ID: 1084003945

View in Genome Browser
Species Human (GRCh38)
Location 11:66313554-66313576
Sequence GACCACCCGGGCAGGCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084003945_1084003952 7 Left 1084003945 11:66313554-66313576 CCTCCTCGCCTGCCCGGGTGGTC No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003945_1084003957 18 Left 1084003945 11:66313554-66313576 CCTCCTCGCCTGCCCGGGTGGTC No data
Right 1084003957 11:66313595-66313617 CCTAATTAGAGGCCCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084003945 Original CRISPR GACCACCCGGGCAGGCGAGG AGG (reversed) Intergenic
No off target data available for this crispr