ID: 1084009598

View in Genome Browser
Species Human (GRCh38)
Location 11:66340209-66340231
Sequence CTCTGGGTCTCGGGGCAGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084009598_1084009608 3 Left 1084009598 11:66340209-66340231 CCATTCTGCCCCGAGACCCAGAG 0: 1
1: 0
2: 2
3: 24
4: 232
Right 1084009608 11:66340235-66340257 GAATTGGGGTGCTGGCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 111
1084009598_1084009607 -5 Left 1084009598 11:66340209-66340231 CCATTCTGCCCCGAGACCCAGAG 0: 1
1: 0
2: 2
3: 24
4: 232
Right 1084009607 11:66340227-66340249 CAGAGTTAGAATTGGGGTGCTGG 0: 1
1: 0
2: 3
3: 17
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084009598 Original CRISPR CTCTGGGTCTCGGGGCAGAA TGG (reversed) Exonic
900120686 1:1047490-1047512 CTCTGGGTATCTGGGGAGGAAGG - Intronic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
901405116 1:9040108-9040130 CTGGGGCTCTCGGGGAAGAAGGG + Exonic
902242450 1:15098152-15098174 GTCTGGGTCACGGCGCAGCACGG - Intronic
903795154 1:25923059-25923081 CTCCGGGTCTCGGAGCAGGCTGG + Intergenic
905282964 1:36860670-36860692 CTCTGGGTCTGGGGGCAGGGTGG + Intronic
905636796 1:39559428-39559450 CTCTGGGTCCAGGGTCAGAAGGG + Intergenic
905904829 1:41611065-41611087 CTCAGGGTGTGGGGGCAGAAGGG + Intronic
906247784 1:44289313-44289335 CTATGGGTCTAAGGCCAGAAAGG + Intronic
906377157 1:45304623-45304645 CTCTGAGTGCTGGGGCAGAATGG - Intronic
907517266 1:55000575-55000597 CTCAGGGTTTCAGGGAAGAAGGG + Intronic
907626224 1:56032700-56032722 CTCTGGGTCTGGGAGGATAATGG + Intergenic
910429375 1:87146292-87146314 TTCTATGTCTCGGGGCTGAAAGG - Intronic
912497452 1:110100690-110100712 CTCTGGGTTCCAGGGGAGAAGGG + Intergenic
915281469 1:154825270-154825292 TTCTGAGTCACGGGGCAGAAGGG - Intronic
915980601 1:160417537-160417559 CTCTGGGTCTCTGGTCTGCAAGG - Intronic
917974163 1:180228966-180228988 GGCTGGGTCTTGGGGCAGACGGG + Intergenic
921706217 1:218324456-218324478 CTCAGGGACGCGGGGCACAAGGG + Intronic
921951963 1:220939415-220939437 TTCTGGGCCTCGGGGCCCAATGG - Intergenic
922968814 1:229716926-229716948 CTCTGAGTCTCAGGACTGAAAGG - Intergenic
1067748980 10:48957599-48957621 CCCAAGGTCTCGAGGCAGAAAGG - Intronic
1068876216 10:61999492-61999514 CTCTTGGTCTCGTGGCTGACTGG + Intronic
1069798612 10:71068900-71068922 CCCTGGGTCTCCGGTCTGAAGGG - Intergenic
1069909876 10:71752513-71752535 GGCTGGGTCTAGGGGCAGAGGGG - Intronic
1070089179 10:73267994-73268016 CTCTGGTGGTGGGGGCAGAAAGG - Intronic
1070750905 10:78963517-78963539 CTCTGGGCCTTGGGGCTGACTGG - Intergenic
1071517166 10:86305766-86305788 CTCTGGCCCTCTGGGGAGAAAGG + Intronic
1072568741 10:96640379-96640401 CTCTGAGGCTCTGGGTAGAATGG - Intronic
