ID: 1084003943

View in Genome Browser
Species Human (GRCh38)
Location 11:66313549-66313571
Sequence CCACTCCTCCTCGCCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084003937_1084003943 0 Left 1084003937 11:66313526-66313548 CCAGGCCCGAAGGGGGCGCTGGG No data
Right 1084003943 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data
1084003931_1084003943 11 Left 1084003931 11:66313515-66313537 CCAGCTCAGGTCCAGGCCCGAAG No data
Right 1084003943 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data
1084003939_1084003943 -5 Left 1084003939 11:66313531-66313553 CCCGAAGGGGGCGCTGGGCCACT No data
Right 1084003943 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data
1084003930_1084003943 15 Left 1084003930 11:66313511-66313533 CCTTCCAGCTCAGGTCCAGGCCC No data
Right 1084003943 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data
1084003927_1084003943 24 Left 1084003927 11:66313502-66313524 CCAGCTCAGCCTTCCAGCTCAGG No data
Right 1084003943 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data
1084003926_1084003943 25 Left 1084003926 11:66313501-66313523 CCCAGCTCAGCCTTCCAGCTCAG No data
Right 1084003943 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data
1084003940_1084003943 -6 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003943 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084003943 Original CRISPR CCACTCCTCCTCGCCTGCCC GGG Intergenic
No off target data available for this crispr