ID: 1084003940

View in Genome Browser
Species Human (GRCh38)
Location 11:66313532-66313554
Sequence GAGTGGCCCAGCGCCCCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084003940_1084003947 3 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003947 11:66313558-66313580 CTCGCCTGCCCGGGTGGTCGTGG No data
1084003940_1084003943 -6 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003943 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data
1084003940_1084003944 -3 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003944 11:66313552-66313574 CTCCTCCTCGCCTGCCCGGGTGG No data
1084003940_1084003941 -7 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003941 11:66313548-66313570 GCCACTCCTCCTCGCCTGCCCGG No data
1084003940_1084003952 29 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003940_1084003948 6 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003948 11:66313561-66313583 GCCTGCCCGGGTGGTCGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084003940 Original CRISPR GAGTGGCCCAGCGCCCCCTT CGG (reversed) Intergenic
No off target data available for this crispr