1073585751 10:104708405-104708427 GTCTGGGTCTCTTGGGAGAAAGG - Intronic
1074246578 10:111699795-111699817 CTTTGGGTCAAGGGGCAAAAGGG - Intergenic
1074412803 10:113242764-113242786 CTCTGGGTCTTGTGCCAGACTGG - Intergenic
1075216917 10:120544457-120544479 CTCTGTGTTGCGGGGCAGGAAGG - Intronic
1075471148 10:122690571-122690593 CTTTGGGCCTGGGGTCAGAAGGG + Intergenic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076830196 10:132990723-132990745 CTCAGGGTCTCGGGGCTGGCGGG - Intergenic
1076830206 10:132990758-132990780 CTCAGGGTCTCGGGGCTGGCGGG - Intergenic
1076830226 10:132990828-132990850 CTCAGGGTCTCGGGGCTGGCGGG - Intergenic
1076990746 11:272264-272286 CTCTGGGTCTCTGTGGGGAAGGG + Intergenic
1077082928 11:733316-733338 CTGTGTGTGTCGGGGAAGAATGG - Intergenic
1077661631 11:4073802-4073824 CTCAGGGCCTGGGGGCAGCAGGG + Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080609510 11:33891940-33891962 CTCTGGGTGTCCTGGCAGAGAGG - Exonic
1081444894 11:43121643-43121665 CTCTGGGCCTCAAGTCAGAATGG - Intergenic
1081659356 11:44878402-44878424 CTCTGGGTCTGGGGCCAGCCCGG + Intronic
1081985050 11:47295665-47295687 CTCTGAGTCTCAGGTCAGCATGG + Intronic
1082659658 11:55894735-55894757 CTCTGGGACTCGGGGATGAAAGG + Intergenic
1083633501 11:64107901-64107923 GTCTGGGGCTCAGGGAAGAATGG + Intronic
1084009598 11:66340209-66340231 CTCTGGGTCTCGGGGCAGAATGG - Exonic
1084049760 11:66592093-66592115 CTCCGGAGCTCAGGGCAGAAAGG + Exonic
1084062908 11:66687507-66687529 CTCTGGGCCTCGAGGCGGCAGGG + Exonic
1085048520 11:73367569-73367591 CTCGGGGCCTGGGGGCAGAGGGG - Exonic
1085669564 11:78449961-78449983 CTGTTGGTCTTGGGGCAGATGGG + Intronic
1089127819 11:116189751-116189773 GCCTGGGTCTCGGCTCAGAAAGG + Intergenic
1090178873 11:124676004-124676026 ATCTGGGTCTCTGTGCAGGATGG - Intronic
1090977100 11:131687767-131687789 CCCTGGGTCTGGTGGCGGAAGGG + Intronic
1091032413 11:132202654-132202676 CTCTTGGCTTCGGGGCATAATGG - Intronic
1093174308 12:15894909-15894931 ACCTGGGTCTGTGGGCAGAATGG + Intronic
1094270494 12:28609120-28609142 CTCTAGCTCTGGGAGCAGAAGGG - Intergenic
1094492153 12:30967442-30967464 CTCTGGGGCTTGAGGCAGAGAGG + Intronic
1094538728 12:31345112-31345134 CTTGAGGTCTCGAGGCAGAATGG + Intergenic
1096655718 12:53090308-53090330 CGCTGAGACTCAGGGCAGAATGG - Intergenic
1098010539 12:66046149-66046171 CTCTGGGGGTCTGGGCTGAAAGG - Intergenic
1100460265 12:94792715-94792737 CCCTGGTTCTAGGGGCAGACAGG - Intergenic
1101717163 12:107320831-107320853 CTCTGGGGATCTGGGCAGGATGG + Intronic
1102862557 12:116349397-116349419 CCCTGGCTCTCTGGGCAGGAGGG + Intergenic
1103188675 12:118982055-118982077 CTCTGGGGCACAGGCCAGAAAGG - Intronic
