ID: 1084001025

View in Genome Browser
Species Human (GRCh38)
Location 11:66295506-66295528
Sequence CAGCCTGAGCGGGGGGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084001017_1084001025 -4 Left 1084001017 11:66295487-66295509 CCACGCCAGGGGTCTTCCGCAGC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG 0: 1
1: 0
2: 2
3: 17
4: 219
1084001008_1084001025 25 Left 1084001008 11:66295458-66295480 CCGCCTCTCGCTGGGCGCTGGCG 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG 0: 1
1: 0
2: 2
3: 17
4: 219
1084001010_1084001025 22 Left 1084001010 11:66295461-66295483 CCTCTCGCTGGGCGCTGGCGGCC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG 0: 1
1: 0
2: 2
3: 17
4: 219
1084001016_1084001025 1 Left 1084001016 11:66295482-66295504 CCGGGCCACGCCAGGGGTCTTCC 0: 1
1: 0
2: 0
3: 18
4: 254
Right 1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG 0: 1
1: 0
2: 2
3: 17
4: 219
1084001018_1084001025 -9 Left 1084001018 11:66295492-66295514 CCAGGGGTCTTCCGCAGCCTGAG 0: 1
1: 0
2: 1
3: 25
4: 173
Right 1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG 0: 1
1: 0
2: 2
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084001025 Original CRISPR CAGCCTGAGCGGGGGGCCGC TGG Exonic
900164743 1:1240186-1240208 CAGCCGGAGCGTGGGGTCCCCGG - Intergenic
900265823 1:1756720-1756742 CAGCGTGAGCGTGGGGGGGCGGG - Intronic
900405458 1:2490974-2490996 CAGGCTCTGCTGGGGGCCGCTGG + Intronic
900629289 1:3625159-3625181 CGGCCCGGGCGGGGGGCGGCCGG + Exonic
901152410 1:7112671-7112693 AAGTCTGAGCGGGAGGCTGCTGG - Intronic
901749493 1:11397228-11397250 CAGCCTGAGCTTGGGACAGCTGG + Intergenic
901925968 1:12566297-12566319 CAGGCTGACCAGGGGGCCTCAGG - Intergenic
902169679 1:14599462-14599484 CAGCCTGAGCGAGGCGCAGCCGG + Intronic
902282532 1:15384842-15384864 CAGCCTGCGAGGAGGGCTGCCGG + Intronic
903885195 1:26536987-26537009 CACCCTGAGCGAGGGGCTGTGGG + Intronic
904376729 1:30086362-30086384 CGGCCTGCTCCGGGGGCCGCTGG + Intergenic
904912502 1:33945788-33945810 CGGGCTGAGCAGGGGGCAGCAGG - Intronic
905033974 1:34905173-34905195 GAGCCTGAGTGAGGGGCCGTCGG - Exonic
905408480 1:37753173-37753195 CAGCCTGAGCCGCTCGCCGCTGG - Exonic
905710390 1:40097291-40097313 CCGCCTGGGCGTGGCGCCGCCGG + Exonic
906062340 1:42957397-42957419 GAGACTGAGCGGGGTGGCGCTGG - Intronic
907805723 1:57817514-57817536 CAGCCTGAGCTGAGAGCCCCAGG - Intronic
911275382 1:95853093-95853115 CAGCCTGAGGAGGGGGCTCCAGG - Intergenic
915248405 1:154571922-154571944 CAGCGTGAGCGCGAGGGCGCTGG + Exonic
