765-66291787 GCGGTGCCAGGCGCTGCCGGCGG 0: 1
1: 0
2: 0
3: 17
4: 246
1084000139_1084000150 21 Left 1084000139 11:66291730-66291752 CCAGCGGGGGCTTCTCGGGGACG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1084000150 11:66291774-66291796 GGCGCTGCCGGCGGCGCCGCCGG 0: 1
1: 2
2: 6
3: 67
4: 789
1084000139_1084000146 9 Left 1084000139 11:66291730-66291752 CCAGCGGGGGCTTCTCGGGGACG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1084000146 11:66291762-66291784 CCCGCGGTGCCAGGCGCTGCCGG 0: 1
1: 0
2: 1
3: 18
4: 184
1084000139_1084000152 29 Left 1084000139 11:66291730-66291752 CCAGCGGGGGCTTCTCGGGGACG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1084000152 11:66291782-66291804 CGGCGGCGCCGCCGGTGCCGCGG 0: 1
1: 0
2: 1
3: 63
4: 678
1084000139_1084000153 30 Left 1084000139 11:66291730-66291752 CCAGCGGGGGCTTCTCGGGGACG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1084000153 11:66291783-66291805 GGCGGCGCCGCCGGTGCCGCGGG 0: 1
1: 0
2: 2
3: 59
4: 630
1084000139_1084000143 -7 Left 1084000139 11:66291730-66291752 CCAGCGGGGGCTTCTCGGGGACG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1084000143 11:66291746-66291768 GGGGACGGGCGGAGCGCCCGCGG 0: 1
1: 0
2: 0
3: 33
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084000139 Original CRISPR CGTCCCCGAGAAGCCCCCGC TGG (reversed) Intergenic
901192501 1:7420960-7420982 CTCCCCTGAGAAGCCCCCACTGG - Intronic
901405443 1:9041863-9041885 CCACCCCGAGAGCCCCCCGCAGG + Exonic
907296595 1:53459807-53459829 CTTCTTCGAGCAGCCCCCGCGGG + Exonic
912539982 1:110407481-110407503 CGTCCCCGAGACGCCCTGGCCGG + Intronic
916051337 1:161038854-161038876 CGGCCCCAGGAATCCCCCGCAGG + Intronic
920710169 1:208287332-208287354 CCTCTCCGAGCAGCCCCCTCCGG - Intergenic
924511213 1:244730488-244730510 CGTCCCCGGGCGGCCCGCGCAGG - Intergenic
1064122622 10:12633053-12633075 TGTCCCCGTGAGGCCCCAGCAGG + Intronic
1065140280 10:22713796-22713818 CGGCCCCCAGCAGCTCCCGCCGG + Intronic
1076741513 10:132488118-132488140 TGTCCCTGAGAAGCCCACTCAGG + Intergenic
1077051310 11:568274-568296 CGACCCCCCGCAGCCCCCGCGGG + Intergenic
1077305980 11:1868882-1868904 CGACCCCCAGATGCCCCTGCTGG + Intronic
1081667558 11:44925422-44925444 AGTCCCCCAGAAGCCCTCCCTGG - Intronic
1081852173 11:46281438-46281460 GATCCCAGAGAAGCCCCAGCTGG + Intronic
1083221978 11:61258691-61258713 TCCCCCCGAGAAGCCCCCACTGG + Exonic
1084000139 11:66291730-66291752 CGTCCCCGAGAAGCCCCCGCTGG - Intergenic
1084195264 11:67520973-67520995 AGTCCTCCAGATGCCCCCGCTGG - Intronic
1090194041 11:124800066-124800088 CGTCCACGACATGCCCCGGCAGG + Exonic
1097250912 12:57631989-57632011 CGCCCCCGCAAAGCCCCCGCAGG - Exonic
1098288629 12:68933632-68933654 CGTCCCGCAGGAGCCCGCGCGGG - Intronic
1102350051 12:112185240-112185262 CGCCCCCCCGGAGCCCCCGCAGG + Exonic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1118936019 14:70289203-70289225 CCTCCCAGAGAAGCTCCCTCTGG + Intergenic
1119742904 14:77026026-77026048 CGGCGCCGCGAAGCCCCCGGCGG + Exonic
1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG + Intergenic
1136075250 16:27812676-27812698 CCACCCCGAGAAGCCTCCGCTGG - Intronic
1136550244 16:30979180-30979202 CGTCCCCCAGAACCACCTGCTGG + Exonic
1141673983 16:85507969-85507991 AGTCCCCCAGAAGCCCCCTGTGG + Intergenic
1143771449 17:9171612-9171634 TGTCCGCGAGAAGCCCCTCCAGG - Intronic
1144686451 17:17229133-17229155 CGTCCCCGTGAAGGCTCAGCAGG - Intronic
1147369268 17:39980597-39980619 CGTCCACGAGAGGTCCCCTCAGG - Intergenic
1148185654 17:45641669-45641691 CCTCCCCGAGTTGTCCCCGCTGG - Intergenic
1151332560 17:73419278-73419300 CCTCCCCGAGGAGCCCCCCACGG - Exonic