1103792861 12:123483979-123484001 CTGGGGGTCTCTGGGCAGAGAGG - Intronic
1103913174 12:124363066-124363088 CTCTGGGTCTCAGGGAAGCCAGG + Intronic
1105261130 13:18780144-18780166 TTCAGAGTCTCAGGGCAGAAGGG - Intergenic
1106142683 13:27024654-27024676 CTCTGGATCTCTGGGCTGACCGG - Intergenic
1106793404 13:33179764-33179786 CTCCGGGTCTCAGAGCAGGAGGG + Intronic
1107396426 13:40022831-40022853 CTGTGGGTCTAGGGCCAGGATGG + Intergenic
1113994706 14:16056543-16056565 CTCTGGCTCTCGGGGCAGATGGG - Intergenic
1117754373 14:58958787-58958809 CTCTGCCTTTCGGGGCACAAGGG - Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121261839 14:92572164-92572186 CTCTGAGACTCAGGGGAGAAGGG - Intronic
1121277810 14:92679568-92679590 ATCTGGGTCCCAGGGCAGAGGGG + Intronic
1122628100 14:103094484-103094506 CTCAGGGTCTCGAGGCAGCAGGG - Intergenic
1126066005 15:44827004-44827026 CTCGGGATCTCAGGGCACAATGG - Intergenic
1127470250 15:59283517-59283539 TACTAGGTCTTGGGGCAGAATGG - Intronic
1127485290 15:59412805-59412827 CTCTGGGCATCGGGGTAGGAAGG + Intronic
1127901905 15:63347065-63347087 CTCTGGGTCTTGGGGCTGCCAGG + Intronic
1127958600 15:63874025-63874047 GTCTGGGTCTGGGGGAAAAAAGG - Intergenic
1129866053 15:78909692-78909714 CTCCGGCTCTGGGGTCAGAAAGG - Intergenic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1131227539 15:90637795-90637817 CTCTGGGACTGGGGACAGCAGGG - Intronic
1132399982 15:101499157-101499179 TTCTCGGTCTCCAGGCAGAATGG + Intronic
1132973608 16:2700884-2700906 CTCTGGGTCTCTGTGCTGACAGG + Intronic
1132989209 16:2784536-2784558 ATCTTGGCCTCGAGGCAGAAGGG + Exonic
1133315652 16:4882170-4882192 CTCGGGGTCTGGGGGCTGCAGGG + Exonic
1133407034 16:5532874-5532896 ATCAGGGTCTCCAGGCAGAAAGG - Intergenic
1133715141 16:8440542-8440564 ATCTCGGTCTCAGCGCAGAAAGG + Intergenic
1136227718 16:28870211-28870233 CTCTGTGTCCCGGGCCAGGATGG + Intronic
1136684179 16:31984357-31984379 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1136784807 16:32927909-32927931 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1136884976 16:33925897-33925919 CTCAGGGTCTTGGGGTGGAAGGG - Intergenic
1137673362 16:50291936-50291958 GTCTGGGTCTAAGGGCAGATGGG + Intronic
1137725696 16:50655217-50655239 CTCTGGGTGTGGGGCCAGAAAGG - Intergenic
1137749258 16:50846796-50846818 CTCTTGGCCTCAGGGCAGGAAGG - Intergenic
1138448002 16:57076912-57076934 TCCTGGGTCTGGGGGCAGAATGG - Intronic
1138542968 16:57699519-57699541 CTCTGGGTCACAGGGCTGGAAGG + Intronic
1203087468 16_KI270728v1_random:1191915-1191937 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142768683 17:2081175-2081197 CTCTAGGGCTCGGGGCAGACAGG - Intronic
1142803266 17:2358182-2358204 CTCTGGGCCTCCAGTCAGAACGG + Intronic