915367742 1:155324994-155325016 CAGCCTGAGAGCAGGGCCGGGGG - Intronic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
918080452 1:181203947-181203969 CAGCCTCAGCTGGGGGCTGCTGG - Intergenic
919925001 1:202187580-202187602 CAGCATGGGCTGGGGGCCTCTGG + Intergenic
919926542 1:202194485-202194507 GACCCTGAGCGGGAGGGCGCGGG + Intronic
920398607 1:205663394-205663416 CATCCTGGGCGTGGGGCTGCTGG - Exonic
921165297 1:212502607-212502629 AAGCCTGAGCAGGGGACAGCAGG + Intergenic
921251076 1:213298928-213298950 CAACCTGAGCGGGGCTCTGCAGG + Intergenic
922210096 1:223479745-223479767 CAGCCTCAGAGAGGGGCCGGAGG + Intergenic
1062919025 10:1265805-1265827 CGGCCTGAGAGGGGGGCCCAGGG + Intronic
1062919051 10:1265873-1265895 CGGCCTGAGAGGGGGGCCCAGGG + Intronic
1062919098 10:1266009-1266031 CGGCCTGAGAGGGGGGCCCAGGG + Intronic
1063194387 10:3727658-3727680 CAGCCGGAGCTGGGGGCGGTGGG + Intergenic
1063429807 10:5978124-5978146 CAGCGGGCGCCGGGGGCCGCGGG - Intronic
1073062772 10:100742202-100742224 CAGCGGGAGCGGGTGGCAGCGGG + Intronic
1073207336 10:101776090-101776112 CTGCCGGAGCCGGTGGCCGCTGG + Intronic
1073286700 10:102394130-102394152 CACCCTGAGCGGCGCGCTGCCGG - Intronic
1075348100 10:121699158-121699180 CAGGCTGAGAGGGTGGCCCCGGG + Intergenic
1075401381 10:122163730-122163752 CGGCCCGAGCCGGGGGCCGGGGG - Intronic
1075732713 10:124645843-124645865 CAGCCTGTCCCGGGGGCAGCAGG + Intronic
1076009631 10:126977198-126977220 CAGCCTGAGAGGGGTGCCAGGGG + Intronic
1076716091 10:132364577-132364599 CTGCCTGAGTGTGGGGCCCCAGG - Intronic
1077197482 11:1288665-1288687 CAGCCTGAGCGGGAGGCAGGGGG - Exonic
1077222979 11:1425585-1425607 CAGCCTGGGCCAGGGGCCACGGG + Intronic
1077319647 11:1935528-1935550 CAGCCTGCCCGGGCGGCCTCAGG + Intronic
1077416247 11:2425635-2425657 CACCCTGGGCGGGGGTCCTCAGG + Intergenic
1077514785 11:2994965-2994987 CAGCCAGAGCTGAGGGCCACTGG + Intergenic
1078053531 11:7987612-7987634 CAGCCTGACCACGCGGCCGCCGG - Exonic
1079035291 11:17014696-17014718 CGGGCGGCGCGGGGGGCCGCTGG + Intergenic
1081654983 11:44851194-44851216 CAGCCTGAGCAGTGGGCCAGCGG + Intronic
1083618289 11:64036787-64036809 GTGCCTGGGCGGGGGGCGGCGGG + Intronic
1083672142 11:64305659-64305681 CGGAGTGAGCCGGGGGCCGCGGG - Intronic
1083936557 11:65872699-65872721 CCGCCAGAGCCGCGGGCCGCGGG - Exonic
1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG + Exonic
1085276956 11:75306642-75306664 GAGCCTGAGCTGGGGGCTGCAGG + Intronic
1085456947 11:76670746-76670768 CAGCCGGAGCGCGGGGGCTCCGG - Intronic
