ID: 1084010589

View in Genome Browser
Species Human (GRCh38)
Location 11:66346409-66346431
Sequence TTATGAGGAGTGGCCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084010589 Original CRISPR TTATGAGGAGTGGCCCTGGA TGG (reversed) Intronic
901381970 1:8880272-8880294 TTCTAAGGCGTGGCCCTGAAAGG + Intergenic
901907679 1:12428384-12428406 TTCTTAGGAATGGCACTGGAGGG - Intronic
902692159 1:18116784-18116806 TTAAAGGGAGTGGCCCAGGAAGG + Intronic
903377058 1:22873296-22873318 TGGTCTGGAGTGGCCCTGGAGGG + Intronic
904041953 1:27590351-27590373 TTGGGAGGTGTGGGCCTGGAAGG - Intronic
904257124 1:29260863-29260885 TGATGAGGGGTGGCCCAGGGCGG - Exonic
904410412 1:30321691-30321713 TTATGAGGAGTGAGACTGGTAGG + Intergenic
906198501 1:43944782-43944804 GGATGAGGAGGAGCCCTGGATGG + Intergenic
910442597 1:87267819-87267841 GTATGAGCAGTGGCTCTGGTTGG - Intergenic
911996831 1:104776316-104776338 TTAAAATGAGTGGCCATGGACGG + Intergenic
912356195 1:109055955-109055977 TTGGGAGGAGTGGTCCTAGATGG - Intergenic
913609068 1:120493008-120493030 CTTAGAGGAGTGTCCCTGGAGGG - Intergenic
913986372 1:143569656-143569678 CTTAGAGGAGTGTCCCTGGAGGG + Intergenic
914204759 1:145517441-145517463 CTTAGAGGAGTGTCCCTGGAGGG + Intergenic
914370803 1:147022786-147022808 CTTAGAGGAGTGTCCCTGGAGGG - Intergenic
914483882 1:148090628-148090650 CTTAGAGGAGTGTCCCTGGAGGG + Intergenic
914582123 1:149028831-149028853 CTTAGAGGAGTGTCCCTGGAGGG + Intronic
914677391 1:149915612-149915634 TTAGGAAGGGAGGCCCTGGAGGG - Intronic
915175627 1:154012423-154012445 TTATGAGGGGTGGATCTGGAAGG - Intronic
915901944 1:159854143-159854165 TTCAGAGGAGTTGCCCTGGATGG + Intronic
916065925 1:161135484-161135506 TTATGAAGAGTGGGCCTAGGAGG + Intergenic
918966888 1:191362425-191362447 TTATGAGGAAGGGCATTGGAAGG + Intergenic
919019488 1:192085565-192085587 TTATGTTGGGTGGCCCTGGAGGG - Intergenic
922046299 1:221949225-221949247 TGTTGAGGAGTGGCCTTGGGAGG - Intergenic
922355614 1:224772464-224772486 TGATGAGGGGTGGGGCTGGAAGG - Intergenic
1062927005 10:1324727-1324749 TTATGGGGAGTGGGGTTGGAAGG + Intronic
1067832243 10:49616869-49616891 GGATGAAGAGAGGCCCTGGAAGG - Intronic
1068634674 10:59335518-59335540 GTTTGAGGAGTGGCGCTGGTAGG - Intronic
1069719241 10:70539288-70539310 TTCTGGGGAGTGGCCTGGGAGGG + Intronic
1073604142 10:104876943-104876965 TTAGGAGGCTTGGGCCTGGAAGG - Intronic
1076197816 10:128532743-128532765 GTAAGTGGAGTGGCCTTGGAGGG + Intergenic
1081586331 11:44386540-44386562 TGATGTTGAGTGGCCCAGGATGG - Intergenic
1082933830 11:58636457-58636479 AAATGAGGAGTGGGCCTAGAAGG + Intergenic
1084010589 11:66346409-66346431 TTATGAGGAGTGGCCCTGGATGG - Intronic
1085417075 11:76326239-76326261 TGAGGAGGAGTGGCTTTGGATGG - Intergenic
1085640493 11:78189686-78189708 TTGTGAGGGGTGGCCCCGCAGGG + Intronic
1085755833 11:79200543-79200565 TGATGAGGAGTAAGCCTGGAAGG - Intronic
1085854204 11:80157815-80157837 TTATACAGACTGGCCCTGGAAGG - Intergenic
1089317821 11:117604277-117604299 TTATGAGAAGTGGCCCAACACGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090492497 11:127177104-127177126 GTATGAGGCCTGACCCTGGAAGG - Intergenic
