ID: 1084001389

View in Genome Browser
Species Human (GRCh38)
Location 11:66296953-66296975
Sequence CGGCATGCCCAGCAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084001389_1084001399 13 Left 1084001389 11:66296953-66296975 CCACTCTGCTGCTGGGCATGCCG No data
Right 1084001399 11:66296989-66297011 TGGTGGCCGGTCCCCAAAGTGGG No data
1084001389_1084001400 14 Left 1084001389 11:66296953-66296975 CCACTCTGCTGCTGGGCATGCCG No data
Right 1084001400 11:66296990-66297012 GGTGGCCGGTCCCCAAAGTGGGG No data
1084001389_1084001397 0 Left 1084001389 11:66296953-66296975 CCACTCTGCTGCTGGGCATGCCG No data
Right 1084001397 11:66296976-66296998 AGGGCTAAGGGAGTGGTGGCCGG No data
1084001389_1084001394 -7 Left 1084001389 11:66296953-66296975 CCACTCTGCTGCTGGGCATGCCG No data
Right 1084001394 11:66296969-66296991 CATGCCGAGGGCTAAGGGAGTGG No data
1084001389_1084001398 12 Left 1084001389 11:66296953-66296975 CCACTCTGCTGCTGGGCATGCCG No data
Right 1084001398 11:66296988-66297010 GTGGTGGCCGGTCCCCAAAGTGG No data
1084001389_1084001395 -4 Left 1084001389 11:66296953-66296975 CCACTCTGCTGCTGGGCATGCCG No data
Right 1084001395 11:66296972-66296994 GCCGAGGGCTAAGGGAGTGGTGG No data
1084001389_1084001405 28 Left 1084001389 11:66296953-66296975 CCACTCTGCTGCTGGGCATGCCG No data
Right 1084001405 11:66297004-66297026 AAAGTGGGGAGAAAGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084001389 Original CRISPR CGGCATGCCCAGCAGCAGAG TGG (reversed) Intergenic
No off target data available for this crispr