1086324559 11:85685344-85685366 CAGCCTGAGCCAGGAGCTGCAGG - Exonic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1089078920 11:115760366-115760388 CAGGCCGAGGGGGGGGCGGCGGG - Intergenic
1090327775 11:125904178-125904200 CTGTGTGAGCGGCGGGCCGCGGG + Intronic
1091294862 11:134466548-134466570 CAGCCTCAGCACGGGGCTGCAGG + Intergenic
1091779718 12:3206057-3206079 TAGCCTGAGGAAGGGGCCGCTGG + Intronic
1092976045 12:13745823-13745845 CAGCCTGAGCTGGGGATCCCTGG + Intronic
1096180669 12:49548876-49548898 CAGCCTGAGGGGGGAACAGCAGG - Exonic
1096601086 12:52730095-52730117 CAGCCTCAGAGAGGGGCTGCAGG + Intergenic
1096674686 12:53220171-53220193 CTGCTGGAGCGGGGCGCCGCCGG - Intronic
1096961442 12:55582117-55582139 CATGCTGAGCGTGGGGCTGCTGG + Intergenic
1101340971 12:103841407-103841429 CAGGCTGGGCGTGGGGCCCCCGG - Intergenic
1102973567 12:117190190-117190212 CAGCCGGGGCGCGGGGCCGCTGG + Intronic
1103521092 12:121537434-121537456 CCACCTGAGCTGGGGGCGGCCGG - Intronic
1104448884 12:128853676-128853698 AAGCCTGGGCCGGGGGCCGGGGG + Intronic
1104689878 12:130817944-130817966 CAGCCTGTGGTGGGGGCAGCTGG + Intronic
1104730637 12:131103582-131103604 CACCCTGAGCTGGGGCCCCCTGG + Intronic
1105439561 13:20403980-20404002 CAGCCTGAGTGGGGTGGTGCAGG - Exonic
1105700984 13:22935571-22935593 CAGCCAGAGAGGGGGGCAGAGGG + Intergenic
1106242268 13:27921349-27921371 CTGCCGGCGCGGAGGGCCGCAGG - Intronic
1109957824 13:69591158-69591180 CAGCCTGGGCTGGGGGGCGAGGG + Intergenic
1113611135 13:111645724-111645746 CAGGCTGAGCAGGGGGCTGATGG + Intronic
1118354070 14:64997318-64997340 CAGCCTGTGGGTGGGGCCACAGG - Intronic
1119322201 14:73738891-73738913 CAGCCTGGGCAGGAGGCCACTGG - Exonic
1122130712 14:99603386-99603408 CAGCCTGAGCGGGCCGCTGTCGG - Exonic
1122637489 14:103137136-103137158 CAGCCTGAGAGGGGGCCCTTCGG + Exonic
1122745524 14:103895114-103895136 CAGCCAGAGCAGGGGGCCTGGGG - Intergenic
1122895224 14:104753394-104753416 AGGCCTGAGCGGGGGGCTGGAGG + Intronic
1123888031 15:24747606-24747628 CAGGCTGAGTGGGGAGCCACAGG - Intergenic
1128743135 15:70096877-70096899 GAGCCCGAGCGGGGGGCGGCCGG + Exonic
1129296760 15:74604147-74604169 CAGCCTGTGGGTGGGGCCGCTGG - Intronic
1129333286 15:74838571-74838593 CAGCCTGAGGGGGAGGCGGGTGG - Intronic
1129360435 15:75020813-75020835 CATCCTGAGCCAGGGGCCTCTGG + Exonic
1129462783 15:75708223-75708245 CAGCCTGTGGAGGAGGCCGCTGG - Intronic
1129722091 15:77883193-77883215 CAGCCTGTGGAGGAGGCCGCTGG + Intergenic
1129826412 15:78637811-78637833 CAGCCTGGGGGAGGGGCAGCAGG - Intronic
1130908697 15:88256837-88256859 CAGCCCGGGCGGGGGGCGGGGGG - Intergenic