1142865794 17:2790793-2790815 CCCTGGCCCTCGGGGCAGGACGG - Intronic
1143514864 17:7414512-7414534 CTCTGGGGCTCGGGGGAGTCTGG + Intronic
1143839630 17:9721667-9721689 CTCTGGGACTCCTGGCAGGAAGG + Intronic
1144664908 17:17095797-17095819 CTCAGGGCCTGGGGGCAGAGGGG - Intronic
1144689086 17:17247971-17247993 CTCTGATTCTGGGGGCTGAAGGG - Intronic
1144695924 17:17303773-17303795 TTCTGGGTGTCGGAGCAGTACGG + Exonic
1144957978 17:19029053-19029075 CTCTGGGTGAGGGGACAGAAAGG + Intronic
1144977180 17:19145467-19145489 CTCTGGGTGAGGGGACAGAAAGG - Intronic
1146285938 17:31574173-31574195 ACCTGGGCCTCGGGACAGAAGGG + Intronic
1147145116 17:38480051-38480073 CTCAGGGTCTCGGGGTGGAAGGG + Intronic
1147356693 17:39903918-39903940 CTCTGGGTCTCTAGAAAGAAAGG + Intergenic
1149096845 17:52853066-52853088 CTCTGGGTCCCTGGACAAAAGGG - Intergenic
1149407425 17:56368056-56368078 CTCTGGATCTGATGGCAGAATGG - Intronic
1149597393 17:57872442-57872464 CTCTGAGTCCCGAGGGAGAAAGG + Intronic
1151550568 17:74820317-74820339 CTCTGGGTCTCTGGCCACCAGGG + Intronic
1151555682 17:74845621-74845643 CTCTGGGTTTGGGGGCAGGCTGG + Intronic
1151971733 17:77460830-77460852 CCCAAGGTCTCTGGGCAGAAGGG - Intronic
1152238497 17:79150308-79150330 CTCTGGGTCAAGGGGCAGAGTGG + Intronic
1152810310 17:82378739-82378761 CTCTGGGTCGTGGGGCTGCAGGG - Intergenic
1152811084 17:82383162-82383184 CTCTTGCTTTCAGGGCAGAAAGG - Intergenic
1154136651 18:11785733-11785755 GACTGGGTCTCTGGGCAGAAGGG - Intronic
1154165913 18:12014352-12014374 CTCCGGGTCTCCGGGGAGACAGG + Exonic
1156623761 18:38884143-38884165 TTCTGGGTCAGGGGACAGAAAGG - Intergenic
1160793802 19:934672-934694 CTCTGGGTCTTGCGGGAGACGGG + Intronic
1161021549 19:2013793-2013815 CACTGGGTCTGGAGGCAGCAGGG + Intronic
1161327658 19:3671309-3671331 CACTGGGTCCCGGGGCCGTAGGG - Intronic
1161795447 19:6383677-6383699 TTGAGGGACTCGGGGCAGAACGG - Intronic
1162018792 19:7859438-7859460 CTCTGGGCCTGGGGGCGGAGGGG - Intronic
1164245141 19:23421908-23421930 TTCTGGGTCTGAGGGCAGGAAGG - Intergenic
1166544795 19:43627524-43627546 TCCTGGGTCTCGGAGAAGAAAGG - Intronic
1167257839 19:48442006-48442028 CCCTGGGTTCCGGGGAAGAAAGG + Intronic
1167327733 19:48835751-48835773 CTCTGGGTCTGAGGGAGGAAGGG + Intronic
1167673111 19:50867147-50867169 CCCTGGGTCTTGGGGGATAATGG + Intronic
927450077 2:23201511-23201533 ATCTGGGTCTCTGGTCATAAAGG + Intergenic
927887966 2:26730149-26730171 GGCTGGGTCTCATGGCAGAAAGG + Exonic
932732859 2:74232889-74232911 GTTTGGGTCTCTGGGGAGAAGGG + Intronic
932753952 2:74391931-74391953 CTCTGGGCCTCTGGGCCGAAGGG - Intronic
933817377 2:86079239-86079261 CTCTGGGACTCCAGCCAGAAGGG - Intronic
