ID: 1084009347

View in Genome Browser
Species Human (GRCh38)
Location 11:66338940-66338962
Sequence CCTGGTTCCAGGGGTCGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084009338_1084009347 -8 Left 1084009338 11:66338925-66338947 CCTACCTCTTAACCCCCTGGTTC 0: 1
1: 0
2: 1
3: 11
4: 185
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139
1084009334_1084009347 11 Left 1084009334 11:66338906-66338928 CCGAGGTCAGGTTCCACCTCCTA 0: 1
1: 0
2: 3
3: 27
4: 248
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139
1084009333_1084009347 18 Left 1084009333 11:66338899-66338921 CCTGGGTCCGAGGTCAGGTTCCA 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139
1084009336_1084009347 -5 Left 1084009336 11:66338922-66338944 CCTCCTACCTCTTAACCCCCTGG 0: 1
1: 0
2: 0
3: 22
4: 245
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139
1084009335_1084009347 -2 Left 1084009335 11:66338919-66338941 CCACCTCCTACCTCTTAACCCCC 0: 1
1: 0
2: 1
3: 62
4: 573
Right 1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG 0: 1
1: 0
2: 3
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084009347 Original CRISPR CCTGGTTCCAGGGGTCGTCC TGG Intronic
900159978 1:1218886-1218908 CCTGGTACCAGCGGTCCTTCAGG + Exonic
900458155 1:2787270-2787292 CCTGGTCCCATGGGTTGTCATGG - Intronic
901656313 1:10771822-10771844 GCGGGTTCCAGGGGGAGTCCTGG - Intronic
901674730 1:10876449-10876471 CATGGTTTCAGGGTTCGTCCGGG + Intergenic
902559965 1:17271157-17271179 CCTGGATCCAGCGGTCGTTGCGG - Exonic
903908517 1:26704646-26704668 CCTGGTCCCAAGGCTGGTCCTGG - Intronic
905168789 1:36098374-36098396 CCGGGTTTCACGGGTCGCCCTGG - Exonic
905241964 1:36587260-36587282 CCTGGTTGCAGGGGTTCCCCAGG + Intergenic
905865544 1:41374440-41374462 CCTGGTACCTGGGGTCTTTCAGG - Intronic
907249756 1:53130343-53130365 CCTGGTTCCAGGGCTTGGCATGG + Intronic
910757973 1:90711150-90711172 CCTTCTTCTAGGGGTCTTCCTGG - Intergenic
910760201 1:90725369-90725391 CCTGGTGCCAGCGGTCGGCCCGG + Intergenic
922885901 1:229020204-229020226 CCTGGGACCAGGGGTAGTCCAGG + Intergenic
924593781 1:245427836-245427858 CCTGCTTCCATGGGAAGTCCTGG - Intronic
1062849128 10:729439-729461 CCTGGTTCTGTGGGCCGTCCTGG + Intergenic
1064208374 10:13344052-13344074 CCTGGTTCCAGATGACATCCTGG + Intronic
1065259940 10:23913949-23913971 CCTGGCTCCAGGGAGGGTCCAGG - Intronic
1067572458 10:47381453-47381475 CCTGTTTCCAGGAATCCTCCTGG + Intronic
1067578720 10:47425744-47425766 CCTGGTTCCATGTGTCTTCCTGG - Intergenic
1071577812 10:86742413-86742435 CCTGGTTCCAGGAACAGTCCTGG - Intergenic
1072551255 10:96479420-96479442 CCAGGTTCCAGAGATCTTCCTGG + Intronic
1077671690 11:4163582-4163604 CCTGGGTCCAGGTGTCTTTCAGG + Intergenic
1083339902 11:61952203-61952225 CTGGGCTCCAGGGGTCCTCCTGG - Intronic
1084009347 11:66338940-66338962 CCTGGTTCCAGGGGTCGTCCTGG + Intronic
1084381443 11:68815747-68815769 CGTGGTTCCAGGGAATGTCCAGG - Intronic
1084381459 11:68815812-68815834 CGTGGTTCTGGGGGACGTCCAGG - Intronic