1132408609 15:101560295-101560317 CAGCCTGTGCTGGGGGCTGTGGG + Intergenic
1132611622 16:819617-819639 CAGCCTGAGCTGGGGGCTGCTGG + Intergenic
1132678813 16:1131400-1131422 CAGCCTGGTCTGGGGGCTGCAGG - Intergenic
1132808924 16:1788413-1788435 CAGCCTGCTGGGAGGGCCGCGGG + Intronic
1133039411 16:3052453-3052475 CAGCTTCAGCGGGGGGCAGGGGG + Intronic
1133136810 16:3717775-3717797 CAGCGTGGGCCGGGGGCGGCGGG - Intergenic
1134112622 16:11524665-11524687 CAGCCTGAGCTGGGGGCCGAGGG - Intergenic
1139384011 16:66552495-66552517 AAGCCAGAGCGGACGGCCGCGGG + Intronic
1141481199 16:84308122-84308144 AAGCCTGGGAGGGGGGCCCCTGG - Intronic
1142189836 16:88712721-88712743 CAGCATGTGCTGGGGGCCGGGGG + Exonic
1142644118 17:1301060-1301082 CAGCCTGACCCTGGGGCCACAGG - Intergenic
1142738518 17:1917054-1917076 CAGCCTGAGGCTGCGGCCGCGGG + Intergenic
1142764502 17:2057733-2057755 CAGGCCGAGCGGGGGCCCCCCGG - Exonic
1143747076 17:9002915-9002937 GAGCCCGAGCGGCGGGGCGCAGG + Intergenic
1147183527 17:38701885-38701907 CCGCCTGGGCGGGGACCCGCTGG - Intergenic
1151395507 17:73820103-73820125 CAGCCTGGGCTGGGGGCTCCAGG + Intergenic
1152753584 17:82077745-82077767 GTGGCTGTGCGGGGGGCCGCTGG - Intergenic
1152753779 17:82078553-82078575 GTGGCTGTGCGGGGGGCCGCTGG + Exonic
1152905916 17:82970879-82970901 CTGCCTTTGCGGGGGGCCTCAGG + Intronic
1153280787 18:3412100-3412122 CAGCCTTCGCCGAGGGCCGCAGG + Intronic
1156036554 18:32771898-32771920 GTGCCCGAGTGGGGGGCCGCTGG - Intronic
1156219962 18:35041365-35041387 CTGCCAGAGGGCGGGGCCGCAGG + Exonic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157914840 18:51654828-51654850 CAGCCCCAGCTGGGTGCCGCAGG - Intergenic
1160793141 19:932284-932306 CAGTCTGAGCTGGCGGCGGCCGG + Intronic
1160880104 19:1315816-1315838 CGGCCTGAGCCCGGAGCCGCGGG - Intergenic
1161099402 19:2413895-2413917 CAGGCTGTGCTGGGGGCGGCAGG - Exonic
1161852741 19:6746089-6746111 CGGCCGGAGCGGGGGGACGGGGG - Intronic
1162321513 19:9973604-9973626 CAGGGTGAGCGAGGGGACGCTGG - Exonic
1162778674 19:12995689-12995711 CGGGCCGAGCGCGGGGCCGCGGG + Exonic
1163104620 19:15116159-15116181 GAGCCAGCGCAGGGGGCCGCGGG + Exonic
1165242779 19:34481462-34481484 CAGGCTGAGCTGGAGGCAGCTGG - Intergenic
1165248816 19:34513819-34513841 CAGCCAGAGCGTGGGGCTGAGGG + Intergenic
1165436359 19:35797487-35797509 CCGACTGTGCGGGGGTCCGCGGG + Intergenic
1167208099 19:48116002-48116024 GAGACTGAGCAGGGGGTCGCTGG - Intronic
926634566 2:15165966-15165988 CAGAGTGACCGGGGGGCCGTTGG - Intergenic
926740304 2:16105051-16105073 CAGCCTGAGCCAGGAGCTGCAGG + Intergenic