934491712 2:94765702-94765724 TTCAGAGGCTCGGGGCAGAAGGG - Intergenic
934762823 2:96865757-96865779 CACTCGGTCTGGGGGCAGAAAGG + Exonic
935332723 2:101988788-101988810 CTCTGGGTCTCGTGGGAGGGGGG + Intergenic
937081385 2:119142508-119142530 CTTTGAGTTTGGGGGCAGAAAGG - Intergenic
937747505 2:125431995-125432017 CTCTGGGTGACTGAGCAGAAAGG + Intergenic
938536765 2:132254213-132254235 CTCTGGCTCTCGGGGCAGGTGGG + Intronic
940997060 2:160160879-160160901 CTCTGGGTCTCACAGCACAAGGG - Intronic
942276245 2:174326188-174326210 CTCTTGGTCTCGGCGGGGAAAGG - Intergenic
947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG + Intronic
948326835 2:237128490-237128512 CTCTGAGTCACAGGGCAGCAGGG + Intergenic
1169786581 20:9365957-9365979 CTCTGGTGCTCAGGGCAGATGGG + Intronic
1172094461 20:32453864-32453886 CTATGGCTCTCGTGGCAGCAGGG - Intronic
1173904162 20:46613755-46613777 CAGCGGGGCTCGGGGCAGAAGGG + Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174413998 20:50355294-50355316 CTCTGGGTCGCTGGGCTGATAGG - Intergenic
1175719676 20:61278533-61278555 CTCTGCCTCTCAGAGCAGAAGGG - Intronic
1175873417 20:62218871-62218893 CCCTGGGCCTGGGGGCAGGAGGG + Intronic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1179538638 21:42068975-42068997 CTCAGGGCCTCTGTGCAGAAAGG - Intronic
1179840596 21:44070485-44070507 CTCAGGCTCTCAGGGCAGAGCGG + Intronic
1179983264 21:44907326-44907348 CTCTGCCTCTAGCGGCAGAAAGG + Intronic
1180312386 22:11250866-11250888 CTCTGGCTCTCGGGGCAGATGGG + Intergenic
1183093916 22:35541119-35541141 CTCTCGGGCTGGGGGCAGAGAGG - Exonic
1183508550 22:38222276-38222298 CTCAGGGGCTCAGAGCAGAAAGG + Intronic
1184466600 22:44672174-44672196 CTCTGGGGCAGGGGACAGAAGGG - Intronic
1185019565 22:48366308-48366330 CTCTGTGCCACGGGGTAGAAAGG - Intergenic
1185272152 22:49934644-49934666 CTGGGGGTCGGGGGGCAGAAGGG + Intergenic
1185323854 22:50216126-50216148 CTCTGGGTTTCTAGGGAGAATGG + Intronic
950407701 3:12815071-12815093 GTCTGTGGCTCGGGGGAGAAGGG - Intronic
951204102 3:19907947-19907969 CTCTGGGTCTAAGGGCAAATTGG + Intronic
953473511 3:43186194-43186216 GTCTGGATCTTGGGGCAGGAAGG - Intergenic
953598250 3:44338139-44338161 CGCTGGATCTTGGGGAAGAAGGG - Intronic
954141404 3:48608591-48608613 CCCTGGGGCTGGGGGCTGAAAGG + Intronic
954691137 3:52396281-52396303 CTCAGGGTCCCTGGGCAGGAGGG + Intronic
954796538 3:53164143-53164165 CTCTGTGTCTCCTGGCTGAAAGG - Intronic
956754126 3:72368541-72368563 GTCTGGGTCGCGGGGCAGCCGGG + Intergenic
963121661 3:141781857-141781879 CTCTGAGTCTCTGTGCACAAAGG + Intronic
963427442 3:145149615-145149637 GTCTAGGTCTAGAGGCAGAATGG + Intergenic
966910232 3:184555529-184555551 CCCTGTGTCTCTGGGCAGCACGG - Intronic
