ID: 1084000222

View in Genome Browser
Species Human (GRCh38)
Location 11:66292001-66292023
Sequence CAGCCAGGACACCATGCCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084000202_1084000222 28 Left 1084000202 11:66291950-66291972 CCTCCGTGCTCCCCCCTATCATG 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000217_1084000222 -3 Left 1084000217 11:66291981-66292003 CCAGGCTGGGGCCGCCCAAGCAG 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000201_1084000222 29 Left 1084000201 11:66291949-66291971 CCCTCCGTGCTCCCCCCTATCAT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000207_1084000222 16 Left 1084000207 11:66291962-66291984 CCCCTATCATGCCCGGTGCCCAG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000216_1084000222 -2 Left 1084000216 11:66291980-66292002 CCCAGGCTGGGGCCGCCCAAGCA 0: 1
1: 1
2: 0
3: 17
4: 197
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000205_1084000222 18 Left 1084000205 11:66291960-66291982 CCCCCCTATCATGCCCGGTGCCC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000208_1084000222 15 Left 1084000208 11:66291963-66291985 CCCTATCATGCCCGGTGCCCAGG 0: 1
1: 0
2: 3
3: 6
4: 124
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000215_1084000222 4 Left 1084000215 11:66291974-66291996 CCGGTGCCCAGGCTGGGGCCGCC 0: 1
1: 0
2: 2
3: 47
4: 496
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000206_1084000222 17 Left 1084000206 11:66291961-66291983 CCCCCTATCATGCCCGGTGCCCA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000214_1084000222 5 Left 1084000214 11:66291973-66291995 CCCGGTGCCCAGGCTGGGGCCGC 0: 1
1: 0
2: 4
3: 65
4: 526
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000210_1084000222 14 Left 1084000210 11:66291964-66291986 CCTATCATGCCCGGTGCCCAGGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184
1084000203_1084000222 25 Left 1084000203 11:66291953-66291975 CCGTGCTCCCCCCTATCATGCCC 0: 1
1: 0
2: 1
3: 20
4: 262
Right 1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG 0: 1
1: 0
2: 1
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084000222 Original CRISPR CAGCCAGGACACCATGCCCG AGG Exonic
900402050 1:2476623-2476645 CAGCCAGGCCACCGTTCCCTTGG - Exonic
900539814 1:3197090-3197112 TAGCCATCACTCCATGCCCGGGG - Intronic
900619960 1:3582112-3582134 CCAGCAGGACACCAGGCCCGGGG + Intronic
900622404 1:3593439-3593461 CACCCAGGACCCCAGGCCCAGGG + Intronic
901630972 1:10647998-10648020 CAGAGAGGACACCGTGGCCGTGG + Exonic
901634539 1:10664447-10664469 CAGCCAGGGGACCGTGGCCGGGG + Intronic
902237975 1:15069796-15069818 AAACCAGGACACCATTCACGTGG - Intronic
902627213 1:17683550-17683572 CAGGCAGGACTCCAGGCTCGTGG + Intronic
905168828 1:36098474-36098496 CAGCCAGGCCACTAGGCCCCTGG + Exonic
907455344 1:54571992-54572014 CAGCCAGGACTTCCTGCCCCAGG - Intronic
907614843 1:55913188-55913210 CAGTCAGGACACCCTGCCTTTGG + Intergenic
915013902 1:152715162-152715184 GAAGCAGGACACCATGCCTGAGG + Intergenic
915013907 1:152715190-152715212 AAGCCAGGACACCAAGCCTGAGG + Intergenic
920034454 1:203056826-203056848 CAGCCAGGACTCCCTGCACAAGG + Exonic
922947536 1:229529846-229529868 CAGCCAGGACAGAGTGCCTGGGG - Intronic