1094233826 12:28139771-28139793 TTAGGAGGTGTGGCCTTTGAGGG - Intronic
1094684228 12:32695014-32695036 TTGTGAGGAGTGGGCCTGGAAGG - Intronic
1096439501 12:51628319-51628341 TTATGTGGACTGGCCCTTCAAGG + Intronic
1097975132 12:65677538-65677560 TTATCAGGAGTTGCCCAGGAGGG - Intergenic
1101729498 12:107415206-107415228 TTATGTGGAGTGGCCATGGAAGG - Intronic
1102046087 12:109831322-109831344 GTAGGAGGACTGGCCCAGGAAGG - Intronic
1104099809 12:125596566-125596588 TTTTGAGGAGGGGCCCTTTAAGG - Intronic
1106559608 13:30837006-30837028 TAATGGGGAGTGGGCGTGGAAGG - Intergenic
1107336847 13:39364368-39364390 TTAGGAGGAAGGACCCTGGATGG - Intronic
1107415081 13:40192790-40192812 TCAGGAAGAGTGGCCCGGGAAGG + Intergenic
1107715270 13:43193567-43193589 ATATGAGGAGGGGCCCTGCCTGG + Intergenic
1108326411 13:49336715-49336737 CAACGAGTAGTGGCCCTGGAAGG - Intronic
1113565816 13:111319098-111319120 TTAGGAGGCGAGGCCTTGGAAGG - Intronic
1117251456 14:53943556-53943578 TTATGAGGCCTGACCCTCGAAGG - Intergenic
1120047435 14:79823779-79823801 TTATGATGTATGGCCCTGCAAGG + Intronic
1122037864 14:98961493-98961515 GCCTGAGGAGGGGCCCTGGAGGG - Intergenic
1122216118 14:100205751-100205773 TTGTGAGGACTGTCTCTGGAGGG + Intergenic
1124364256 15:29061121-29061143 GTCTGTGGGGTGGCCCTGGATGG + Intronic
1124655537 15:31503951-31503973 GCATGAGAAGTGGCCCAGGATGG - Intronic
1125606514 15:40942408-40942430 CAATGAGGGGTGGCGCTGGAAGG - Intergenic
1130514737 15:84617538-84617560 ATATGAGGGGTGGGGCTGGAGGG + Intronic
1131334502 15:91534976-91534998 TCATGAGGAGGGGCCCAAGAAGG + Intergenic
1131960407 15:97784572-97784594 TTAGGAGGTGGGGCCTTGGAAGG - Intergenic
1132215355 15:100058111-100058133 ATATGGGCAGAGGCCCTGGAGGG - Intronic
1133998590 16:10765713-10765735 TTGTGAAAAGTGGCCCTGAAAGG - Intronic
1141394335 16:83691448-83691470 TTGGGAGGAGTGGCCCTGCCTGG + Intronic
1142388555 16:89782975-89782997 GTGTGAGGAGTGGGCATGGAGGG + Intronic
1142624796 17:1185144-1185166 TTATCATCAGTGGCCCTGGGAGG - Intronic
1143385765 17:6529683-6529705 TGATGATGAGTGGTACTGGATGG - Intronic
1143509981 17:7390083-7390105 TTTGGAGCAGAGGCCCTGGAAGG + Exonic
1146428633 17:32768561-32768583 TGTTGAGGAAGGGCCCTGGAAGG + Intronic
1146592629 17:34141249-34141271 GAATAAGGAGTGGTCCTGGATGG + Intronic
1151957268 17:77386632-77386654 TGATGAGGTGTGGCCTGGGAGGG + Intronic
1154363712 18:13687527-13687549 TCTTGTGGAGTGCCCCTGGAAGG - Intronic
1155498097 18:26462132-26462154 CTCTGAGGTCTGGCCCTGGATGG + Intronic
1155737948 18:29247415-29247437 TTATGAGGAGTGGAGGTAGATGG - Intergenic
1156886257 18:42139790-42139812 TTAAGAGGTGGGGCCTTGGAAGG - Intergenic
1159938294 18:74386035-74386057 TGCTGTGGAGTGCCCCTGGAAGG + Intergenic
1163616646 19:18333064-18333086 CTAATAGGAGTGGCCTTGGAAGG - Intergenic
1164459905 19:28437791-28437813 TGCTGAGGAGTGGTCCTGGGTGG + Intergenic
1166379032 19:42344838-42344860 GTAGGAGGCGTGGCCCTGGGTGG + Intronic
1167399025 19:49252592-49252614 TTTTTAGGAGTGGGCTTGGAAGG + Intergenic
1167900969 19:52622047-52622069 TTCTGAGGAGTGGCCTGGGGAGG - Intronic
