ID: 1084009347

View in Genome Browser
Species Human (GRCh38)
Location 11:66338940-66338962
Sequence CCTGGTTCCAGGGGTCGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084009333_1084009347 18 Left 1084009333 11:66338899-66338921 CCTGGGTCCGAGGTCAGGTTCCA 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139
1084009335_1084009347 -2 Left 1084009335 11:66338919-66338941 CCACCTCCTACCTCTTAACCCCC 0: 1
1: 0
2: 1
3: 62
4: 573
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139
1084009336_1084009347 -5 Left 1084009336 11:66338922-66338944 CCTCCTACCTCTTAACCCCCTGG 0: 1
1: 0
2: 0
3: 22
4: 245
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139
1084009334_1084009347 11 Left 1084009334 11:66338906-66338928 CCGAGGTCAGGTTCCACCTCCTA 0: 1
1: 0
2: 3
3: 27
4: 248
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139
1084009338_1084009347 -8 Left 1084009338 11:66338925-66338947 CCTACCTCTTAACCCCCTGGTTC 0: 1
1: 0
2: 1
3: 11
4: 185
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084009347 Original CRISPR CCTGGTTCCAGGGGTCGTCC TGG Intronic