1062951262 10:1505655-1505677 CAGCCACCTCCCCATGCCCGTGG + Intronic
1064615199 10:17146343-17146365 CAGACAGAACACCATGGCCAGGG + Intronic
1067565379 10:47332278-47332300 CACCAAGGAAACCATGCCCAAGG + Intergenic
1067769016 10:49110200-49110222 CAGCCGGGACCCCACGCCCCAGG + Intronic
1069633757 10:69913212-69913234 CTGCCATCACACCATGCACGTGG + Intronic
1069868352 10:71517970-71517992 CAGCCAGGACAGCAAGCTCTGGG + Intronic
1070186020 10:74063180-74063202 GAGCCATGACACCAGGCCCGAGG + Intronic
1070306866 10:75244949-75244971 CAGCCCCTACACCCTGCCCGTGG - Intergenic
1071875231 10:89837329-89837351 CACCCAGGTCACCACGCCTGGGG - Intergenic
1076005394 10:126944600-126944622 CAGGGAGGACACCAAGCCTGAGG + Intronic
1076276702 10:129205625-129205647 CAGCTAGCACACCTTGCCTGTGG + Intergenic
1076632493 10:131859362-131859384 CAGCCTGGACAGCATCCCTGTGG - Intergenic
1077106935 11:846234-846256 CAGCCTGGGTGCCATGCCCGTGG - Intronic
1077328911 11:1975437-1975459 CAGCCTGGACAGCCTGTCCGAGG - Intronic
1080359364 11:31494392-31494414 GATGCAGGACACCATGCCCCAGG + Intronic
1082881293 11:58040914-58040936 CAGCAAAGACACCATGGCCATGG - Intronic
1083292815 11:61699316-61699338 CAGCCAGGTGAGCATGCCCTGGG + Intronic
1083651493 11:64207201-64207223 CACCCAGGCCAGCACGCCCGTGG - Intronic
1083757680 11:64800435-64800457 CTGGCAGGACACCCTGCACGAGG - Intronic
1084000222 11:66292001-66292023 CAGCCAGGACACCATGCCCGAGG + Exonic
1085402123 11:76241519-76241541 CAGCTAGGACCCCATGCCCCTGG - Intergenic
1202811890 11_KI270721v1_random:30616-30638 CAGCCTGGACAGCCTGTCCGAGG - Intergenic
1091975295 12:4819708-4819730 CAGCCACGTCACCTTGCCCTGGG - Intronic
1092006821 12:5077049-5077071 CAGCCAGCACTCCATGTCCAGGG + Intergenic
1092278381 12:7080619-7080641 GCCCCAGGACACGATGCCCGTGG + Exonic
1092280803 12:7096478-7096500 GCCCCAGGACACAATGCCCGTGG + Exonic
1092928244 12:13291502-13291524 CAGGCAGTCCTCCATGCCCGAGG + Intergenic
1094446024 12:30531402-30531424 AAGCCAGTTCACCATGCCAGAGG - Intergenic
1094551062 12:31451973-31451995 CAGCCAGGATTCCATGTCCTGGG + Exonic
1095097127 12:38154812-38154834 CAGCCACTGCGCCATGCCCGGGG + Intergenic
1096094523 12:48925483-48925505 CAGCCAGGACAGCGTTCCCGCGG + Exonic
1096532144 12:52248919-52248941 AAGCCAGGATACCAGGCACGTGG - Exonic
1097153351 12:56995350-56995372 CAGCCAGAGCACCAAGCGCGTGG + Exonic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1103561058 12:121793495-121793517 CAGCCAGGGCTCCTTCCCCGAGG - Exonic
1104946293 12:132416315-132416337 CAGAGAGGCCCCCATGCCCGGGG + Intergenic
1104963210 12:132497922-132497944 CGGGGAGGACACCAGGCCCGAGG - Intronic
1105011817 12:132761535-132761557 CGGCCGGGACCCCAGGCCCGAGG + Intronic
1105211202 13:18258161-18258183 CATCCATCTCACCATGCCCGAGG + Intergenic
1112208215 13:97346819-97346841 CAGCGAGGAAACTGTGCCCGGGG + Exonic
1112436248 13:99393206-99393228 GAGCCACCACACCCTGCCCGGGG - Intergenic
1112506493 13:99979485-99979507 CAGCCAGGAGAACACGCCCGAGG + Intergenic
1113653764 13:112055977-112055999 CAGCGGGGACACCGTGGCCGTGG - Intergenic
1113706417 13:112436194-112436216 CAGCCCTGACACCGTGCCCCAGG + Intergenic
1119666105 14:76486268-76486290 CAGCCAGGAAAGCCTGCCCAGGG + Intronic