927672567 2:25081596-25081618 GAGCCTGAGCAGTGGCCCGCAGG + Intronic
931036688 2:58251711-58251733 CAGCCTGACCACGCGGCCGCCGG - Intergenic
931374447 2:61694948-61694970 CAGCCTGAGCGAGGGTGCTCAGG + Intergenic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
935820457 2:106887529-106887551 GAGCCTGCGGGCGGGGCCGCGGG + Intergenic
937340743 2:121088970-121088992 CAGCCTGCACCGGGGGCCTCTGG - Intergenic
938291408 2:130152726-130152748 CAGGCTGAGCCTGGGGCCGCGGG + Exonic
938465135 2:131520233-131520255 CAGGCTGAGCCTGGGGCCGCGGG - Intergenic
942545269 2:177056832-177056854 CAGCCTGGGCTGTGGGCAGCTGG - Intergenic
946239191 2:218343614-218343636 CAGGCTGAGCGTGGGGCTGGAGG - Intronic
948801670 2:240436050-240436072 CAGCCTGAGCGACGTGCCCCAGG + Exonic
948847181 2:240688637-240688659 CCGCCTGAGCGGGGGGCATATGG + Intergenic
948857298 2:240736016-240736038 CAGCCAGGGCAGGGGGCAGCTGG - Intronic
948892605 2:240914738-240914760 CTGCCTGAGCTGGGGGCGGGAGG - Intergenic
948911113 2:241003122-241003144 GTGCCTGAGCGGGGGGCCCGGGG - Intronic
1169130565 20:3164545-3164567 CTGCGGGAGCGCGGGGCCGCAGG - Exonic
1172123607 20:32612535-32612557 CAGCCTGAGGCGGGGCCCACAGG - Intergenic
1172301746 20:33855312-33855334 CAGGCTGAGCGGGTGGAAGCTGG - Intergenic
1175988610 20:62776685-62776707 CAGCCTCAGCTGGGGGTCACAGG + Intergenic
1176173839 20:63708391-63708413 GAGCCTGAGCGGGGGTACCCGGG + Intronic
1178914336 21:36698494-36698516 CAGGAGGAGCGGGAGGCCGCAGG - Intergenic
1178914683 21:36699681-36699703 CAGCCCGAGCGGGGCTCCGCGGG + Exonic
1179511848 21:41878897-41878919 CAGGCCCAGCGCGGGGCCGCGGG - Intronic
1179553242 21:42156595-42156617 CAGCCAGAGCTGGGGGTCTCAGG - Intergenic
1179610075 21:42544660-42544682 CAGCCTGAGCAGGGGCCTCCTGG + Intronic
1179959146 21:44758557-44758579 CAGCCTGATATGGGGGCTGCAGG + Intergenic
1180161514 21:46000532-46000554 CAGCCTGTGCGGGGACCCGGGGG - Intronic
1180996575 22:19968742-19968764 GAGCCCGAGAGGGGGGCCGGGGG - Exonic
1180997148 22:19971279-19971301 CAGCCTGACCGCGGGCCTGCTGG + Exonic
1181049536 22:20231980-20232002 CAGCCTGTGCGGGGGCCCTGAGG - Intergenic
1181630513 22:24148765-24148787 CAGCCTGAGCGGGTGGGGCCTGG - Intronic
1182146509 22:28000089-28000111 CAGCCGGCACGGTGGGCCGCTGG + Intronic
1184022747 22:41832398-41832420 CCTCCTGAGAGGGGGGCCCCGGG - Intergenic
1184112834 22:42405333-42405355 AAGCCTGGGTGGGGGTCCGCAGG + Intronic
1184555938 22:45233142-45233164 CAGCCTGAGTTGGTGGCCACTGG - Intronic
1184671153 22:46012915-46012937 GAGGCTGAGTGTGGGGCCGCAGG - Intergenic
1185322331 22:50207533-50207555 CAGCCTCAGGGGTGGGCGGCTGG - Intronic