1084381482 11:68815877-68815899 CATGGTTCCGGGGGACGTCCAGG - Intronic
1084381527 11:68816007-68816029 CGTGGTTCCGGGGGACGTCCAGG - Intronic
1085075294 11:73585772-73585794 CCTGGTTCCAGTGATTCTCCTGG - Intronic
1092137995 12:6163025-6163047 CCTGGTCCCAGGCCTGGTCCTGG - Intergenic
1092603128 12:10089071-10089093 CCTGGTTCCAAGGTTTGTCTAGG - Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1097007276 12:55928299-55928321 CCTGGTTCCAGGGGTACTGCTGG - Intronic
1099666152 12:85631774-85631796 CCTGGTTCCAGATGTGGTCTGGG + Intergenic
1106757483 13:32837388-32837410 ACTGGTTCCTGGGGTGGTCTAGG - Intergenic
1110800738 13:79691821-79691843 CATGGTTCCATGGGTTGTACAGG + Intergenic
1116338600 14:43692572-43692594 CCAGGTTCAAGGGGTAGTGCAGG + Intergenic
1119730990 14:76951051-76951073 ACTCCTTCCAGGGGGCGTCCTGG + Intergenic
1124379314 15:29151422-29151444 GCTGGGTCCAGGGGATGTCCAGG + Intronic
1125343464 15:38696657-38696679 CCTGGTTTCATGGTTCCTCCGGG - Exonic
1128263704 15:66251081-66251103 CCTGGCCCCAGGGGTCTTCTAGG - Intronic
1128732691 15:70031778-70031800 CCTGGCACCTGGGGTCCTCCTGG + Intergenic
1128889093 15:71315050-71315072 CCTGATTGCAGAGGTCATCCTGG - Intronic
1129068663 15:72932734-72932756 CCTGGTTCCAAGGGCTGTCAGGG + Intergenic
1131143638 15:89998306-89998328 CCTGCTCCCAGGGGCCTTCCTGG + Intergenic
1132678046 16:1128791-1128813 GCTGGTTCTAGGGGTCAGCCTGG - Intergenic
1136546240 16:30956741-30956763 CCGAGTTCCAGGGGTAGGCCTGG + Intergenic
1138217983 16:55222282-55222304 GCTGGCTGCTGGGGTCGTCCTGG - Intergenic
1141635513 16:85312014-85312036 CCTGGTCCCAGAGGTCGAGCTGG - Intergenic
1142281540 16:89150737-89150759 CCTGGCTCCAGGGCTCCTGCAGG - Intronic
1146280039 17:31538792-31538814 CCTGGTGCCATGAGTCCTCCAGG + Intergenic
1147610401 17:41798676-41798698 CCTGGTTGCAGGGGCTGGCCTGG - Intergenic
1148052976 17:44778198-44778220 CCTGGTTGCAGCCATCGTCCTGG + Exonic
1148209452 17:45799566-45799588 CCTGGGTCCTGGGGTCCTGCAGG - Intronic
1152230729 17:79112837-79112859 TCTGGGTCCAGGGAGCGTCCAGG + Intronic
1152800606 17:82329077-82329099 CATGTTACCAGGGGTCCTCCTGG + Intronic
1153911345 18:9708590-9708612 CCTGGTTCCCCGGGTCCCCCTGG + Intronic
1154009963 18:10565758-10565780 CCTGTTTCCAGGGGTCATGGTGG - Intergenic
1157307704 18:46529084-46529106 CTTGGTTCCTGGGGACATCCAGG - Intronic
1160797609 19:953127-953149 CCTGGTTCTAGGGGTGGTCCGGG + Intronic
1161572475 19:5038161-5038183 CCTCCTTCCAGGAGTCGACCGGG - Intronic
1163054653 19:14709200-14709222 CCTGGTTCCACAGGTTGTACAGG - Intronic
1163075481 19:14887195-14887217 CCTGCTTCCAGGGGTCCACACGG + Intergenic
1165486726 19:36101025-36101047 CCTGGTTCCAGGTGGGGTACAGG + Intronic
1165721209 19:38081359-38081381 CCTGCTTCCTGAGGTTGTCCTGG + Exonic
926635588 2:15175315-15175337 CCTCATCCCAGGGGTTGTCCTGG - Intronic
927140349 2:20125993-20126015 CATGGTTCCATGGGTTGTCTGGG - Intergenic
929832460 2:45358155-45358177 CTTGGTTCCATGGGTCCTCGTGG - Intergenic