1152345307 17:79747601-79747623 CGTCCCAAAGAAGCCCGCGGAGG - Intergenic
1152916022 17:83036380-83036402 CAGCCCCCAGAAGCCCCCTCAGG - Intronic
1153997434 18:10454520-10454542 CGCCCCCGGGCAGCCGCCGCCGG - Intergenic
1160853276 19:1205147-1205169 TTTTCACGAGAAGCCCCCGCTGG + Intronic
1161029275 19:2050489-2050511 TGTCCCCTGCAAGCCCCCGCCGG - Intronic
1161264704 19:3358913-3358935 CCTCCCCGAGCAGCCCTGGCCGG - Intergenic
1162395554 19:10416594-10416616 CGAGCCGGGGAAGCCCCCGCGGG + Intronic
1163167468 19:15508093-15508115 CCCCCCCGAGAAGCCTCCTCTGG - Intergenic
1163215236 19:15871558-15871580 AGTCCCCAAGCAGCCCCTGCTGG + Intergenic
1164934871 19:32202464-32202486 AGTCCCCGGGTAGCTCCCGCTGG + Intergenic
1165871472 19:38975983-38976005 CATCCCCAAGACGCCCCCGCGGG + Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
926397014 2:12453917-12453939 CCTCCCCGAGGCTCCCCCGCCGG - Intergenic
926397028 2:12453944-12453966 CCTCCCCGAGGCCCCCCCGCCGG - Intergenic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
935740151 2:106140243-106140265 CTTCCCTGTGAAGCCACCGCAGG + Intronic
937272500 2:120661958-120661980 TGGCCCTGGGAAGCCCCCGCAGG + Intergenic
1168892103 20:1301249-1301271 TGTCTCCCAGGAGCCCCCGCAGG + Intronic
1176234644 20:64048711-64048733 CTTCCGCGAGCTGCCCCCGCTGG - Exonic
1181689221 22:24549095-24549117 GGTCCCTGAGCAGCCCCTGCAGG - Intronic
1182145764 22:27995872-27995894 CGTCCCCGGGATGAGCCCGCTGG - Intronic
1184089174 22:42283493-42283515 GCTCCCCGAGCAGCCCCCTCGGG + Intronic
954763904 3:52897312-52897334 CGACGCCGAGCAGCCCCTGCAGG + Exonic
966390933 3:179451571-179451593 CGTCCCCGGCACGTCCCCGCCGG - Exonic
967848379 3:194062843-194062865 CTTCCTCAAGAAGCCCCAGCAGG + Intergenic
976629324 4:87220552-87220574 CGGCCCCGCGGAGCCCCGGCGGG + Exonic
982198438 4:152937459-152937481 CCTCCCCGAGGGGCCCACGCTGG - Intronic
986023345 5:3825396-3825418 CGTCCACGTGAAGTCCCCTCAGG + Intergenic
997625300 5:135327129-135327151 CGTCCCAGAGAAGCCCGCGCGGG + Intronic
1001601024 5:172928457-172928479 CGTCTCCAAGAAGCCCTCACTGG + Intronic
1002887828 6:1312045-1312067 CGCCCCCGCGGAGCCGCCGCAGG + Intergenic
1003081284 6:3023789-3023811 CGTCACCGAGCAGCCGTCGCTGG + Intergenic
1014569124 6:122986954-122986976 CGTCCCAGAGAGGCACCCGCCGG - Intergenic
1015928612 6:138334698-138334720 TTTCCCAGAGAAGCCCCCGGTGG - Exonic
1016386771 6:143537101-143537123 GGTCCCCGGGAAGCCAGCGCAGG - Intronic
1018923531 6:168191701-168191723 CCTCCCCAAGAAGCCTCCCCAGG - Intergenic
1020059919 7:5144277-5144299 CGTCCCCTGGAAGCTCGCGCAGG - Intergenic
1029715136 7:102321558-102321580 CGCCGCCGAGGAGCCCCCGGAGG + Exonic
1033464380 7:141577727-141577749 GGTCCCCGAGAAACCCCAACCGG - Intronic
1035249638 7:157588474-157588496 TGTCGCAGAGAAGCCCCCGCAGG - Intronic
1035376290 7:158409104-158409126 CATTCATGAGAAGCCCCCGCAGG + Intronic
1036765243 8:11545902-11545924 TGTCCCTGAGCAGCCCCCACAGG + Intronic
1042894412 8:73651168-73651190 GGGCCCCGAGGAGCCCCCTCAGG + Intronic
1043542568 8:81280405-81280427 CGACCCCGAGAAGGCCCAGGGGG + Exonic
1047203087 8:122782429-122782451 CGTCCCGGTGGAGTCCCCGCGGG - Intronic
1049585265 8:143430077-143430099 CTTCCCCGAGGTGCCCCCGACGG + Exonic
1057152553 9:92808373-92808395 CGTCCCTGTGCAGCCGCCGCGGG - Intergenic
1061006233 9:127929816-127929838 GGCGCCAGAGAAGCCCCCGCCGG + Exonic
1062438393 9:136557225-136557247 CGTCCCCGAGAGAGCCCTGCAGG + Intergenic
1185736405 X:2500242-2500264 AGTGCCCGAGAAGCCGCCTCTGG + Intronic
1189250694 X:39598944-39598966 CGTGCCCCAGAACCCCCTGCAGG + Intergenic
1192369442 X:70501006-70501028 AGTTCCCCAGAACCCCCCGCAGG - Intronic
1200163276 X:154019835-154019857 CGGCCCTGAGAGGCCCCGGCAGG - Exonic