1168485463 19:56758746-56758768 TTCTGAGGATTAGCCATGGAAGG + Intergenic
925619099 2:5773458-5773480 TAAGCAGGTGTGGCCCTGGAAGG - Intergenic
927490231 2:23516502-23516524 TTATGTGCATTGTCCCTGGAGGG - Intronic
927652119 2:24919481-24919503 TTCTAAGGACTGGGCCTGGAGGG - Exonic
928213226 2:29339440-29339462 TTATGAGGGGTGGCTGCGGAGGG + Intronic
929443274 2:41982856-41982878 TTGTGCTGAGTGGCCTTGGAGGG - Intergenic
930053917 2:47237563-47237585 TGATGAGGACAGGCCCTGGTTGG + Intergenic
931384614 2:61786883-61786905 TTGAGAAGAGTGGCCCTGAAAGG + Intergenic
933042398 2:77486066-77486088 TTATTAAGTGTGTCCCTGGAAGG - Intronic
936527713 2:113253038-113253060 TGGTGATGAGTGGCCATGGATGG + Intronic
937037728 2:118795686-118795708 TTCTGAGCAGTGCCCCAGGAGGG - Intergenic
938131398 2:128718521-128718543 TCTTCAGGAGTGACCCTGGATGG + Intergenic
938319717 2:130355143-130355165 TTAAGAGGGGTGTCACTGGAAGG - Intergenic
938807738 2:134822471-134822493 TCCTGAGGCCTGGCCCTGGAAGG + Intergenic
940721117 2:157283351-157283373 TTATGAAGAGTGGCACAGGCAGG + Intronic
941915935 2:170814001-170814023 TGATGAGGGGTGGCCCGGAAGGG - Intronic
942637540 2:178024036-178024058 GTAGGGGGAGGGGCCCTGGAGGG + Intronic
946324811 2:218979921-218979943 TTAAGGGCAGTGGCCCTGGTGGG + Intergenic
1170076096 20:12420833-12420855 TAAAGAAGAGTAGCCCTGGAGGG - Intergenic
1172998032 20:39084919-39084941 TTATAAGGAGTGCCCAGGGAAGG - Intergenic
1178631488 21:34265065-34265087 TTATGAGAAGAGACTCTGGAGGG + Intergenic
1181368949 22:22401230-22401252 TTCTGAGGACTTGCCCTGCAAGG + Intergenic
1182826926 22:33273688-33273710 CTATCAGCAGTGGCCCAGGAAGG - Exonic
1184277504 22:43418574-43418596 TTTTGAGGAGTTGCAGTGGAGGG - Intronic
1184435497 22:44472265-44472287 TTAAGAGGTGTGGCCTTTGAGGG + Intergenic
950221664 3:11201007-11201029 TTCTGAGGAGAGGCCCTCAAAGG - Intronic
951589880 3:24252916-24252938 CTATGAGGAGGGGACCTGGATGG + Intronic
952051013 3:29384760-29384782 TTATGCGGAGTGGCCTGGGAAGG - Intronic
952925533 3:38316818-38316840 CTGGGAGGAGTGCCCCTGGAGGG - Intronic
954402452 3:50326111-50326133 CTATGAGGTGTGACCCTGGGAGG - Exonic
956199242 3:66689421-66689443 TTATGGAGAGTGGATCTGGAGGG - Intergenic
957191425 3:77015121-77015143 TTATGATGAGTCGCATTGGAGGG - Intronic
960574978 3:119220528-119220550 TCAGGAGGAGGGGGCCTGGAAGG + Intronic
961974402 3:131008021-131008043 CTATGTGGAGTGGGTCTGGATGG + Intronic
962246490 3:133799496-133799518 ATATGAGCAGTAGCCTTGGAAGG + Intronic
962680843 3:137798682-137798704 TTATCAGGAGTTGCCCTCTAAGG + Intergenic
964285322 3:155111398-155111420 TTTTAAAGAGTGGCCCTGGAAGG + Intronic
965263054 3:166507443-166507465 TTGTAAGGAGTTGCCCTTGAAGG - Intergenic
969279487 4:6160605-6160627 TGATGATGAGGGGTCCTGGAGGG - Intronic
971534550 4:27732631-27732653 TTATGGGGAGTAGCCATGGAGGG - Intergenic
972368042 4:38394246-38394268 CTATGAGGGGTGAGCCTGGAGGG - Intergenic
974250951 4:59382150-59382172 TTTGGTGGAGTGCCCCTGGAAGG - Intergenic
976527287 4:86108765-86108787 TTATTTTGAGTTGCCCTGGAAGG - Intronic
