ID: 1084003952

View in Genome Browser
Species Human (GRCh38)
Location 11:66313584-66313606
Sequence CTCTGCCCCGTCCTAATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084003940_1084003952 29 Left 1084003940 11:66313532-66313554 CCGAAGGGGGCGCTGGGCCACTC No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003950_1084003952 -5 Left 1084003950 11:66313566-66313588 CCCGGGTGGTCGTGGCGGCTCTG No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003946_1084003952 4 Left 1084003946 11:66313557-66313579 CCTCGCCTGCCCGGGTGGTCGTG No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003949_1084003952 -1 Left 1084003949 11:66313562-66313584 CCTGCCCGGGTGGTCGTGGCGGC No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003945_1084003952 7 Left 1084003945 11:66313554-66313576 CCTCCTCGCCTGCCCGGGTGGTC No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003951_1084003952 -6 Left 1084003951 11:66313567-66313589 CCGGGTGGTCGTGGCGGCTCTGC No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003939_1084003952 30 Left 1084003939 11:66313531-66313553 CCCGAAGGGGGCGCTGGGCCACT No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data
1084003942_1084003952 12 Left 1084003942 11:66313549-66313571 CCACTCCTCCTCGCCTGCCCGGG No data
Right 1084003952 11:66313584-66313606 CTCTGCCCCGTCCTAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084003952 Original CRISPR CTCTGCCCCGTCCTAATTAG AGG Intergenic
No off target data available for this crispr