ID: 1084003950

View in Genome Browser
Species Human (GRCh38)
Location 11:66313566-66313588
Sequence CAGAGCCGCCACGACCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084003950_1084003957 6 Left 1084003950 11:66313566-66313588 CCCGGGTGGTCGTGGCGGCTCTG No data
Right 1084003957 11:66313595-66313617 CCTAATTAGAGGCCCCCAAGAGG No data
1084003950_1084003952 -5 Left 1084003950 11:66313566-66313588 CCCGGGTGGTCGTGGCGGCTCTG No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003950_1084003962 29 Left 1084003950 11:66313566-66313588 CCCGGGTGGTCGTGGCGGCTCTG No data
Right 1084003962 11:66313618-66313640 CTGTAACTGAAAAATTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084003950 Original CRISPR CAGAGCCGCCACGACCACCC GGG (reversed) Intergenic
No off target data available for this crispr