1122005301 14:98698527-98698549 GAGCAAGGACCCCATGCCAGCGG - Intergenic
1125427879 15:39567909-39567931 CAGACATGGCAACATGCCCGAGG + Intergenic
1126849740 15:52789708-52789730 CAGCAGGGACGCCATGCCCATGG + Exonic
1129957861 15:79655563-79655585 CAACCTGGTCACCATCCCCGGGG - Intergenic
1130354708 15:83118725-83118747 AAGCCAGGACAGCATGAACGTGG + Intronic
1130922884 15:88363863-88363885 CATCCATAACACCATGCCCCAGG - Intergenic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131177791 15:90220806-90220828 CAGCCAGGACACGGTGCCGAAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132679351 16:1133388-1133410 CTGCCAGGACACCAAACCAGAGG + Intergenic
1132721994 16:1321037-1321059 CAGACAGGACCCCAGGCCCACGG - Intronic
1137411655 16:48233404-48233426 CAGCCAGGGCACCAGGCCATAGG + Intronic
1138093509 16:54194773-54194795 CTCCCAGGACACCATTCCCATGG - Intergenic
1138575353 16:57904074-57904096 CTGCCAGGAGCACATGCCCGTGG - Intronic
1139971105 16:70775722-70775744 CAGCCAGGACTCCATGCCCCTGG + Intronic
1141013909 16:80429555-80429577 CTGGCAGTACACCATGCCTGAGG + Intergenic
1141126027 16:81401727-81401749 CACCCAGGACACCAGCCCTGCGG + Intergenic
1141429990 16:83966431-83966453 CATCCAGGACCACATGCCCCAGG - Intergenic
1141634032 16:85304282-85304304 CAGTAAAGACACCATGCCAGGGG - Intergenic
1141663492 16:85453962-85453984 CAGCCAGGTCCTCATGCCCCAGG + Intergenic
1141664230 16:85457649-85457671 CAGCCAGGTCCTCATGCCCCAGG + Intergenic
1141881955 16:86866118-86866140 CAGCCTGGGCCCCATGCCCACGG + Intergenic
1141948529 16:87325848-87325870 CAGACAGGACACAGTGCCCAGGG - Intronic
1142355943 16:89602104-89602126 CAGGCAGGGCATCCTGCCCGGGG - Intergenic
1143251594 17:5527075-5527097 CAGCCAGGAAACCAATCCCTGGG - Intronic
1143452426 17:7043719-7043741 CAGCCAGATCCCCAGGCCCGAGG + Exonic
1144586626 17:16491600-16491622 CAGACAGGGCTCCATCCCCGCGG + Intronic
1144950296 17:18990286-18990308 CAGGCAGGTCACCATGACCCTGG + Intronic
1145878848 17:28339662-28339684 CCGCCACGACACCATGCTCAAGG + Exonic
1148377260 17:47159699-47159721 CAGCCAGGGCACCAGGTTCGAGG - Intronic
1151787739 17:76283502-76283524 CAGGCAGGACTCCTGGCCCGGGG + Intronic
1152750788 17:82061575-82061597 CAGCCAGGGCCCCATGCACACGG - Intronic
1152754528 17:82081731-82081753 CAGGCAGGACGCCATGCGCTGGG + Exonic
1153813324 18:8771044-8771066 CAGCCAGGACATAGTGCCCGTGG + Intronic
1153925555 18:9832207-9832229 CAGCCAGCACCCCAGGCCGGTGG + Intronic
1155983937 18:32209837-32209859 CAGCCAGGAAACCAGGGCCTTGG - Intronic
1160155775 18:76432770-76432792 CAGGCAGGACCCCATGCCCAGGG + Intronic
1160767587 19:815295-815317 CAGACAGTACAACATGCCCTCGG + Exonic
1161495346 19:4583397-4583419 CAGCCAGGCCTTCCTGCCCGTGG + Intergenic
1162565835 19:11445573-11445595 CAGCCTGGACCCCACGCCGGGGG - Intronic
1162821995 19:13228857-13228879 CAGCGAGGTCATGATGCCCGAGG + Intronic
1162869296 19:13573431-13573453 CAGCTAGGACCCAATGCCGGGGG + Intronic
1164562413 19:29301483-29301505 AAGCCAGGACACAAAGGCCGAGG + Intergenic
1164617146 19:29674064-29674086 CAGCCAGCACATCATCCCCCTGG + Exonic
1165297440 19:34938978-34939000 GACCCTGGAAACCATGCCCGTGG - Intronic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167509497 19:49888576-49888598 CAGCCTGGAGATCCTGCCCGAGG + Exonic
