ID: 1084006844

View in Genome Browser
Species Human (GRCh38)
Location 11:66327420-66327442
Sequence TGGGTGAGTGGTGGTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084006828_1084006844 13 Left 1084006828 11:66327384-66327406 CCCACATCTCCCACCAGGGTCTA No data
Right 1084006844 11:66327420-66327442 TGGGTGAGTGGTGGTGGGACAGG No data
1084006833_1084006844 3 Left 1084006833 11:66327394-66327416 CCACCAGGGTCTAGCATGGGCTG No data
Right 1084006844 11:66327420-66327442 TGGGTGAGTGGTGGTGGGACAGG No data
1084006829_1084006844 12 Left 1084006829 11:66327385-66327407 CCACATCTCCCACCAGGGTCTAG No data
Right 1084006844 11:66327420-66327442 TGGGTGAGTGGTGGTGGGACAGG No data
1084006832_1084006844 4 Left 1084006832 11:66327393-66327415 CCCACCAGGGTCTAGCATGGGCT No data
Right 1084006844 11:66327420-66327442 TGGGTGAGTGGTGGTGGGACAGG No data
1084006825_1084006844 20 Left 1084006825 11:66327377-66327399 CCAGCAACCCACATCTCCCACCA No data
Right 1084006844 11:66327420-66327442 TGGGTGAGTGGTGGTGGGACAGG No data
1084006836_1084006844 0 Left 1084006836 11:66327397-66327419 CCAGGGTCTAGCATGGGCTGGGG No data
Right 1084006844 11:66327420-66327442 TGGGTGAGTGGTGGTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084006844 Original CRISPR TGGGTGAGTGGTGGTGGGAC AGG Intergenic