967035440 3:185645702-185645724 CTCTGGGGCTTGGGGATGAAGGG + Intronic
968079401 3:195835860-195835882 CTCTGGCTCTTGGGGAGGAAGGG - Intergenic
968457721 4:707439-707461 CTCAGGGTCCCGGGGGAGACGGG - Intronic
968568216 4:1326108-1326130 CTATGCGTGTCGGGGCAGCAAGG + Intronic
968880294 4:3295067-3295089 ATGAGGGTCTCGGGGAAGAAGGG + Intronic
968910034 4:3472927-3472949 CGGTGGGTCTCGAGGCAGCAGGG + Intronic
969087805 4:4669484-4669506 CTCTAAGTCTCTGAGCAGAAAGG + Intergenic
969243357 4:5916475-5916497 CTCTGTGTCCTGGGGAAGAAGGG - Intronic
973048960 4:45571136-45571158 CTCTGGGCCTCTGGCAAGAATGG + Intergenic
975950525 4:79764512-79764534 CTCTGTGTTTGAGGGCAGAAGGG + Intergenic
976523650 4:86059984-86060006 CTCTGGGAATCAGGGCAGAGAGG - Intronic
978189734 4:105896831-105896853 CTTTGGGCCTGGGGGTAGAAAGG + Intronic
980613250 4:135185004-135185026 CGATGGGGGTCGGGGCAGAAAGG + Intergenic
982124686 4:152174413-152174435 CTCTGGGTCTCGGCACAGTCAGG - Intergenic
983763232 4:171440443-171440465 CACTGAGTGTAGGGGCAGAAGGG - Intergenic
985656694 5:1135497-1135519 CCCTGGATCCCGGGGCAGCAGGG - Intergenic
985663544 5:1169547-1169569 CTCTGGGGGTTGGGGCACAAGGG - Intergenic
986300712 5:6476436-6476458 CTCTGGGTCACGGGGCTGCTGGG + Intronic
988483500 5:31649015-31649037 CTCTGGGTTGGGGGGCAGGAGGG - Intronic
994727848 5:103457434-103457456 GTCTGGGACTAGGGGCAGAGGGG - Intergenic
995853951 5:116573978-116574000 CTCTGGGGCGCAGGGCAGAGAGG + Intronic
998590428 5:143472146-143472168 CTGTGGGTCCCTGGGCAGAGAGG - Intergenic
999984699 5:156992020-156992042 CTCTGAATCTCTGGGCTGAAAGG + Intergenic
1001829504 5:174773788-174773810 CTCTGGGCCTCAGCGCAGAAAGG + Intergenic
1002758487 6:183542-183564 CTCTGGGAGTGGGAGCAGAAGGG + Intergenic
1003092921 6:3118982-3119004 ATCGGGGTCTCGCGGCACAAAGG - Intronic
1003626306 6:7744811-7744833 CTCTGATTCTCCGGGCAGAAAGG + Intronic
1011009035 6:82682821-82682843 CTCTGGATTTTGGGGCAGAAGGG + Intergenic
1014225555 6:118842522-118842544 CTCTGCCTCTGGGGGCAGAAAGG - Intronic
1017712442 6:157182598-157182620 TGCTGCGTCTCGGGGGAGAAAGG + Intronic
1019409944 7:901965-901987 CTCTGGGGCTCCGGGCAGACGGG + Intronic
1021365524 7:19773255-19773277 CTCTGGGTCCCCAGGCAGAGCGG + Exonic
1023286843 7:38629988-38630010 CTCTGGGCCTGGGGACAAAAGGG + Intronic
1023637628 7:42228263-42228285 CTGGGTGTCTGGGGGCAGAAGGG + Intronic
1026930330 7:74220086-74220108 CTCTGGGACTCGGGGAGGGAGGG - Intronic
1029672066 7:102040204-102040226 CACTGGGTCTTGGGGTAGAGCGG + Intronic
1032020682 7:128405861-128405883 CGCGGGGTCTCGCGGCAGCATGG - Exonic
1035112961 7:156499573-156499595 TTCTGGGTCTCCGTGGAGAACGG - Intergenic
1035236548 7:157501021-157501043 CTCCGGGGCTCGGGGCATGACGG + Intergenic