925087240 2:1117710-1117732 CAGTGAGGACTCCATGCCCTGGG - Intronic
925331623 2:3063068-3063090 CAGCCAGGACACCACCCCTGCGG + Intergenic
931586749 2:63838264-63838286 CAGCAAGGAAACCATGTCTGTGG - Intergenic
933749102 2:85591706-85591728 CTGCCTGGACACCAAGCCCGAGG - Exonic
933991166 2:87634853-87634875 CAGCCAGGACACTAGGTCTGGGG - Intergenic
934247112 2:90317102-90317124 GAGCCAGGCCAACATGCCCTGGG - Intergenic
936302673 2:111315970-111315992 CAGCCAGGACACTAGGTCTGGGG + Intergenic
943532970 2:189110260-189110282 CAGACAGGACAGCATTCCCCAGG + Exonic
947257231 2:228180620-228180642 CAGCCAGGACACCCTCTCCCTGG + Intronic
947674524 2:231965845-231965867 CAGCCAGGGCAACATGGACGTGG - Intronic
948223895 2:236293937-236293959 CAGCCAGGACTCTGTGGCCGTGG + Intergenic
948516508 2:238507234-238507256 AAGCCAGTAGACGATGCCCGAGG - Intergenic
948641783 2:239379667-239379689 CAGCCTGGGCACCATTCCCCTGG + Intronic
1173079196 20:39849896-39849918 CAGCTAGGGCACCGTGCCCAGGG - Intergenic
1174412946 20:50347684-50347706 CAGCCAGTCCAGAATGCCCGAGG - Intergenic
1175753670 20:61515959-61515981 CAGCCAGGAAACCAGGCAGGAGG - Intronic
1176430945 21:6575263-6575285 CAGCCAGGCCTCCATGCACCAGG - Intergenic
1179255689 21:39713352-39713374 CAGCCAGCCCACCATGACCTGGG - Intergenic
1179657288 21:42853203-42853225 CAGCCAGTGCCCCAGGCCCGAGG + Intronic
1179706339 21:43182725-43182747 CAGCCAGGCCTCCATGCACCAGG - Intergenic
1180765034 22:18341276-18341298 CATCCATCTCACCATGCCCGAGG - Intergenic
1180813995 22:18778408-18778430 CATCCATCTCACCATGCCCGAGG + Intergenic
1181166088 22:20983793-20983815 AAGCCAGGGGACCATGCCCAAGG - Intronic
1181200180 22:21212743-21212765 CATCCATCTCACCATGCCCGAGG + Intronic
1181701557 22:24624216-24624238 CATCCATCTCACCATGCCCGAGG - Intronic
1181851144 22:25750804-25750826 CCTCCATGACACCATGCCTGAGG - Intronic
1182638210 22:31746058-31746080 CAGCCAGGACTACAGGCGCGAGG + Intronic
1184377863 22:44125848-44125870 CAGTCAGGACACCATTGCCATGG + Intronic
1185088154 22:48751947-48751969 CTCCCAGGACACCACGCCCAGGG - Intronic
1203264094 22_KI270734v1_random:4095-4117 CATCCATCTCACCATGCCCGAGG + Intergenic
953387368 3:42514168-42514190 CACCCAGGACACAAGGCCCAGGG + Intronic
953389395 3:42525828-42525850 CAGCCAGGTCCCCATGCTCCCGG + Intronic
954149991 3:48652538-48652560 CCTCCAGGACACCATGGCGGTGG - Exonic
956855786 3:73273679-73273701 CAGTCAGGAAGCCAGGCCCGGGG + Intergenic
960442487 3:117706187-117706209 CAGCCAGGAGGACATGCCCTGGG - Intergenic
961455259 3:127020754-127020776 CACCCAGGAGACCAGGCCAGTGG - Intronic
961643810 3:128381789-128381811 CACCCAGGAGACCTGGCCCGGGG + Intronic
962536092 3:136329813-136329835 CAGCCTGGGCACCATCCCTGGGG - Intronic
968420396 4:479325-479347 CACCCATGACATCATGCACGTGG + Intronic
968480910 4:832671-832693 CAGCCAGGACCCCATGGAGGAGG + Intergenic
968751298 4:2390476-2390498 GAGCCAGGACCCCATGTCGGGGG + Intronic
968838368 4:2981816-2981838 CAGCCAGGGCACCATGAACAAGG - Intronic
969441959 4:7222580-7222602 CAGCCAGTGCACCAAGCCAGTGG - Intronic
974626145 4:64431031-64431053 CAGCCAGGCCTCCATACCAGGGG - Intergenic
978441219 4:108736076-108736098 CAGACAGGACAACATGGCAGAGG - Intergenic
981680282 4:147389547-147389569 CTGCCCAGACACCATGCCAGTGG - Intergenic