982307186 4:153944839-153944861 TTATAAGGTGGGGCCCTGGTGGG - Intergenic
986057557 5:4153728-4153750 TTAGGAGGATTGGCCTTGGTAGG + Intergenic
987119456 5:14753071-14753093 CCCAGAGGAGTGGCCCTGGATGG + Intronic
998140212 5:139695733-139695755 TTATGAGAGGTGGCCCTGGGTGG + Intergenic
1002078938 5:176726487-176726509 CTCAGAGGAGTGACCCTGGAAGG + Intergenic
1003056280 6:2823920-2823942 CAATGAGAAGTGGCCCAGGAAGG - Intergenic
1003804499 6:9711835-9711857 TTATTAGGAGTGGGCATGGAAGG - Intronic
1006611215 6:35295593-35295615 CTATGGGGACTGGCCCTGTAGGG + Exonic
1007523923 6:42474382-42474404 TTGGGATGAGTGGCCCTAGAAGG - Intergenic
1008405405 6:51113403-51113425 TTATCAGGGGTGGCACTGAAAGG + Intergenic
1010693535 6:78941236-78941258 TTGTGAAGAGGGGACCTGGAAGG - Exonic
1010831329 6:80534208-80534230 TTAAGAGGTGAGGCCCTGGGAGG + Intergenic
1013611864 6:111803240-111803262 TTCAGAGGAGTGCCCCTGAAGGG - Intronic
1018729140 6:166635948-166635970 TTATGTGGAATGGCCATGGGCGG - Intronic
1021894776 7:25223440-25223462 TTATGAGGGTTTGCCTTGGAGGG + Intergenic
1022054553 7:26717079-26717101 TTGTGAGAAGGGGCTCTGGAAGG - Intronic
1022282975 7:28929332-28929354 ATCTGAGGAGTGACCCTTGAAGG - Intergenic
1022769579 7:33454739-33454761 ATTTCAGGAGTGGCCCTGGAAGG + Intronic
1023058878 7:36311005-36311027 CAGGGAGGAGTGGCCCTGGAAGG - Intergenic
1024583903 7:50824268-50824290 TTAGGCTGAGTGGCCCAGGAAGG - Intergenic
1025099684 7:56124191-56124213 TTCTGAAGATTGGCCCTGGAAGG + Intergenic
1033126081 7:138708474-138708496 TTATGAATAGTGGCCATAGAGGG + Intronic
1034272205 7:149808816-149808838 TTCTGAGGAGGGGCCCTGTTAGG - Intergenic
1038844554 8:31216671-31216693 ATATGAGAAGAGGGCCTGGAGGG + Intergenic
1046742337 8:117843035-117843057 TTATGAGGATGGGGACTGGAGGG - Intronic
1048341776 8:133545598-133545620 TTAAGAGGAGTTCCCATGGAAGG - Intronic
1049452928 8:142672039-142672061 TTCTGGGGAGGGGCCCTGGCAGG - Intronic
1050216629 9:3332942-3332964 CTGTGAGGAGTGGCCATAGAGGG - Intronic
1051021895 9:12555011-12555033 TTATAAAGAGTGGCCCAAGAGGG - Intergenic
1054744783 9:68843542-68843564 TTATGATGTGTGGCCATGGAGGG - Intronic
1055217253 9:73880787-73880809 TTAGGTGGAGTGGTCATGGAGGG - Intergenic
1055742421 9:79404546-79404568 CTATGTGGAGTGGCATTGGATGG - Intergenic
1057016164 9:91654732-91654754 TTATCTGGAGTGGCCCAAGATGG + Intronic
1059490266 9:114660795-114660817 TGATGAGGAGAGGACATGGAGGG - Intergenic
1060295327 9:122339284-122339306 TTTAGAGCTGTGGCCCTGGAAGG + Intergenic
1192910999 X:75604191-75604213 TTATTAGGAGAGGCTGTGGAGGG + Intergenic
1193152695 X:78140858-78140880 TTGTGAGGAGAGCCACTGGAGGG - Intergenic
1194663080 X:96647681-96647703 TTAGGAGGAGGAGGCCTGGAGGG - Intergenic
1194980763 X:100438073-100438095 TTTTGTGGAATGCCCCTGGAAGG - Intergenic
1195025498 X:100872995-100873017 ATATGTGGAGTTTCCCTGGAGGG - Intronic
1195156430 X:102127505-102127527 TTATGTGTAGTGTCCCTGGCAGG + Exonic
1195306433 X:103587314-103587336 TTATGTGTAGTGTCCCTGGCAGG + Exonic
1198491708 X:137147611-137147633 GTATGAGCAGTGGTCCTGCAAGG + Intergenic
1198851926 X:140974194-140974216 TTAAGAGGTGTGGCCTTGGCCGG + Intergenic