949953806 3:9251178-9251200 CAGCATGAGCTGGGGCCCACAGG + Intronic
950033031 3:9864361-9864383 CTGGCTGTGCGGGGGGCCCCAGG + Intergenic
950764313 3:15262010-15262032 GAGCCTGAGCAGGGGGGCTCTGG + Intronic
953574892 3:44105098-44105120 CAGCCTGAGCTGGGAGACACTGG - Intergenic
954137089 3:48586916-48586938 GAGCCTGGGTGGGGGGCCTCAGG + Intronic
954882708 3:53846437-53846459 CAGCCTGGGAGGGGGCCAGCGGG + Intergenic
961662304 3:128475881-128475903 CAGCCAGAGCTGGGGGAGGCTGG - Intergenic
961754922 3:129121839-129121861 CAGCCTGAGGGCGGAGCCGGGGG - Intronic
961819953 3:129570976-129570998 CAGCCTCAGCTGTGGGCCTCGGG - Intronic
967055232 3:185824734-185824756 CGGCCTGAGCGGGGCGAGGCGGG + Intronic
967872834 3:194246330-194246352 GGGCCTGAGCGTGGGGCTGCTGG + Intergenic
968577839 4:1376217-1376239 CAGCCTGAGGAGGGGGCTGCCGG + Intronic
969716845 4:8871899-8871921 CAGCAGGGGCGGGGGGTCGCGGG + Intergenic
969823165 4:9735798-9735820 CACCCTGAGAAGGGGGCAGCGGG - Intergenic
970525681 4:16929488-16929510 CAGCCTGAAAGGGGGTCCTCAGG - Intergenic
970601225 4:17642320-17642342 CAGCCTGGGCGGGGTGCCAGTGG - Intronic
976811434 4:89104951-89104973 CAGCCTGAGCTGGGGTCTGAGGG - Intronic
982291535 4:153787903-153787925 GAGGCTGAGCGAGGGGCCTCTGG + Intronic
985778361 5:1857069-1857091 CAGCCTGTGCGGGGAGCCAGCGG - Intergenic
989533830 5:42540694-42540716 CAGCCTGAGAGCGGGGGCGGTGG - Intronic
989643130 5:43602926-43602948 GAGGCTGGGCTGGGGGCCGCAGG + Intronic
994981174 5:106876239-106876261 CAGACTGAGTGGGGGGTCTCAGG + Intergenic
997253665 5:132410800-132410822 CAGCCAGAGGCGGGGGCCCCGGG - Intronic
1000048479 5:157541390-157541412 CAGACAGAGCAGGGGGCAGCAGG - Intronic
1001516983 5:172362762-172362784 CAGCCTCAGCGTGGGGCAGGTGG - Exonic
1002183267 5:177442279-177442301 CAGCCTGAGCCCAGGGCAGCAGG - Exonic
1002456225 5:179346449-179346471 CAGCCTGAGAGGGGGCTCTCAGG - Intergenic
1002524407 5:179807155-179807177 CAGCCGGGGCGGGGGGCGGGCGG + Intronic
1002635081 5:180603301-180603323 CGGCCTGAGCGGGGGGCCCGAGG - Exonic
1005226335 6:23647381-23647403 TAGCCTGAGAGGGGAGCTGCAGG - Intergenic
1007769736 6:44183261-44183283 CAGCCTAGGCCAGGGGCCGCGGG + Intronic
1009681360 6:66897256-66897278 CAGACTGAGTGGGGGGTCTCTGG - Intergenic
1013013721 6:106142841-106142863 CATCCTGAGCTGGGGGTGGCAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018610719 6:165645242-165645264 CCTCCTGAGCGGGGGCCTGCTGG + Intronic
1018769367 6:166957478-166957500 CAGCCCGTGGGCGGGGCCGCGGG - Intergenic
1019101640 6:169635428-169635450 AAGGCTGAGGGAGGGGCCGCAGG + Intronic