931710863 2:64988747-64988769 CCTTCTTCCAGGGGTCCTCAGGG - Intronic
935039682 2:99414256-99414278 ACTGGTTCCAGAGGTTTTCCTGG - Intronic
936428398 2:112437493-112437515 CCTGGTCTCAGGGCTCCTCCAGG + Intergenic
937083790 2:119157953-119157975 CCTGGACCCAGGGGCCCTCCGGG - Exonic
945062736 2:205923301-205923323 CCTGGTGCCTAGGGTGGTCCTGG - Intergenic
947362169 2:229357047-229357069 CCTGGTTCCAGGACTCCTCTTGG + Intergenic
948687308 2:239677381-239677403 CCTGGTTCCTGGGCTCCACCTGG + Intergenic
1170507719 20:17045514-17045536 CCTGGTTCTAGGGGCTTTCCTGG - Intergenic
1171752872 20:29071644-29071666 CCTGGTTCCATGGGCTGTACAGG + Intergenic
1171789392 20:29505922-29505944 CCTGGTTCCATGGGCTGTACAGG - Intergenic
1173711723 20:45163260-45163282 CCTGGCTCCAGGGGTGGGTCTGG + Intergenic
1174175135 20:48639814-48639836 GGAGGTTCCAGGGGTCCTCCTGG + Exonic
1174795976 20:53522854-53522876 CCTGAGTCCAGGGGTGGACCTGG - Intergenic
1175912477 20:62411358-62411380 CCTGGTTCCTGCGATGGTCCGGG + Intronic
1175934295 20:62508013-62508035 TTTGGTTCCAGGAGGCGTCCAGG + Intergenic
1175999211 20:62824603-62824625 CCTGGTTCCAGGGTTGCCCCAGG + Intronic
1176373853 21:6077718-6077740 CCTGGTCTCAGGGCTCCTCCAGG - Intergenic
1179749624 21:43460525-43460547 CCTGGTCTCAGGGCTCCTCCAGG + Intergenic
1180409666 22:12593703-12593725 CCTGGTTCCATGGGCTGTACAGG + Intergenic
1180957517 22:19747557-19747579 ACTGGTTCCATGAGTTGTCCAGG - Intergenic
1184373189 22:44095744-44095766 CCTGGTTCGAAGGGAAGTCCCGG + Intronic
1184788190 22:46682084-46682106 CCTGGTTCCAGGGGTTTTGAGGG - Intergenic
1185029454 22:48433950-48433972 CCTCTTTCCAGGGCTCCTCCTGG + Intergenic
1185385447 22:50529680-50529702 CCCGGTTCCCGGGGTCATCAAGG + Exonic
949590066 3:5484860-5484882 CCTGGTGCCAGGGGTGGGCTAGG + Intergenic
949977876 3:9477278-9477300 GCTGGCTCCAGGGCTCCTCCAGG - Exonic
953372182 3:42398026-42398048 CCGGTTTCCACGGGTCTTCCAGG + Intronic
953875149 3:46662427-46662449 CCCGGTCCCTGGGGTCGCCCTGG - Intergenic
954194664 3:48989594-48989616 CCTGATGCCAGGGCTCCTCCAGG + Intergenic
954509460 3:51109702-51109724 CCAGGTTCCAGTGGTCCACCTGG - Intronic
956309513 3:67863675-67863697 CCTGGTTGCAGGCTTCTTCCAGG + Intergenic
958614743 3:96478099-96478121 CCGGGTTCAAGGGATCCTCCTGG + Intergenic
961313170 3:126016666-126016688 CCTGGTTCTAGGGGCCTTCATGG + Intronic
964475298 3:157092435-157092457 CCTGGTCCCAGGGGTCTCCTCGG - Intergenic
965369259 3:167840592-167840614 CCTGGTTCCATGGCTCTTCTGGG - Intergenic
968844417 4:3031992-3032014 CCTGGAGCCAGGGGTCAGCCTGG + Intronic
973711056 4:53630962-53630984 CCTGGTTGCAGAGGTCAACCTGG + Intronic
974929186 4:68342169-68342191 CATGGTTCCAGGGCTCAACCGGG + Intronic
975195326 4:71518002-71518024 CTTGGTTCAAGGAGTCTTCCTGG + Intronic
978813328 4:112875404-112875426 CCTGGTTCAAGTGATCCTCCTGG + Intronic
979968385 4:127105126-127105148 CCTGATTCCTGAGGTTGTCCAGG + Intergenic
984803111 4:183732625-183732647 CCTGGTTACAGGGCTCGGGCAGG - Intergenic
