ID: 1084003947

View in Genome Browser
Species Human (GRCh38)
Location 11:66313558-66313580
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084003937_1084003947 9 Left 1084003937 11:66313526-66313548 CCAGGCCCGAAGGGGGCGCTGGG No data
Right 1084003947 11:66313558-66313580 CTCGCCTGCCCGGGTGGTCGTGG No data
1084003931_1084003947 20 Left 1084003931 11:66313515-66313537 CCAGCTCAGGTCCAGGCCCGAAG No data
Right 1084003947 11:66313558-66313580 CTCGCCTGCCCGGGTGGTCGTGG No data
1084003930_1084003947 24 Left 1084003930 11:66313511-66313533 CCTTCCAGCTCAGGTCCAGGCCC No data
Right 1084003947 11:66313558-66313580 CTCGCCTGCCCGGGTGGTCGTGG No data
1084003940_1084003947 3 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003947 11:66313558-66313580 CTCGCCTGCCCGGGTGGTCGTGG No data
1084003939_1084003947 4 Left 1084003939 11:66313531-66313553 CCCGAAGGGGGCGCTGGGCCACT No data
Right 1084003947 11:66313558-66313580 CTCGCCTGCCCGGGTGGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084003947 Original CRISPR CTCGCCTGCCCGGGTGGTCG TGG Intergenic