1035236563 7:157501070-157501092 CTCCGGGGCTCGGGGCATGACGG + Intergenic
1035236578 7:157501119-157501141 CTCCGGGGCTCGGGGCATGACGG + Intergenic
1035236592 7:157501165-157501187 CTCCGGGGCTCGGGGCATGACGG + Intergenic
1035236607 7:157501214-157501236 CTCCGGGGCTCGGGGCATGACGG + Intergenic
1035236622 7:157501263-157501285 CTCCGGGGCTCGGGGCATGACGG + Intergenic
1035236637 7:157501312-157501334 CTCCGGGGCTCGGGGCATGACGG + Intergenic
1035659760 8:1338466-1338488 GCCTGGGTCTGGGGGCAGGAAGG + Intergenic
1037952418 8:23027866-23027888 CCCTGGGGCTGGGGACAGAATGG + Intronic
1037967383 8:23145201-23145223 CCCTGGGGCTGGGGACAGAATGG + Intronic
1041644629 8:60238856-60238878 GTCTGGGTGTCAGGGCAGATTGG - Intronic
1042598399 8:70473573-70473595 GTCTGGGGCTGGGGGGAGAAGGG - Intergenic
1042847600 8:73184264-73184286 CACTGTGTCTGGGGGCAGCAGGG + Intergenic
1042868792 8:73378924-73378946 CTCAGGGTGTCGGGCCAGCATGG + Intergenic
1049494799 8:142924629-142924651 CACTGGGTGTGGGGCCAGAAAGG - Intergenic
1053409966 9:37909557-37909579 CTCTTGTCCTTGGGGCAGAAGGG + Intronic
1056760529 9:89411524-89411546 CTCAGTGTCTCAGGGCAGCAGGG + Intronic
1057140113 9:92721581-92721603 CTGTGGGTCTTGGGTCGGAAGGG + Intronic
1058002018 9:99875622-99875644 CTATGAGTCTCAGGACAGAAAGG + Intergenic
1059713768 9:116894190-116894212 CTCTGGGTTCAGGGGCAGAAAGG - Intronic
1060214985 9:121733566-121733588 CTCTGGTTCTCAGGGCCTAAGGG - Intronic
1060719354 9:125964909-125964931 GTCCGGGTCTGGGGGCAGCATGG + Intronic
1060810694 9:126610218-126610240 CCCTGGTTCTCCGGGCAGAGTGG + Intergenic
1060819090 9:126651339-126651361 CTCGGGGTCTGGGGACAGATAGG - Intronic
1060987210 9:127826596-127826618 ATCTGGGTCTTGGGGAAGGATGG + Exonic
1061729491 9:132602566-132602588 CTCTAGGTCTGGAAGCAGAACGG - Intronic
1061899945 9:133667870-133667892 CTCTGGGACTCCGGGCAGTTGGG - Intronic
1061939590 9:133876854-133876876 TTCTGTGTCTCCTGGCAGAAAGG - Intronic
1061959906 9:133982562-133982584 CTCTGGCTGGCGGGGCAGGAGGG + Intronic
1062002975 9:134226126-134226148 CTCTGGGCCATGGGGCAGAATGG - Intergenic
1062407630 9:136404330-136404352 CTCTGGGACTGGGGGCCTAATGG + Intronic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1190729165 X:53213568-53213590 CTATGGGTATAGGGGCAGTAAGG - Intronic
1192209362 X:69117825-69117847 CTCTAGGTCTCTGGGCTGAGGGG + Intergenic
1196157311 X:112445080-112445102 ATCTGGGGCTCAGGACAGAAGGG + Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic
1200035016 X:153321309-153321331 CTCTGGCTTTCGGGGGAGGAAGG - Intergenic
1200304216 X:155008337-155008359 CTCTGGGACCCGCAGCAGAAAGG + Intronic
1201077568 Y:10199216-10199238 CTCTGGCTCTCGGGGCAGGCGGG - Intergenic