1019129514 6:169863257-169863279 CTGCCTGAGCGGGAGGCTGTGGG - Intergenic
1019165710 6:170096321-170096343 CTGCCTGCGCGGAGGGCGGCTGG - Intergenic
1019474437 7:1237010-1237032 GAGCCTGAGCGAGCGGCCGCGGG - Exonic
1019496352 7:1342229-1342251 CAGCCTGAGCTGGGGTGGGCTGG + Intergenic
1019526022 7:1480885-1480907 CAGCATGAGCGCGGCGCCTCCGG - Exonic
1020091794 7:5345917-5345939 AGTCCTGAGCAGGGGGCCGCTGG + Intronic
1022653468 7:32297827-32297849 CAGTCTGAGAGAGAGGCCGCAGG - Intronic
1023995376 7:45156327-45156349 CTGCCTGAGGGGTGGGCAGCAGG - Intergenic
1024082086 7:45864262-45864284 CAGGCTCAGCTGGGGGCCGCTGG + Intergenic
1031629730 7:124032556-124032578 CAGCCTGGGCGGCGGGGCGGGGG - Exonic
1031982318 7:128135881-128135903 CAGCGGGAGCGGGAGGCCGCGGG + Intergenic
1032215313 7:129952754-129952776 CAGCCCGAGCCGGGCGCCGCAGG - Exonic
1032525732 7:132577188-132577210 CAGCCCGCCCGGGGGGCCGGGGG - Exonic
1034589971 7:152130786-152130808 CTGTCTGAGTGGGGGTCCGCAGG + Intergenic
1036552335 8:9826559-9826581 CAGCCTGAGCGGAGAACCACTGG + Intergenic
1036723716 8:11201026-11201048 CGGCCGGCGCCGGGGGCCGCGGG + Exonic
1041511405 8:58658987-58659009 AAGGCTGGGAGGGGGGCCGCCGG - Intronic
1042216363 8:66432572-66432594 CAGCGTGAGTGCGGGGCCGGCGG + Exonic
1044913510 8:97087345-97087367 CTGCCTGAGCTGGGAGCCACAGG - Intronic
1045546849 8:103137300-103137322 CAGCCAGAGCTGGGGGCCTGTGG - Intronic
1047569436 8:126082143-126082165 CAGCCTGGGCTAGGGGCCCCAGG + Intergenic
1049585450 8:143430652-143430674 CAGCCCGAGGCGGCGGCCGCGGG - Intergenic
1049610672 8:143553399-143553421 CAGAGTGAGCGGCGGGCGGCGGG - Exonic
1049672005 8:143874043-143874065 CACCCTGCCCCGGGGGCCGCAGG + Intronic
1049682681 8:143926629-143926651 CAGGCTGAGCTGGGGGCAGGGGG + Intronic
1049709533 8:144057374-144057396 CAGCCTGAGCAGGAGGCCTGGGG + Intronic
1051626241 9:19102472-19102494 GAGCCTGAACCGGGGGACGCCGG - Intronic
1053280848 9:36819094-36819116 CAGCCGGGGAGGGGGGACGCGGG - Intergenic
1053302679 9:36963006-36963028 ATGCCTGAGCAAGGGGCCGCAGG - Intronic
1053312852 9:37030252-37030274 CCGCCCGAGCGGGCGGCCTCTGG + Intronic
1061284382 9:129613807-129613829 CAGCGTGAGTGGGGGTGCGCAGG - Intronic
1061750066 9:132770971-132770993 CTGGCTGAGCAGGGGGCCTCAGG + Intronic
1061886249 9:133592390-133592412 CGGCCTGAGAGGGAGGCCGAGGG + Intergenic
1061904342 9:133688990-133689012 CAGCCTGAGAGGGGAGCAACTGG + Intronic
1062498139 9:136841220-136841242 CAGCCTGGGCCCGGGGCAGCGGG - Intronic
1062554116 9:137106360-137106382 CAGCAGGAGTGGGGGGCTGCGGG - Intronic