985644145 5:1077206-1077228 CTTCCTGGACACCATGCCCTAGG + Intronic
986770992 5:10973563-10973585 CAGCGAGTACACCATGCACCTGG - Exonic
992857493 5:80877733-80877755 CTGCCAGGACACAATGCTCCTGG - Intergenic
997583583 5:135031736-135031758 CAGCCAGGAACGCAGGCCCGCGG - Intronic
999372869 5:151066827-151066849 CAGCCAGGACACAGAGCCAGAGG + Intronic
1002878256 6:1230000-1230022 CAGCCAGGACACCGAGGCCTCGG + Intergenic
1006037559 6:31225407-31225429 CAGCCAGGACACAGTGGCCAGGG - Intergenic
1006793938 6:36720511-36720533 CTGCCAGGACACCCGGCCCCTGG - Exonic
1007253229 6:40510682-40510704 CAGGCTGGACAACATGCCAGAGG + Intronic
1011887596 6:92116524-92116546 CAGCCAGGAAAACATGACCTTGG + Intergenic
1015805251 6:137101995-137102017 CTCCCAGTACACCATGCTCGTGG + Intergenic
1017646131 6:156541337-156541359 CAGCCAGGGCTCCATGAGCGAGG + Intergenic
1017774914 6:157673062-157673084 CAGCCAGGACTCCCTGCATGAGG + Exonic
1019186258 6:170222196-170222218 CAGCCAGGACAAAATGCACAGGG - Intergenic
1019211005 6:170404834-170404856 CTGCAAGGAGACCATGCCTGTGG + Exonic
1019574967 7:1733249-1733271 CAGCCGGGACACCAGTCCCCGGG + Intronic
1023867075 7:44243395-44243417 CAGCCAACACACCCTGCCCCTGG + Intronic
1024475039 7:49800557-49800579 GAGCCAGAACACCCTGCCCCAGG - Intronic
1027643468 7:80766935-80766957 CTGGCAGGCCACCATGCCTGCGG + Intronic
1027824875 7:83099264-83099286 CAGCAAGGACACCAGGCTAGAGG + Intronic
1033291206 7:140084321-140084343 CAGCCAGGCCACCACACCCCTGG + Intergenic
1035029671 7:155848966-155848988 GAGCCAGGACCCCAGGACCGTGG - Intergenic
1035556498 8:570942-570964 CTGCCAGGACACCCTGCCTCTGG + Intergenic
1035603188 8:910875-910897 CATCCAGGACACCGCGCCCAAGG - Intergenic
1039411640 8:37359977-37359999 CAGCCAGGACTGCCTGCCCTAGG + Intergenic
1052990855 9:34518736-34518758 CAGCCATGACACCATGAGGGTGG + Intronic
1053055869 9:34992758-34992780 CAGCCTGGGCACCATGCCTGAGG + Intronic
1054713093 9:68530799-68530821 CAGCCAGGACACCCAGCGCGTGG + Exonic
1055229541 9:74045035-74045057 CAGACAGGACACCATCCCATCGG - Intergenic
1057420902 9:94911413-94911435 CAGCTACGACACCAAGCCAGTGG - Intronic
1058880975 9:109285767-109285789 CAGCCTGGACACCCCACCCGGGG + Intronic
1061980702 9:134101918-134101940 CAGCCAGGCCTCGGTGCCCGGGG + Intergenic
1062415013 9:136444216-136444238 CAGCCATGACACGAGGCCCAGGG + Intronic
1062617246 9:137403435-137403457 CAGCCAGCACACCCTGGCCCAGG + Intronic
1186986248 X:15016914-15016936 CAGCCAGGACACCCTACCTGGGG - Intergenic
1190828971 X:54043866-54043888 CTGCAAGGACTCCACGCCCGCGG + Intronic
1191250190 X:58256519-58256541 CAGCCACTGCACCAGGCCCGTGG + Intergenic
1197599998 X:128517725-128517747 CAGCCAGGTAACCATGGCAGGGG - Intergenic
1198085319 X:133277013-133277035 CAGCCAGACCACCATGGCCCAGG - Intergenic
1200091428 X:153637875-153637897 CAGCCAGGGCCCCATGGCCAGGG - Intergenic
1200100397 X:153687177-153687199 CAGCCAGGACCTCAGGCCTGAGG + Intronic
1200266672 X:154649824-154649846 CAGCAAGGTCACCGTGCCCCAGG - Intergenic
1200326173 X:155242053-155242075 CAGGCAAGACAGCATGCCAGAGG + Intergenic
1201783059 Y:17744372-17744394 CAGCCAGGAGCCCAGGCCAGGGG - Intergenic
1201818494 Y:18161615-18161637 CAGCCAGGAGCCCAGGCCAGGGG + Intergenic