986214760 5:5708974-5708996 TCTGGTTCTAGGGTTCTTCCTGG - Intergenic
992663437 5:78984058-78984080 CCTGCATCCACTGGTCGTCCCGG - Intronic
992827970 5:80569036-80569058 CCTGGTTCCAGGGGTCGGCGGGG - Exonic
997419036 5:133751218-133751240 CCTGTTTCCTGGGGTCTTCTTGG - Intergenic
1002436705 5:179235955-179235977 CCTGGTCCCAGGTGCCCTCCTGG + Intronic
1004353481 6:14911470-14911492 CATGGTTCCAGAGGTTGTACAGG - Intergenic
1007288250 6:40763724-40763746 CCTGGTTCCAGTTGTCTGCCTGG - Intergenic
1008007163 6:46423043-46423065 CTTGGTTCCTGGGGAGGTCCAGG + Intronic
1010037228 6:71340369-71340391 CCTGGTTCCAGGAGGTGGCCTGG - Intergenic
1012549661 6:100455368-100455390 CCTGGTCCCTGGGGTCCTCCTGG + Intronic
1014703666 6:124720752-124720774 CCTGGTTCCTGGGATCCTCTGGG - Intronic
1017775338 6:157676146-157676168 CCTGCTTCCTGGGGCCCTCCCGG - Exonic
1017949942 6:159128066-159128088 CCTGGTTCCAGGGATGTTTCTGG - Intergenic
1017989867 6:159476939-159476961 CCTGGTGACAGGGCTCTTCCAGG - Intergenic
1019625525 7:2013964-2013986 CCTGGCTCCAGGGTTCTCCCAGG - Intronic
1022908661 7:34879462-34879484 CCTGGTGCCAGGGGTCTCCCTGG + Intergenic
1023185070 7:37524546-37524568 CCAGTTTCCAGGGGTCCTTCAGG - Intergenic
1026629036 7:72021663-72021685 CCTGGTCCCAGAGGACATCCAGG - Intronic
1028662276 7:93292931-93292953 CATGGTCCCAGGGGTAGTACAGG - Intronic
1028753709 7:94410895-94410917 CCTGGTTCTCGTGGTCTTCCTGG + Exonic
1032826292 7:135571957-135571979 CCTGGTTCAAGCGTTCTTCCTGG + Intronic
1034196859 7:149254715-149254737 GCTGGTTCCAGGGCTCGTCCCGG + Exonic
1034400843 7:150860561-150860583 GCGGGTGCCAGGGGTCGTTCTGG - Exonic
1035472694 7:159120301-159120323 CCTGGTGCAGAGGGTCGTCCAGG + Intronic
1037745867 8:21643576-21643598 GATGGTTCCAGGGGGCATCCAGG - Intergenic
1037960308 8:23092783-23092805 CCTGGTTTCTGGGGAAGTCCTGG + Intronic
1038379599 8:27080116-27080138 TCTGGTTCCTGGGGTGGGCCAGG - Intergenic
1038404387 8:27310845-27310867 CCTGGTGTCGGGGGTCGGCCTGG + Exonic
1049433837 8:142577258-142577280 CCGGGGTTCAGGGGCCGTCCTGG - Intergenic
1049481356 8:142825185-142825207 CCTGGAGCCAGGGATCCTCCAGG + Intergenic
1049673261 8:143878892-143878914 GCTGGGTCCAGGGGTCTTCAAGG + Intergenic
1050115577 9:2259862-2259884 CCTGATTCCTGGGCTCCTCCAGG - Intergenic
1052459140 9:28741075-28741097 ACTGGATCCAGGGGTGGGCCTGG + Intergenic
1053724393 9:40983733-40983755 CCTGGTTCCATGGGCTGTACAGG + Intergenic
1060221374 9:121765787-121765809 CCTGGTTCCACTGGGCATCCTGG - Intronic
1060831945 9:126722696-126722718 TCTGGTTCCCGGGGCCTTCCCGG - Intergenic
1060942894 9:127553472-127553494 CCAGGTACCAGGGGTGGCCCTGG + Intronic
1203450402 Un_GL000219v1:108236-108258 CCTGGTTCCATGGGCTGTACAGG - Intergenic
1190337405 X:49270520-49270542 CCTGGATCCGGGGCTCGGCCTGG + Exonic
1191007336 X:55723648-55723670 CCTGGTTCAAGGGATTCTCCTGG + Intronic
1198388174 X:136147810-136147832 CCGGGGGCCAGGGGCCGTCCCGG + Intronic
1200328080 X:155263976-155263998 CCTGGTTCTAGGTGCGGTCCAGG - Intronic